CN107011444B - Method for screening hERG potassium ion channel agonist and detecting toxicity - Google Patents

Abstract

The invention relates to a method for screening hERG potassium ion channel agonist and detecting toxicity. Specifically, the invention firstly relates to a fusion protein, which contains a fragment with the length of 75-85 amino acid residues between 1-85 amino acid residues at the N end of a nematode ERG family potassium ion channel UNC-103 protein as the N end of the fusion protein; hERG or a fragment thereof comprising at least the S1-S6 transmembrane region and the circular nucleotide binding domain; and a fragment which is used as the C terminal of the fusion protein and is between the 590-829 th amino acid residues from the C terminal of the UNC-103 protein and is 240 amino acid residues in length. Also relates to polynucleotide sequences encoding the fusion proteins, related transgenic nematodes, and related screening methods and uses. The inventor firstly constructs a screening method which can identify compound molecules influencing hERG intracellular transport, screens hERG inhibitor or long QT syndrome (LQTS) related channel mutant function correction agent, and provides a new approach and method for hERG toxicological detection and screening of LQTS treatment drugs.

Description

Method for screening hERG potassium ion channel agonist and detecting toxicity

Technical Field

The invention relates to a method for screening hERG potassium ion channel agonist and detecting toxicity.

Background

Long QT syndrome (LQTS) is a type of arrhythmia disease caused by abnormal myocardial ion channels, and is characterized by prolonged myocardial repolarization time course, which is reflected in QT interval prolongation on an electrocardiogram. LQTS is susceptible to induce torsade de pointes (TdP) ventricular tachycardia, leading to palpitations, syncope, and even sudden death. LQTS can be divided into congenital and acquired species. Congenital LQTS is caused by genetic mutations, which occur mainly in KCNQ1, KCNH2 (encoding hERG potassium channel) and SCN5A plasma channel genes. The mutation of the hERG channel gene results in type II LQTS (LQTS2), accounting for about 45% of the incidence of total LQTS. Acquired LQTS mainly refers to reversible QT interval prolongation caused by medicaments, and researches show that most medicaments induce the LQTS by inhibiting hERG potassium ion channels. Current treatment of LQTS patients relies mainly on the use of beta blockers, which in severe cases require implantation of a cardiac pacemaker or left cervicothoracic sympathetic ganglion resection. However, beta blockers are effective in only a portion of patients, and implantation of a cardiac pacemaker and left cervicothoracic sympathetic ganglion resection cause trauma to the patient, affecting the quality of life of the patient. Since LOTS is mainly caused by ion channel dysfunction due to gene mutation, the direct repair of mutant channel function by small molecule chemical combination would be a very effective and safe therapeutic approach.

hERG potassium ion channel mediated cardiac rapid delayed rectifier potassium current (I)_kr) And regulates repolarization of cardiomyocytes [ Warmke, J.W.&Ganetzky, B.A family of probability channel genes related to eag in Drosophila and mammals, Proc Natl Acad Sci U S A91, 3438-. Congenital genetic mutations or some drugs can inhibit hERG potassium channel function, resulting in type II LQTS [ Curran, M.E.et al.A molecular basis for cardiac arrhythmia: HERG mutations cause QT syndrome.cell 80,795-803 (1995); sanguinetti, m.c., Jiang, c., Curran, M.E.&Keating,M.T.A mechanistic link between an inherited and an acquired cardiac arrhythmia:HERG encodes the IKr potassium channel.Cell 81,299-307(1995)；Trudeau,M.C.,Warmke,J.W.,Ganetzky,B.&Robertson,G.A.HERG,a human inward rectifier in the voltage-gated potassium channel family.Science 269,92-95 (1995); abbott, G.W.et al.MiRP1for IKr sessions channels with HERG and is associated with cardiac arrhythmia.cell 97,175-187 (1999); vandeberg, J.I.et al.hERG K (+) channels structure, function, and clinical design. physiol Rev 92, 1393-. LQTS is an arrhythmia disease with the clinical manifestations of palpitation, syncope, convulsion and even sudden death. Many compounds affect hERG channel function and lead to LQTS. These compounds can be divided into two classes according to the mechanism of action: blockers that block the function of the hERG channel on the cell membrane and inhibitors that inhibit the intracellular trafficking of hERG; since the end of the nineties of the last century, several clinical drugs have been withdrawn from the market because of their effect on the hERG channel; currently, pharmacological hERG assays are required for the development of new drugs to assess the cardiac side effects of this compound [ Vanderberg, J.I.et al.hERG K (+) channels: structure, function, and clinical design. physiol Rev 92, 1393-.

Recent studies have shown that most of the type II LQTS-related gene mutations cause hERG protein trafficking defects and retention in the endoplasmic reticulum, thereby reducing the number of channels on the cell membrane and reducing its function [ Anderson, C.L.et al. Most LQT2mutations reduce Kv11.1(hERG) current by a class 2 (differentiation-determination) mechanism 113, 365-; anderson, C.L.et al.Large-scale molecular analysis of Kv11.1 dimensions molecular instruments inter type 2long QT syndrome.Nat Commun 5,5535 (2014). Some hERG mutant channels can be transported back to the cytoplasmic membrane after treatment with blockers or low temperature conditions [ Anderson, c.l.et al.most LQT2mutations reduction kv11.1(hERG) current by a class 2 (trafficking-specification) mechanism.circulation 113, 365-; ficker, E.E., Dennis, A.T., Wang, L. & Brown, A.M.role of the cytoelastic channels Hsp70and Hsp90in mapping of the cardiac porous channel HERG.circ Res 92, e87-100(2003), and the re-membranated mutant channels are capable of exerting physiological functions corresponding to those of the wild-type channels [ Mehta, A.et.Re-flexibility of hRG reverse QT syndrome 2 codon in human iPS-derived cardiac molecular. CardioasovRes 102, 497-yo 506(2014) ]. The above phenomena suggest, on the one hand, that the hERG mutant channel can be corrected and re-transported to the cytoplasmic membrane, and, on the other hand, that corrective compounds possessing the above properties have potential clinical therapeutic effects on LQTS. However, blockers of the hERG channel cannot be used to treat LQTS because of their direct blocking effect on the hERG channel on the cell membrane. Therefore, screening of non-blocker class of orthotics compounds is an important direction for the development of novel drugs for treatment of LQTS.

There are several cellular-level assays currently in use to assess the effect of drugs on hERG function. These Methods include radioligand binding experiments [ Finanalysis, K., Turnbull, L., January, C.T., Sharkey, J. & Kelly, J.S. [3H ] safe binding to HERG transformed membranes: a porous high-throughput diagnostic method 430,147-148(2001) ], ion flow monitoring [ Tang, W.et. development and evaluation of high-throughput functional method J. biomedical Screen 6,325-331(2001) ], and automated clamp system [ Guo, L. & Guthproduct, H.Automation analysis. J. biological Screen 6, 325-136 ] (cement: QT: repair, QT. 12, cement, QT. repair, QT. 12, cement, H.E. repair, QT. repair, et. 12, cement, QT. 12, cement, A. repair, 32, cement, QT, A. repair, A. 12, A. repair, A. 52, A. repair, A. repair, A. repair, A. a method, A. a method, A. A, a method, a method, a method, a method, a method. However, these monitoring devices are expensive and they generally only detect transient hERG channel blockers or agonists that act on the cell membrane, making it difficult to screen for compounds that have a longer duration of action and regulate the intracellular trafficking of the hERG channel. More importantly, no relevant screening systems have been developed for orthotics that promote the re-membrane of the trafficking-deficient mutant hERG channel.

Caenorhabditis elegans is an important model organism in biological research and is also commonly used for analyzing the mechanism of action of drugs and searching for the target of action of drugs (Kwok, t.c. et al.a small-molecule screen in c.elegans yields a new calcium channel antagnostist. nature 441,91-95 (2006); kaletta, T. & Hengartner, M.O.Finding function in novel targets C.elegans as a model organic. Nat Rev Drug Discov 5,387-398 (2006); burns, A.R.et al.A predictive model for drug biological administration and biological activity in Caenorhabditis elegans.Nat Chem Biol 6, 549-. Recently, several high throughput screening platforms based on nematode behavior were developed for new drug screening [ Burns, a.r. et al. high-throughput screening of small molecules for bioactivities and target identification in marine diagnostics industries 1,1906-1914 (2006); leung, C.K., et al, an ultra high-throughput, a hold-animal screen for small molecular modules of a specific genetic pathway in Caenorhabditis elegans, PLoS One 8, e62166(2013) ]. There is an ERG family potassium channel UNC-103 in nematodes, which plays an important role in nematode locomotion, oviposition and mating behavior in male nematodes [ Park, E.C. & Horvitz, H.R. mutations with their dominant effects on the behavior and morphology of the nematoda Caenorhabditis elegans 113,821-852 (1986); garcia, L.R. & Sternberg, P.W.Catenorhabditis elegans UNC-103ERG-like potassium channels modulators of x muscles in muscles and enzymes and reduction of Neurosci 23,2696 2705 (2003). The hERG channel in humans is highly conserved in amino acid sequence with the UNC-103 channel of nematodes. Previous work found that the gene regulating hERG could also regulate the function of UNC-103 [ Petersen, C.I. et al. in vivo visual identification of genes that are present modification ether-a-go-go-related gene activity in nucleic acids accumulation of human cardiac arrhythmia. Proc Natl Acad Sci U S A101, 11773-11778(2004) ], suggesting that the regulatory mechanisms of ERG family potassium channels in cells are also highly conserved.

Disclosure of Invention

Provided herein is a fusion protein comprising:

a fragment which is used as the N-terminal of the fusion protein and is 75-85 amino acid residues, preferably 78-82 amino acid residues, from the 1 st to 85 th amino acid residues of the N-terminal of the nematode ERG family potassium ion channel UNC-103 protein;

hERG or a fragment thereof comprising at least the transmembrane region from S1 to S6 and the circular nucleotide binding domain; and

the C-terminal of the fusion protein is a fragment which is 220 to 240, preferably 225 to 235 amino acid residues long between 590 to 829 amino acid residues from the C-terminal of the UNC-103 protein.

In one or more embodiments, the amino acid sequence of hERG is as set forth in SEQ ID NO 18.

In one or more embodiments, the amino acid sequence of the UNC-103 protein is set forth in SEQ ID NO 19.

In one or more embodiments, the fusion protein further comprises a detectable protein or enzyme encoded by a reporter gene, such as a fluorescent protein.

In one or more embodiments, the fragment of the UNC-103 protein with the N-terminal length of 75-85 amino acid residues consists of amino acid residues from 1 st to 70 th, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84 or 85 th from the N-terminal of the UNC-103 protein.

In one or more embodiments, the fragment of UNC-103 protein N-terminal 75-85 amino acid residues in length consists of amino acid residues from position 1 to position 77, 78, 79, 80, 81 or 82 of UNC-103 protein N-terminal.

In one or more embodiments, the fragment of the UNC-103 protein with the N-terminal length of 75-85 amino acid residues at least comprises or consists of amino acid residues 1-79.

In one or more embodiments, the fragment of the UNC-103 protein, which is 220 to 240 amino acid residues long between 590 to 829 amino acid residues from the C-terminus of the UNC-103 protein, consists of any one of the amino acid residues from 590 to 605 to any one of the amino acid residues from 810 to 829 amino acid residues from the C-terminus of the UNC-103 protein.

In one or more embodiments, the fragment of the UNC-103 protein, which is 220 to 240 amino acid residues long between 590 to 829 amino acid residues from the C-terminus, contains at least 599 to 829 amino acid residues, or consists of 599 to 829 amino acid residues.

In one or more embodiments, the fragment of hERG that comprises the transmembrane region from S1 to S6 and the cyclic nucleotide binding domain comprises at least amino acid residues 408 to 889 of hERG, preferably at least amino acid residues 369 to 889 of hERG.

In one or more embodiments, the fragment of hERG comprising the S1-S6 transmembrane region and the cyclic nucleotide binding domain is at least 482 amino acid residues in length.

In one or more embodiments, the fragment of hERG comprising the S1-S6 transmembrane region and the cyclic nucleotide binding domain is a fragment of hERG between amino acids 360-900 and 510-530 amino acid residues long;

in one or more embodiments, the fragment of hERG that comprises the transmembrane region from S1 to S6 and the cyclic nucleotide binding domain consists of amino acid residues 369 to 889 or amino acid residues 1 to 889.

In one or more embodiments, the fusion protein is a fusion protein consisting of amino acid residues 1 to 79 of the N-terminal of UNC-103 protein, amino acid residues 369 to 889 of hERG, or amino acid residues 1 to 889 and amino acid residues 599 to 829 of the C-terminal of UNC-103 protein.

In one or more embodiments, there are channel gain of function mutations in the hERG or fragments thereof comprising at least the S1-S6 transmembrane region and the circular nucleotide binding domain, wherein the mutations include, but are not limited to, mutations at positions 536 and/653, such as a536W and/or a 653T.

In one or more embodiments, there are channel gain of function mutations in the hERG or fragments thereof comprising at least the S1-S6 transmembrane region and the circular nucleotide binding domain, wherein the mutations include, but are not limited to, mutations at positions 536 and/653, such as a536W and/or a 653T; and mutations that cause disorders of hERG intracellular trafficking, including but not limited to mutations at one or more of positions 31, 65, 470, 561, 601, and 818, e.g., one or more of I31S, T65P, N470D, a561V, G601S, and S818L.

Also provided herein is a polynucleotide sequence selected from the group consisting of:

(a) a polynucleotide sequence encoding a fusion protein described herein; and

(b) a sequence complementary to the polynucleotide sequence of (a).

Also provided herein is an expression vector comprising a polynucleotide sequence described herein.

Also provided herein is a genetically engineered cell or transgenic nematode comprising a polynucleotide sequence as described herein or having an expression vector as described herein incorporated therein, preferably the transgenic nematode has one or more of the following characteristics:

(i) the polynucleotide sequence is integrated into the genome of the transgenic nematode;

(ii) the transgenic nematode expresses a fusion protein in which there is a gain-of-channel-function mutation in the hERG described herein and preferably a mutation that results in a dysfunction of its intracellular trafficking; and

(iii) the transgenic nematode is acs-20 gene defective nematode.

Also provided herein is a method of screening for an hERG channel inhibitor, the method comprising: co-incubating a compound to be screened with a transgenic nematode expressing a fusion protein according to claim 3 item (1), and observing and comparing the behavioral performance of the nematode before and after co-incubation, wherein a compound that improves or restores the behavioral deficits (e.g. dyskinesia and/or egg laying) of the nematode before co-incubation compared to before co-incubation is identified as an inhibitor of the hERG channel.

Also provided herein is a method of screening for an LQTS-related hERG mutant channel function-correcting agent, the method comprising: co-incubating a compound to be screened with a transgenic nematode expressing a fusion protein according to claim 3 (2), and observing and comparing the behavioral performance of the nematode before and after co-incubation, wherein after co-incubation a behavioral defect (such as dyskinesia and/or egg production) is imparted to the nematode compared to before co-incubation, and preferably a compound that allows transport of the fusion protein to the plasma membrane of the cell is identified as an LQTS-associated hERG mutant channel function corrector.

Also provided herein is a method for detecting the pharmacological effect of hERG, the method comprising: co-incubating a compound to be screened with a transgenic nematode expressing a fusion protein according to claim 3 item (1), and observing and comparing the behavioral performance of the nematode before and after co-incubation, wherein a compound that improves or restores the behavioral deficits (e.g. dyskinesia and/or egg laying) of the nematode before co-incubation compared to before co-incubation is identified as a compound that inhibits hERG channel function, with potential side effects leading to LQTS.

In one or more embodiments, the above methods are used for screening using a transgenic nematode as described herein.

In one or more embodiments, the co-incubation comprises: co-incubating the test mixture with a transgenic nematode, preferably a nematode of stage L4, in a nematode medium (e.g., NGM) preferably containing an inducing agent (e.g., IPTG) and an antibiotic (e.g., carbenicillin);

in one or more embodiments, the test compound is added to the nematode culture medium several days after inoculating the RNAi bacteria targeting ifd-2 and c15c7.5 genes in the culture medium, and the transgenic nematode (preferably a nematode of stage L4) is inoculated into the culture medium several hours later.

Also provided herein is the use of a PKC epsilon agonist, preferably Prostratin and Ingenol 3,20-dibenzoate (idb), in the manufacture of a substance for use in the correction of LQTS-related hERG mutant channel function or in the manufacture of a medicament for the treatment of LQTS, especially type II LQTS.

Also provided herein is the following use of the fusion proteins, polynucleotides, expression vectors, genetically engineered cells, or transgenic nematodes described herein:

(1) for screening for hERG channel inhibitors;

(2) screening hERG mutant channel function correcting agent related to LQTS; and

(3) the kit is used for detecting the pharmacological action of hERG.

Drawings

FIG. 1: chimeric channel hERG of C-terminal fusion GFP protein^{chimera/A536W}Expression in wild type nematodes results in significant behavioral deficits in the nematode. A: hERG chimeric channel hERG^{chimera/A536W}Schematic, the a536W mutation point is marked with an arrow; b: under-lens wild type N2 nematode and transgenic nematode hERG^{chimera/A536W}Behavioral graphs, arrows indicate nematode eggs; c: wild type N2 nematode and transgenic nematode hERG^{chimera/A536W}Statistical diagram of head swing behavior of<0.001; d: wild type N2 nematode and transgenic nematode hERG^{chimera/A536W}Statistical plot of egg laying ability of<0.001; e: under-fluoroscopic hERG^{chimera/A536W}GFP (green) and mCherry protein (red) expression patterns in nematodes, with arrows indicating head neurons of the nematodes and a scale bar length of 10 μm; f: the hERG channel whole cell current diagram expressed in 293T cells under DMSO or hERG inhibitor treatment conditions, the stimulation membrane potential is shown in the upper right, and the time course current within the dotted line is shown in the left; g: nematology after treatment with DMSO or hERG inhibitors under the scope of the mirror.

FIG. 2: screening for inhibitors that block intracellular trafficking of the hERG channel from a library of small molecules. A: a schematic diagram of a screening strategy workflow; b: chemical structural formula of hazy wood acid (alphitolic acid); c: nematology plots after treatment with DMSO or dimly mucic acid under the scope of the body, arrows indicate nematode eggs; d: transient effects on hERG channel current after treatment with haze wood acid, a schematic diagram of hERG channel whole-cell current expressed in 293T cells under DMSO or haze wood acid transient treatment conditions is given in the figure; e: the long-term effect of the treated haze wood acid on the hERG channel current is shown in the figure, which shows a schematic diagram of the hERG channel whole-cell current expressed in 293T cells under the DMSO or haze wood acid long-term treatment condition (24h after dosing); f: influence on a current-voltage curve (I-V curve) of an hERG channel after treatment of hazy wood acid; g: change of hERG potassium channel current density under long-time treatment condition of hazy wood acid with different concentrations; h: effect of long-term treatment of haze wood acids on hERG channel intracellular trafficking. Plasmid HA-hERG was transfected into 293T cells, two arrows indicate high molecular weight (155kD, fully glycosylated form) and low molecular weight (135kD, core glycosylated form) hERG bands, respectively, and HA antibody was used for final visualization.

FIG. 3: screening of the mutation-promoting channel hERG from a library of small molecule compounds^A561VAnd (4) a re-membranaceous curable compound. A: hERG chimeric channel hERG^{chimera/A536W/A561V}Schematic representation, the two mutation points a536W and a561V are marked with red and black arrows, respectively; b: hERG^{chimera/A536W}And hERG^{chimera/A536W/A561V}Positioning the protein in nematode cells, wherein the length of a scale bar is 10 mu m; c: screening for the promoted mutation channel hERG^A561VA workflow diagram for a re-membranous curable compound.

FIG. 4: prostratin and IDB repair of hERG^{chimera/W536A/A561V}Nematode hERG mutant protein transport defects. Prostratin and IDB treatment of hERG^{chimera/W536A/A561V}Microscope images of nematodes and hERG after 10. mu.M Prostratin and 10. mu.M IDB treatment^{chimera/W536A/A561V}Localization of proteins within nematode neuronal cells. Arrows indicate nematode cranial neurons. The scale indicates 10 μm.

FIG. 5: prostratin and IDB repair the hERGA561V transport defect. A: structural formulas of Prostratin and IDB compounds; b: prostratin (3uM) and IDB (2uM) on hERG-hERG^A561V(ratio 3:1) an example current diagram of the effect of current; c: prostratin and IDB treatment to increase hERG-hERG^A561VChannel current density. hERG and hERG^A561VExpressed in HEK293T cells at a 3:1 ratio; d: different concentrations of Prostratin and IDB on hERG-hERG^A561V(ratio 3:1) influence of channel current density; e: prostratin and IDB treatment to increase hERG-hERG^A561V(hERG/hERG^A561VThe ratio is 1:1) endoplasmic reticulum yielding efficiency; f: effects of Prostratin and IDB treatment on the current of other transport-deficient hERG mutants, which were expressed in HEK293T cells at a 1:1 ratio.

FIG. 6: prostratin and IDB do not affect wild-type hERG function. A and B: effects on wild-type hERG current after transient IDB and Prostratin treatments (where the upper panel is the effect before treatment and the lower panel is the effect after treatment); c and D: long time course (24h) effect on wild type hERG current after IDB and Prostratin treatment; e and F: western Blot analysis of the effects of IDB and Prostratin long-term treatment on wild type hERG protein; the compound concentration IDB was 2uM and Prostratin was 3 uM.

FIG. 7: prostratin and IDB on hERG^A561VThe modulation of (c) is dependent on the activation of PKC epsilon. A: PKC epsilon siRNA treatment was significantly reducedProtein amounts of PKC epsilon in HEK293T cells; b: reduction of PKC epsilon protein expression abolishes the inhibition of both Prostratin and IDB on hERG-hERG^A561V(hERG/hERG^A561VRatio of 3:1) influence of current; c: PKC epsilon siRNA treatment with Prostratin and IDB on hERG/hERG^A561V(ratio 1:1) influence of protein amount.

FIG. 8: prostratin and IDB repair of hERG in hiPSC-derived cardiomyocytes^A561VThe function of (c). A: expression of hERG^A561VEffect on endogenous Ikr Current (hERG channel mediated) in hiPSC-derived cardiomyocytes, and the expression of hERG by Prostratin and IDB^A561VThe influence of Ikr current in hiPSC-derived cardiomyocytes, Cs for Ikr current⁺Recording a channel method; b: ikr current density analysis; c: expression of hERG in hiPSC-derived cardiomyocytes^A561VAnd then ventricular-type and atrial-type cardiomyocyte action potentials after Prostratin and IDB processing; d: statistical analysis of APD90 in different conditions of hiPSC-derived cardiomyocytes<0.001。

FIG. 9: prostratin and IDB abrogate hERG expression in hiPSC-derived cardiomyocytes^A561VThe caused EAD phenomenon. A: expression of hERG by hiPSC-derived cardiomyocytes^A561VCan make atrial and ventricular cardiac muscle cell produce EAD; b: statistical plots of the proportions of EAD were generated for hipSC-derived cardiomyocytes under different treatment conditions.

FIG. 10: prostratin and IDB did not affect the action potential time course of hiPSC-derived wild-type cardiomyocytes. Statistical plots of the effect of Prostratin and IDB treatment on wild-type hiPSC-CM cardiomyocyte action potential APD 90.

FIG. 11: UNC-103 and hERG sequence alignment.

FIG. 12: the experiment result of the expression of the fusion protein containing the hERG 1-889 amino acid residues in wild nematode N2. A: body style subspecular hERG^{chimera/A536W}(hERG 1-889) behavior pattern of transgenic nematodes; b: body style subspecular hERG^{chimera /A536W/A561V}(hERG 1-889) behavior pattern of transgenic nematodes; c: wild type N2 nematode and transgenic nematode hERG^{chimera/A536W}Statistical analysis of head swing behavior of (hERG 1-889). about.P<0.001 (second row left panel); d: wild type N2 nematode and transgenic lineInsect hERG^{chimera/A536W}(hERG 1-889) oviposition ability statistical map, P<0.001 (second row right).

Detailed Description

Herein, the inventors constructed nematode transgenic animal models and used to screen for inhibitors of hERG channel function and compounds that correct LQTS-related hERG mutant channel function (corecters). The inventors expressed hERG channels or hERG mutant channels associated with LQTS in nematodes where there was an gain-of-channel-function mutation. These hERG channel nematodes expressing gain-of-channel-function mutations present very significant movement and egg-laying obstacles, and reduction of hERG channel function by inhibitors can alleviate the above-mentioned behavioral deficits in the transgenic nematodes. And the nematode expressing the hERG mutant channel can normally move and lay eggs because the hERG can not normally coat the membrane due to gene mutation, and the compound promoting the membrane on the channel can possibly cause the defects of the movement and the laying eggs of the transgenic nematode. By screening for small molecule compounds on these transgenic nematodes, the present application has discovered several novel inhibitors of the hERG channel and functionally correct compounds of the hERG mutant channel. Therefore, it is a new method to screen small molecular compounds that modulate the function of hERG ion channel.

The nematode herein may be a nematode from the genus Caenorhabditis, preferably Caenorhabditis elegans (Caenorhabditis elegans). The transgenic nematode constructed in the method can express N terminal and hERG or a fragment thereof containing transmembrane segment amino acid sequence and Cyclic Nucleotide Binding Domain (CNBD) of nematode ERG family potassium ion channel UNC-103 protein and fusion protein formed by C terminal of UNC-103 protein.

"fragment" as used herein refers to a sequence that is contiguous with a portion of the full-length sequence.

Specifically, the fusion protein comprises a fragment of 75-85, preferably 78-82 amino acid residues from the N-terminus of the UNC-103 protein as the N-terminus of the fusion protein, hERG or a fragment thereof containing S1-S6 transmembrane region and Cyclic Nucleotide Binding Domain (CNBD), and a fragment of 220-240, preferably 225-235 amino acid residues from 590-829 amino acid residues from the C-terminus of the UNC-103 protein as the C-terminus of the fusion protein.

The fragment of the UNC-103 protein with the length of 75-85 amino acid residues at the N terminal can be, for example, a fragment of the UNC-103 protein with the amino acid residues from 1 st to 70 th, 71 th, 72 th, 73 th, 74 th, 75 th, 76 th, 77 th, 78 th, 79 th, 80 th, 81 th, 82 th, 83 th, 84 th or 85 th at the N terminal, preferably the amino acid residues from 1 st to 77 th, 78 th, 79 th, 80 th, 81 th or 82 th at the N terminal, more preferably at least the amino acid residues from 1 st to 79 th, or the fragment consists of the amino acid residues from 1 st to 79 th at the N terminal.

The fragment of the UNC-103 protein with the length of 220-240 amino acid residues between 590-829 amino acid residues at the C terminal can be, for example, a fragment formed by starting from any one of 590-605 amino acid residues to any one of 810-829 amino acids of the UNC-103 protein, such as 590-810 amino acid residues, 590-820 amino acid residues, 595-825 amino acid residues, 598-828 amino acid residues, or 599-829 amino acid residues; preferably, the fragment contains at least amino acid residues 599-829.

The fragment of hERG described herein comprises at least the S1-S6 transmembrane region and the Circular Nucleotide Binding Domain (CNBD) of hERG. The transmembrane regions S1-S6 and CNBD can be as shown in FIG. 11. The fragment of the hERG containing the S1-S6 transmembrane region and the Cyclic Nucleotide Binding Domain (CNBD) at least comprises amino acid residues 408-889 of the hERG, preferably at least comprises amino acid residues 369-889 of the hERG, or consists of amino acid residues 369-889. For example, the fragment may be a fragment including at least amino acid residues 408 to 889 of amino acid residues 1 to 1000 of hERG, or a fragment including at least amino acid residues 369 to 889. For another example, the fragment may be a fragment of hERG including at least amino acid residues 408-889 from amino acid positions 360-900. Thus, the fragment of hERG that contains the transmembrane segment amino acid sequence and CNBD is at least 482 amino acid residues in length, e.g., at least 500, at least 510, at least 520, at least 550, etc. In certain embodiments, the fragment is hERG amino acid residues 1-889.

In certain embodiments, the hERG fragment is a fragment of at least 510-530 amino acid residues between 360-900 amino acids, such as any of the 360-372 amino acid residues to any of the 885-900 amino acids, e.g., 360-885 amino acid residues, 365-895 amino acid residues, 368-890 amino acid residues, 369-889 amino acid residues, etc.; preferably, the fragment contains at least amino acid residues 369-889.

In a preferred embodiment, there is a mutation that gains access to channel function in the hERG or fragment thereof containing the transmembrane amino acid sequence and CNBD. These mutations include, but are not limited to, mutations at positions 536 and/or 653. Preferred mutations are substitution mutations, such as a536W and/or a653T, that shift the activation curve of an ion channel to a more negative voltage, allow the channel to open at lower membrane potentials, cause abnormal behavior in animals, and facilitate screening of compounds that modulate hERG ion channel function.

More preferably, the hERG or its fragments containing the transmembrane amino acid sequence and CNBD also have mutations that cause intracellular trafficking disorders of hERG. These mutations include, but are not limited to, mutations at one or more of positions 31, 65, 470, 561, 601, and 818, which are known to cause hERG intracellular trafficking disorders (Anderson, C.L. et al, Large-scale molecular analysis of Kv11.1 horizontal molecular information into type 2long QT syndrome, Nat Commun 5,5535 (2014)). Preferred mutations are substitution mutations, including but not limited to one or more of I31S, T65P, N470D, a561V, G601S and S818L, but other transport-deficient LQTS-related mutants can also be used for corresponding compound screening.

In certain embodiments, the fusion protein herein consists of amino acid residues 1-79 of the N-terminus of the UNC-103 protein, amino acid residues 369-889 or amino acid residues 1-889 of hERG, and amino acid residues 599-829 of the C-terminus of the UNC-103 protein. In addition, it is understood that, although not listed herein, any of the N-terminal fragments of the UNC-103 protein described herein can be combined with any of the hERG fragments described herein and any of the C-terminal fragments of the UNC-103 protein to form a fusion protein of the invention.

The amino acid sequence of UNC-103 suitable for use herein can be as shown in SEQ ID NO 19; the amino acid sequence of hERG suitable for use herein can be shown as SEQ ID NO 18. The amino acid positions/numbering of the full length UNC-103 and hERG sequences or fragments thereof described herein are based on the amino acid positions/numbering of SEQ ID NO 18 and 19.

It is well known to those skilled in the art that in gene cloning procedures, it is often necessary to design appropriate cleavage sites, which necessitate the introduction of one or more irrelevant residues at the end of the expressed protein, without affecting the activity of the protein of interest. Also for example, to construct a fusion protein, to facilitate expression of a recombinant protein, to obtain a recombinant protein that is automatically secreted outside of a host cell, or to facilitate purification of a recombinant protein, it is often necessary to add some amino acids to the N-terminus, C-terminus, or other suitable regions within the recombinant protein, for example, including, but not limited to, a suitable linker peptide, signal peptide, leader peptide, terminal extension, glutathione S-transferase (GST), maltose E binding protein, protein a, a tag such as 6His or Flag, or a proteolytic enzyme site for factor Xa or thrombin or enterokinase. It is understood that the presence of these amino acid sequences does not affect the activity of the resulting protein. Thus, the invention also encompasses fusion proteins obtained by adding one or several amino acids (e.g.the aforementioned linker peptide, signal peptide, leader peptide, terminal extension, GST, maltose E binding protein, protein A, tags such as 6His or Flag, or proteolytic enzyme sites of factor Xa or thrombin or enterokinase, etc.) at the C-terminus and/or N-terminus of the fusion proteins of the invention, which fusion proteins still have the biological activity described herein.

In certain embodiments, one or more (e.g., within 30, within 25, within 20, within 15, within 10, within 5) amino acid mutations (including substitutions, deletions and/or insertions) may be present in the N-terminal fragment, the C-terminal fragment, and the hERG or fragments thereof of the UNC-103 protein of the fusion protein of the invention. The mutation is preferably a conservative mutation. For example, conservative substitutions with amino acids that are similar or analogous in performance will not generally alter the function of the protein or polypeptide. "amino acids with similar or analogous properties" include, for example, families of amino acid residues with analogous side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, it is preferred that each fragment or fusion protein resulting from the mutation itself still retains the biological activity described herein. For example, the N-terminal fragment and the C-terminal fragment of the UNC-103 protein obtained by mutation retain the biological activity of the N-terminal and the C-terminal of the wild-type UNC-103 on the normal upper membrane in nematode cells; the mutated hERG fragment retains the biological functions of S1-S6 and CNBD, or retains the same biological functions as the A536W or A653T mutant described herein (gain of channel function), or the same biological functions as the I31S, T65P, N470D, A561V, G601S or S818L mutant (causing hERG intracellular trafficking disorder).

In addition, it is preferred that the fusion protein herein be detected, for example, by a protein or enzyme encoded by a reporter gene, to detect where the fusion protein is located in the cell, e.g., to determine whether the fusion protein is transported to the plasma membrane of the cell. In other words, the fusion proteins herein may also include a protein or enzyme encoded by the reporter gene at its N-terminus and/or C-terminus. Such proteins or enzymes include, but are not limited to, various fluorescent proteins commonly used in the art, such as green fluorescent protein, blue fluorescent protein, yellow fluorescent protein, orange fluorescent protein, red fluorescent protein, and the like. Green fluorescent proteins also include, for example, Enhanced GFP (EGFP) and destabilized EGFP (destabilized EGFP). These proteins or enzymes can be linked to fragments of UNC-103 in the fusion protein via linker sequences. The linker sequence may be one conventional in the art, such as a GS-containing linker sequence, as long as it does not affect the overall biological function of the fusion protein.

In addition to such proteins or enzymes, the fusion proteins herein can be labeled using methods conventional in the art to facilitate detection of the location of the fusion protein in a cell, e.g., to determine whether the fusion protein is transported to the plasma membrane of the cell.

Included herein are coding sequences for the fusion proteins. For example, SEQ ID NO 1 shows the coding sequence of a fusion protein consisting of UNC-103N-terminal amino acid residues 1 to 79, hERG amino acid residues 369 to 899 and UNC-103N-terminal amino acid residues 599 to 829; SEQ ID NO 2 is the coding sequence of the aforementioned fusion protein in the presence of the A536W mutation; SEQ ID NO 3 shows the coding sequence of the aforementioned fusion protein in the presence of the A536W and A561W mutations. Degenerate isomers of SEQ ID NOs 1, 2 and 3, i.e., sequences that encode the same amino acid sequence but differ in nucleotide sequence, are included herein. Also included herein are complementary sequences to the coding sequences of the present invention. As previously described, when a protein or enzyme for detection purposes is also included in the fusion protein herein, the coding sequence herein preferably also includes a reporter gene encoding the protein or enzyme.

The coding sequences herein can be obtained by PCR amplification or recombinant methods in general. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

Included herein are nucleic acid constructs, such as cloning vectors or expression vectors, comprising the coding sequences described herein. Nucleic acid constructs will also typically contain control sequences operably linked to the coding sequences described herein for directing expression of the coding sequences in a suitable host cell.

The control sequence may be a suitable promoter. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. Suitable promoters may be various promoters known in the art, including but not limited to the lac or trp promoters of E.coli; a lambda phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs of retrovirus, and other known promoters which can control the expression of genes in prokaryotic or eukaryotic cells or viruses. A preferred promoter is that of nematode unc-103. As an example, the promoter sequence of unc-103 is shown in SEQ ID NO 4.

The control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention, for example a preferred terminator for use in a bacterial host may be the terminator from the T7 bacteriophage.

An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translation control elements. The expression vector may also include a ribosome binding site for translation initiation and a transcription terminator. In an expression vector, a coding sequence herein and one, more or all of the above regulatory sequences are operably linked together for expression of a fusion protein herein in a host cell. The recombinant expression vector may be any vector, such as a plasmid or virus, including but not limited to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors, that can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the coding sequences herein. Any plasmid or vector may be used as long as it can replicate and is stable in the host. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid. The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication. Such vectors include plasmids, extrachromosomal elements, minichromosomes or artificial chromosomes. The vector may comprise any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. The products of suitable marker genes provide resistance to antibiotics or viruses, resistance to heavy metals, prototrophy to auxotrophs, and the like.

Suitable constructs of the invention can be constructed using vectors known in the art, such as the pPD95.75 expression vector (sequence shown in SEQ ID NO: 17). Thus, in certain embodiments, a suitable construct herein is a pPD95.75 expression vector as a backbone, comprising a coding sequence herein and a promoter sequence from unc-103 operably linked to the coding sequence.

Methods well known to those skilled in the art can be used to construct expression vectors containing the coding sequences described herein and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like.

The nucleic acid constructs herein can be transferred into host cells using methods conventional in the art. For example, when the host is a prokaryote such as E.coli, competent cells capable of DNA uptake are harvested after exponential growth phase and then CaCl is used₂Methods, the steps used are well known in the art. Another method is to use MgCl₂. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

When the host is a nematode, the nucleic acid constructs herein, and in particular the expression vectors, can be transferred into the nematode or into cells by microinjection. The expression vector is then integrated into the chromosome by methods well known in the art, including but not limited to the UV/TMP method. Thus, the transgenic nematodes herein can be constructed. Preferably, the background mutation is removed by backcrossing several times (e.g., 2-5 times) after obtaining a nematode that has integrated the target gene (i.e., the gene encoding the fusion protein described herein) into the chromosome. Furthermore, it is further preferred that the nematodes herein are deficient in the acs-20 gene, e.g. the acs-20 gene is knocked out, since the nematode has a thicker body wall and the nematode gut can actively exclude foreign toxic substances, which makes it more difficult for most compounds to enter the nematode cells. For example, the acs-20 gene-deficient nematodes herein can be obtained by hybridizing nematodes having a target gene integrated into the chromosome or nematodes obtained by backcrossing with acs-20 gene-deficient nematodes such as acs-20(tm3232) as is well known in the art.

Thus, in certain embodiments, included herein are transgenic nematodes that express fusion proteins with gain-of-channel-function mutations in hERG. In particular, such nematodes express fusion proteins herein wherein the hERG has a channel gain-of-function mutation at position a536 and/or a653, preferably a536W and/or a 653T. Such nematodes often have behavioral deficiencies. In a further preferred embodiment, such nematodes are also nematode deficient in the acs-20 gene.

In other embodiments, the transgenic nematodes herein express fusion proteins having gain-of-channel-function mutations in hERG, in combination with mutations that result in a dysfunction of intracellular trafficking. In particular, such nematodes express fusion proteins herein wherein the hERG has a channel gain-of-function mutation at position a536 and/or a653, preferably a536W and/or a 653T; and the presence of a mutation at any one or more of positions 31, 65, 470, 561, 601 and 818 which results in a disorder of hERG intracellular trafficking, preferably any one or more of I31S, T65P, N470D, a561V, G601S and S818L. Such nematodes typically do not have behavioral deficits. Likewise, it is preferred that such nematodes are also deficient in the acs-20 gene.

Herein, a behavioral deficit in a nematode is generally referred to as a movement and/or oviposition disorder. In M9 solution, the head swing motion of wild type N2 nematode can reach 114 times per minute on average. Thus, a transgenic nematode can be considered dyskinesia when its head-swinging motion in M9 solution is less than 80 times per minute. More preferably, the head-swinging motion of the transgenic nematode in the M9 solution is less than 70, 60, 50, 40, 30, 20, 10 or less times per minute. In terms of egg laying capacity, wild type N2 nematodes in the late stage of L4 produced 57 eggs on average within 30 hours. Therefore, when the number of eggs laid by late L4 transgenic nematodes is less than 35, preferably less than 30, more preferably less than 25, more preferably less than 20, more preferably less than 15, more preferably less than 10, more preferably less than 5 in 30 hours, the transgenic nematodes are considered to have egg laying failure. Transgenic nematodes that present the above-described movement and/or oviposition disorders may be used for compound screening.

Transgenic nematodes of the disclosure can be used to screen hERG channel inhibitors and LQTS-related functional correction agents of hERG mutant channels. For example, using nematodes expressing fusion proteins with gain-of-channel-function mutations as described herein, inhibitors of the hERG channel can be screened. Generally, a transgenic nematode expressing a fusion protein in which the a536W or a653T mutation is present with a behavioral deficiency (e.g., dyskinesia and/or egg production), and if the behavioral deficiency (e.g., dyskinesia and/or egg production) of the transgenic nematode is improved or restored after contact with a substance to be screened, it is an indication that the substance to be screened is an inhibitor of the hERG channel. By "improving" is meant that in M9 solution, the number of head oscillations per minute of the transgenic nematode is higher (preferably at least 5 times higher, more preferably at least 10 times higher, more preferably at least 15 times higher) than the number of head oscillations per minute of the control transgenic nematode not treated with the substance to be screened, and/or that the number of eggs laid by the transgenic nematode in 30 hours is greater (preferably at least 2 more, more preferably at least 5 more, more preferably at least 10 more) than the number of eggs laid by the transgenic nematode in 30 hours not treated with the substance to be screened.

Alternatively, a nematode expressing a fusion protein having a channel gain-of-function mutation in hERG and a mutation that results in a disorder of its intracellular trafficking as described herein can be used to screen for a modifier of the LQTS-associated hERG mutant channel function, wherein the compound to be screened can be used as a modifier if the nematode exhibits a behavioral defect (e.g., dyskinesia and/or egg production) following contact with the compound to be screened, as compared to the nematode before it has not been contacted with the compound to be screened.

Typically, the screening will be carried out in conventional nematode culture medium NGM to which may be added an inducer (e.g., IPTG) and an antibiotic (e.g., carbenicillin). The concentrations of the inducer and the antibiotic can be determined according to actual conditions to be tested. The test compound and the nematode herein (preferably a nematode of stage L4) can be added to the medium and after a period of co-incubation (i.e., "treatment") for a period of time (e.g., 24-40 hours) it can be determined whether the compound to be screened is an inhibitor of the hERG channel and a LQTS-related functional correction agent of the hERG mutant channel by observing the nematode phenotype. Preferably, RNAi bacteria targeting ifd-2 and c15c7.5 genes can be inoculated to the NGM culture medium to reduce the capability of the nematode intestinal tract to exclude exogenous drugs and increase the accumulation of molecules of the compound to be tested in the nematode. In this case, after the RNAi bacterium is inoculated into the NGM medium and cultured for several days (e.g., 1-3 days), the compound to be tested is added to the medium for several hours (e.g., 2-8 hours), and then the nematode (preferably the nematode at the stage L4) is inoculated into the medium, and after the incubation for a period of time (e.g., 24-40 hours), whether the compound to be screened is an inhibitor for inhibiting the hERG channel and a function-correcting agent for the hERG mutant channel associated with LQTS can be determined by observing the nematode phenotype.

The nematodes and methods herein can be used to screen compounds in various databases known in The art, for example, from Prestwick Chemical Library and The Spectrum Collection and Sigma Lopac, and The like. In certain embodiments, various agonists (preferably chemical molecules) of Protein Kinase C (PKC), including but not limited to traditional PKC (cpcc, α, β I, β II and γ), novel PKC (nPKC, δ, ε, η, θ), and agonists of atypical PKC (aPKC, ζ, iota, λ), particularly agonists of PKC ε, are screened for LQTS-associated hERG mutant channel function correctors and/or drugs for treatment of type II LQTS using the nematodes and methods described herein.

Using the nematodes and methods herein, it is possible to not only screen for inhibitors that inhibit the function of the hERG channel on cell membranes, but also to identify small compounds that block intracellular trafficking of the hERG channel. Accordingly, also provided herein is a method of detecting the pharmacological effect of hERG of a compound, said method comprising the step of treating a nematode as described herein (particularly a nematode as hereinbefore described which expresses a fusion protein in which a gain-of-channel-function mutation in hERG is present) with a compound to be screened, wherein the behavioral deficiency of said nematode is ameliorated or restored following treatment with the compound, whereby the compound is capable of inhibiting hERG channel function with the potential for causing LQTS side effects.

Also included herein is the use of a PKC agonist, particularly a PKC epsilon agonist, for correcting LQTS-related hERG mutant channel function, including in the preparation of a substance for correcting LQTS-related hERG mutant channel function. Preferably, the PKC agonist is Prostratin and IDB. Correcting LQTS-related hERG mutant channel function includes, but is not limited to, repairing the trafficking defect of the mutant. The hERG mutants include mutants having a mutation at any one or more of positions 31, 470, 561, 601, 818 and 823, in particular mutants having any one or more of I31S, N470D, a561V, G601S, S818L and R823W.

Further, also encompassed herein is the use of a PKC agonist, especially a PKC epsilon agonist, in the treatment of LQTS, especially type II LQTS, including in the manufacture of a medicament for the treatment of LQTS (especially type II LQTS).

The present invention will be illustrated below by way of specific examples. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (Cold spring harbor laboratory Press, N.Y., USA, 1989) or according to the manufacturer's recommendations. For the use and amounts of the reagents, the conventional use and amounts are used unless otherwise indicated.

Method

Nematode strain

The wild-type nematode strain N2 was obtained from the American nematode genetic center, and the mutant nematode acs-20(tm3232) was purchased from the Japanese nematode repository. Nematodes were raised on NGM plates at 20 ℃.

Molecular biology

Plasmid hERG for transgenesis^{chimera/A536W}Through three steps PThe CR method is constructed. First, PCR was performed on the following DNA or cDNA fragments from a genomic or cDNA library, respectively: an upstream promoter sequence of the unc-103 gene (SEQ ID NO:4), a5 'terminal sequence of the unc-103cDNA (the nucleotide sequence is shown as the 1 st-237 th site of SEQ ID NO:1, the coded amino acid sequence is shown as the 1 st-79 th site amino acid residues of SEQ ID NO: 19), a middle segment sequence of the hERG cDNA (the nucleotide sequence is shown as the 238 nd-1800 th site of SEQ ID NO:1, the coded amino acid sequence is shown as the 369 rd-889 th site amino acid residues of SEQ ID NO: 18), and a 3' terminal sequence of the unc-103cDNA (the nucleotide sequence is shown as the 1801 st-2493 th site of SEQ ID NO:1, and the coded amino acid sequence is shown as the 599 nd-829 site amino acid residues of SEQ ID NO: 19). Firstly, the upstream promoter sequence of the unc-103 gene is inserted into a pPD95.75 (the sequence is shown as SEQ ID NO: 17) expression vector by utilizing an enzyme digestion connection method. Secondly, the fragment of the 5 'terminal sequence of the unc-103cDNA, the hERG cDNA sequence and the 3' terminal sequence of the unc-103cDNA is subjected to fusion PCR to obtain a chimeric hERG channel PCR fragment, and then the fragment is inserted into a pPD95.75 expression vector containing the upstream promoter sequence of the unc-103 gene by an enzyme digestion connection method, so that the hERG is obtained^chimeraA plasmid; finally, point mutation PCR is carried out to mutate the hERG channel at the 536-bit amino acid, thereby obtaining the plasmid hERG^{chimera/A536W}(the sequence of the chimeric gene is shown in SEQ ID NO: 2). hERG for transgenesis^{chimera/A536W/A561V}The plasmid (the sequence of the chimeric gene is shown in SEQ ID NO: 3) is in hERG^{chimera /A536W}On the basis of the method, the amino acid at the 561 th site of the hERG channel is mutated through one point mutation. The HA-hERG plasmid for expression in mammalian cells is constructed by inserting the cDNA of the hERG gene into the HA-PRK5 expression vector, and the corresponding hERG mutant is obtained by point mutation reaction. All the plasmids are verified by a sequencing reaction to ensure the correctness of the sequence.

The same method is adopted to construct hERG which codes the 1 st-79 th amino acid residues of UNC-103, the hERG fragment is SEQ ID NO 1 st-889 th amino acid residues and the 599-829 th amino acid residues of UNC-103^chimera(1-899) transgenic sequences (the nucleotide sequence is shown in SEQ ID NO: 22) except that the forward primer for PCR amplification of the hERG fragment and UNC-103The reverse primers at the N-terminal were the primer sequences shown in SEQ ID NO:20 and 21, respectively. Then the transgenic sequence is inserted into a pPD95.75 expression vector to obtain hERG^chimera(1-899) plasmid, then point mutation PCR, hERG channel in 536 amino acid mutation, plasmid hERG^{chimera/A536W}Plasmid (named "hERG)^{chimera/A536W}(hERG 1-889) plasmid ", the chimeric gene nucleotide sequence is shown in SEQ ID NO: 23), further amino acid 561 mutation, to obtain hERG^{chimera/A536W/A561V}(hERG 1-889) plasmid (the nucleotide sequence of the chimeric gene is shown in SEQ ID NO: 24).

The sequences of the primers used in the above construction are shown below:

primer sequence for the unc-103 promoter:

forward direction: ATgcatgcAGGTGTTCACGAGATACCA (SEQ ID NO:5)

And (3) reversing: CGggatccGATTCGCCACGCATT (SEQ ID NO:6)

unc-103N-terminal primer sequence:

forward-P1: CGggatccATGAAGACGGCGGTATT (SEQ ID NO:7)

reverse-R1: GGTGACCTTCTCAGTGACATTTAGTCGACTTGTCCTTCTCGAT (SEQ ID NO:8)

hERG primers:

Forward-P2: AATGTCACTGAGAAGGTCACC (SEQ ID NO:9)

reverse-R2: CAACTTGCGCTTGCGTTGC (SEQ ID NO:10)

The primer at the C end of unc-103:

forward-P3: GGCAACGCAAGCGCAAGTTGTCATCATCAATGAACAAAGAT (SEQ ID NO:11)

reverse-R3: GGggtaccCTTAGAATAGTATCAGTTTCTTGTG (SEQ ID NO:12)

A536W point mutation primer:

forward direction: GGCTGGTGCGCGTGTGGCGGAAGCTGGATCG (SEQ ID NO:13)

And (3) reversing: CGATCCAGCTTCCGCCACACGCGCACCAGCC (SEQ ID NO:14)

A561W point mutation primer:

forward direction: CCTTTGCGCTCATCGTGCACTGGCTAGCCTG (SEQ ID NO:15)

And (3) reversing: CAGGCTAGCCAGTGCACGATGAGCGCAAAGG (SEQ ID NO:16)

hERG (1-889) primers:

Forward-P2: ATGCCGGTGCGGAGGGGCCACG (SEQ ID NO:20)

reverse-R2: CAACTTGCGCTTGCGTTGC (SEQ ID NO:10)

unc-103N-terminal primer sequence:

forward-P1: CGggatccATGAAGACGGCGGTATT (SEQ ID NO:7)

reverse-R1: cgtggcccctccgcaccggcatTAGTCGACTTGTCCTTCTCGAT (SEQ ID NO:21)

Construction of transgenic nematodes

Plasmid hERG^{chimera/A536W}、hERG^{chimera/A536W/A561V}、hERG^{chimera/A536W}(hERG 1-889) plasmid and hERG^{chimera/A536W/A561V}(hERG 1-889) plasmids were microinjected into wild-type N2 nematodes, simultaneously with microinjection of P_unc-103The mCherry plasmid can express red mCherry fluorescent protein in nematode cytoplasm, and can be used for nematode fluorescence selection and marking nematode cytoplasm part to reflect the transportation condition of the chimeric hERG channel in nematodes. The transiently passaged nematodes are integrated by standard UV/TMP methods [ Jiang et al (2014) genetic manipulation of both the heterologous infection serotonin/polypeptide level and the heterologous determination in the formation of the fungal organisms, the Journal of Neuroscience 34: 3947. sup. 3958 ], followed by four rounds of backcrosses to remove background mutations, to give hERG^{chimera/A536W}、hERG^{chimera/A536W/A561V}Transgenic nematode, hERG^{chimera/A536W}(hERG 1-889) transgenic nematodes and hERG^{chimera/A536W/A561V}(hERG 1-889) transgenic nematodes.

Nematode behavior detection

Head swing behavior of nematodes is used to detect the locomotor ability of the nematode. Specifically, the nematodes on the first day of growth were placed in the buffer M9 and the number of swings in the body over a period of 1 minute was observed and recorded. The number of offspring generated per unit time by the nematode is used to test the egg laying capacity of the nematode. The nematodes in the late stage of L4 were picked up on an empty plate and after 30 hours the nematodes were picked up, and the number of eggs on the plate and hatched larvae totaled the number of offspring of the nematodes.

Western blot

The western blotting experiments were performed with reference to the existing literature reports. HEK293T cells were cultured in CO at constant temperature of 37 ℃ according to standard cell culture methods₂An incubator. HA-hERG plasmid is transfected into cells by Lipofetamine 2000 transfection reagent, the cells are collected after 30 hours of plasmid transfection, protein samples after cell lysis are separated in SDS-PAGE electrophoresis, and a western blot experiment is carried out. The HA-hERG protein is shown with the HA antibody.

Small molecule compound screening

Small molecule compounds of structural and functional diversity are derived from a variety of compound libraries, such as Prestwick Chemical Library, The Spectrum Collection and Sigma Lopac, among others. The 48-well plate is used for screening target drugs by the compound treatment nematodes. Each well contained 500. mu.l of NGM, and the medium contained 1mM IPTG (isopropyl thiogalactoside), 50. mu.g/ml carbenicillin. The RNAi bacteria of targeted ifd-2 and c15c7.5 genes are inoculated in the NGM culture medium, and the accumulation of compound molecules in the nematode body can be effectively increased. After 2 days, the small molecule compound to be screened dissolved in DMSO is added to NGM medium, and the final concentration of the compound molecule reaches 20 μ M. After 4 hours, synchronized L4 phase nematodes grown on normal NGM medium inoculated with OP50 bacteria were inoculated onto 48 well plates of NGM plus compound molecules, approximately 20 per well. After 36 hours the nematode phenotype was observed under a microscope to initially identify the compound of interest.

Electrophysiological experiments

hERG current was recorded using whole cell recording mode. The electrode (superstrate glass) resistance was about 4-6M omega and the patch clamp amplifier was Axon 200B. In HEK293T cells, the expression plasmid was transfected with Lipofectamine 2000 reagent and the siRNA with Lipofectamine or RNAiMAX reagent. The electrode internal liquid composition is (mM): 135KCl,10EGTA,1MgCl₂5Mg-ATP, 10HEPES (pH adjusted to 7.2 with KOH). Extracellular fluid composition (mM): 130NaCl,5KCl,10HEPES,1MgCl ₂10 glucose, 2CaCl₂(pH was adjusted to 7.4 with NaOH). hERG currents were recorded at room temperature (22. + -. 1 ℃ C.) and collectedThe stimulation was as follows: that is, cells were first stimulated to inactivate the hERG channel by +40mV, followed by a-140 mV to +40mV gradient stimulation (20mV increments) with the clamp voltage set at-80 mV.

Cardiomyocytes derived from human induced pluripotent stem cells were cultured on 0.1% geltain-coated 24-well plates, from Cellular dynamics international. 4 days later, ViaFect Transfection Reagent Transfection of myocardial cells expression hERG-ires-GFP plasmid. After 12 hours transfected cells were given drug treatment, action potential and Cs⁺Mediated hERG channel currents (Ikr-Cs)⁺) After 24 hours the recording was carried out, the temperature being controlled at 27 ℃. The composition of the electrode internal liquid for recording the action potential was (mM): 120KCl,1MgCl₂3Mg-ATP,10HEPES, 10EGTA, pH 7.2. Extracellular fluid composition (mM): 140NaCl,5.4KCl,1.8CaCl₂,1MgCl₂10HEPES, 10 glucose, pH 7.4. The generation of action potential is caused by injecting 0-40pA current, and the data sampling frequency is 0.25 Hz. Cs⁺Recording of mediated hERG channel currents was performed with reference to Zhang S. (Isolation and characterization of I (Kr) in cardiac myocytes by Cs + characterization, Am J Physiol Heart Circuit physiol.2006; 290: H1038-49). The electrode internal solution comprises the following components (mM): 135CsCl, 10HEPES, 5MgATP, 10EGTA, pH 7.2. Extracellular fluid composition (mM): 135CsCl, 10HEPES, 10 glucose, 1MgCl ₂10 μ M nifedipine, pH 7.4.

Results

Construction of transgenic nematodes

The UNC-103 ion channel is the only potassium ion channel of an ERG family in the nematode, and regulates the behaviors of movement, oviposition, mating of males and the like of the nematode. The UNC-103 channel has high homology with the human ERG family potassium channel hERG. In the transmembrane segment and the important functional segment such as cNBD domain, the amino acids in the two are the same and are up to 70%. In order to construct a nematode strain for screening small-molecule drugs for regulating the functions of an hERG channel, the inventor firstly expresses the full-length human hERG channel in the nematode, but finds that the hERG channel can not be normally transported to a cytoplasmic membrane in nematode cells. The inventors then attempted to construct chimeric hERG channel proteins. The chimeric hERG channel protein has N-terminal and C-terminal substitutionThe sequence of UNC-103 was generated and a point mutation A536W was introduced into the fifth transmembrane region of this chimeric hERG channel (Subbiah, R.N., et al, supra) (FIG. 1, A). The above two modifications are made based on the following considerations: on one hand, the N end and the C end of the UNC-103 channel are crucial to normal membrane application in nematode cells, so that the replacement of the N end and the C end of the hERG with the N end and the C end of the UNC-103 channel may cause the hERG to be normally transported to a cell membrane in the nematode cells; on the other hand, the activation of the hERG channel with the mutation at position a536W at a lower voltage causes the membrane potential of the cell to become lower, thereby reducing the excitability of the cell and causing nematode behavior defects. Indeed, expression of this chimeric hERG channel under the drive of the unc-103 promoter in wild-type nematodes resulted in very significant dyskinesia and egg production in the transgenic nematodes (FIGS. 1, B, C and D). In M9 solution, the head swing motion of wild type N2 nematode can reach 114 times per minute averagely, while hERG^{chimera/A536W}The average head swing motion of the transgenic nematodes is close to 6 times per minute; in terms of egg laying capacity, the wild type N2 nematode of late L4 can lay 57 eggs on average within 30 hours, and the corresponding hERG^{chimera/A536W}On average, transgenic nematodes can produce approximately 1 egg. At the same time, fluorescence results show that hERG fused with GFP in nematode cells^{chimera/A536W}Proteins can be properly transported to the plasma membrane of cells (FIG. 1, E). hERG^{chimera/A536W}(hERG 1-889) transgenic nematodes also exhibited similar behavioral defects (FIGS. 12, A, C and D). hERG^{chimera/A536W/A561V}(hERG 1-889) transgenic nematodes and hERG^{chimera/A536W/A561V}The transgenic nematodes were identical and had normal locomotor and oviposition behavior (fig. 12, B).

Nematodes have a thick body wall and the nematode gut can actively exclude foreign toxic substances, which makes it more difficult for most compounds to enter the nematode cell [ Subbiah, R.N., et al, supra ]. ACS-20 protein is an important constituent of nematode body wall [ Kage-Nakadai, E.et al. two vertical chain fatty acid acyl-CoA synthetic genes, ACS-20and ACS-22, positive rolls in the cervical surface barrier in Caenorhabditis elegans. PLoS One 5, e8857(2010) ]. ACS-20 Gene knockout nematodes [ ACS-20(tm3232)]Exhibiting a loss of body wall protective function [ Kage-Nakadai, E., et al, supra ]. To allow efficient entry of small molecule compounds into nematodes, we use hERG^{chimera/A536W}Hybridizing with acs-20(tm3232) to obtain acs-20(tm 3232); hERG^{chimera/A536W}And (5) strain. Treatment of the nematodes with clofilum, Ibutilide or E-4031, a known hERG channel inhibitor, can significantly improve the defects in locomotor and oviposition behavior (fig. 1, F and G). This result indicates that the drug small molecule compound can effectively enter the nematode body, and on the other hand, also indicates that the phenotype of the transgenic nematode constructed by the invention is indeed caused by the fact that the chimeric hERG channel can be correctly transported to the cytoplasmic membrane and successfully functions.

Screening of small molecule compound to obtain hERG channel inhibitor

Small molecule compounds that inhibit hERG channel function have the potential to cause LQTS side effects, and therefore these compounds must be eliminated during the development of preclinical drugs. To examine whether the transgenic nematodes constructed by the present inventors could be used to identify potential hERG inhibitors, the inventors screened 4000 small molecule compounds by examining the behavior of the nematodes after drug treatment (figure 2, a). The inventors found that around 70 of these four thousand compounds could alleviate acs-20(tm3232) to varying degrees; hERG^{chimera/A536W}Behavioral defects in transgenic nematodes. Among them, hazy wood acid (ALA) can greatly reduce behavioral deficits of nematodes (fig. 2, B and C). From whole cell recordings, the inventors found that transient treatment with 1 or 10 μ M ALA had no effect on hERG channel current expressed in HEK293 cells (FIG. 2, D), whereas long-term ALA treatment (24-32 hours of treatment) resulted in a significant decrease in hERG channel current density and exhibited drug concentration-dependent properties with half-inhibitory concentration IC₅₀At 8.2. mu.M (FIG. 2, E-G).

The inventors next examined the changes in hERG protein expression and trafficking efficiency following ALA treatment. The hERG channel appears as two bands in SDS denaturing gel electrophoresis: the low molecular weight band is in the form of a core glycosylated protein, localized to the endoplasmic reticulum; the high molecular weight band is in the form of a fully proteinated glycosylated protein which has been transported out of the endoplasmic reticulum [ Ficker, E2003, supra. The hERG high molecular weight band decreased after ALA treatment, while the low molecular weight band remained unchanged (FIG. 2, H), indicating that ALA inhibits the hERG channel from being transported out of the endoplasmic reticulum. The above data illustrate that the transgenic insect acs-20(tm3232) constructed by the present inventors; hERG^{chimera/A536W}Novel hERG channel inhibitors can be effectively identified.

Prostratin and IDB repair of hERG^A561VTransport defect

Most of the LQTS-related gene mutations result in defective hERG channel trafficking, which in turn reduces hERG channel function. To construct animal models that can screen compounds for transport defect correction, the inventors generated hERG in the chimeric channel^{chimera /A536W}A561 mutation point A561V (FIG. 3, A) was introduced, which is a mutation of alanine at 561 in the hERG channel to valine, leading to hERG intracellular trafficking disorders, causing LQTS [ Kagan, A., Yu, Z., Fishman, G.I ].&McDonald, T.V.the dominant negative LQT2mutation A561V reduce world wide-type HERG expression. J Biol Chem 275,11241-11248 (2000); finker, E.et al.Retention in the end plastic particulate as a mechanism of passive-reactive current supply in human Long QT syndrome J Mol Cell Cardiol 32,2327-2337 (2000). The present inventors have established a novel chimeric channel hERG^{chimera/A536W/A561V}Expressing in wild type N2 nematode, and mating the transgenic nematode with acs-20(tm3232) to obtain acs-20(tm 3232); hERG^{chimera/A536W/A561V}Nematodes are present. At acs-20(tm 3232); hERG^{chimera/A536W/A561V}hERG fused with GFP in nematodes^{chimera/A536W/A561V}The protein localized to the cytoplasm (fig. 3, B). Accordingly, acs-20(tm 3232); hERG^{chimera/A536W/A561V}Nematodes exhibit a normal phenotype similar to wild-type nematodes.

Mutant channel hERG that shows transport defects has been reported^A561VCorrected to reach the cell membrane to function as a normal channel [ Mehta, A. et al 2014, supra ]. The present inventors hypothesize that certain compounds may promote chimeric channel hERG^{chimera/A536W/A561V}In normal epilame in transgenic nematodes, the chimeric channel will function on the cell membrane and thereby redirectCausing defects in movement and spawning. Based on this concept, the inventors selected a corrected hERG from a small library of compounds^A561VA compound that functions as a channel. The screening process of the inventor is divided into two steps: first, screening by using a behavior index can lead to acs-20(tm 3232); hERG^{chimera/A536W/A561V}Compounds deficient in nematode locomotor and oviposition behavior; next, the present inventors observed hERG by GFP fluorescence in these compound-treated transgenic insects^{chimera/A536W/A561V}Localization of the channel in the cell to confirm that the mutant channel is transported to the cell membrane (fig. 3, C). The present inventors screened 6 compounds including Prostratin and Ingenol 3,20-dibenzoate (IDB) among 10600 compounds, all of which resulted in the deficiency of the movement and oviposition behavior of transgenic nematodes and hERG^{chimera/A536W/A561V}The plasma membrane of the cells was located (FIG. 4).

hERG^A561VWhen the hERG and wild type hERG are co-expressed in HEK293T cells, the 155KD protein band of the mature form is obviously reduced, which indicates that the hERG^A561VWith a dominant negative effect, consistent with previous studies [ Kagan, a., 2000, supra; ficker, E., 2000, supra. When the ratio of 1: 3 ratio Co-expression of hERG in HEK293 cells^A561VAnd wild type hERG, administration of compound Prostratin or IDB (structural formula shown in FIG. 5, A) can significantly increase hERG current density for 24 hours (FIG. 5, B). The effects of these two compounds were concentration gradient dependent (FIG. 5, C-D), half maximal Effect Concentrations (EC) of Prostratin and IDB₅₀) 0.95. mu.M and 0.042. mu.M, respectively (FIG. 5, D). hERG was expressed in HEK293T cells at a 1:1 ratio^A561VAnd wild type hERG, Western blotting results showed that the mature form of hERG (155KD) protein increased significantly after treatment with Prostratin and IDB, indicating that these two drugs can increase the intracellular transport efficiency of hERG protein (FIG. 5, E). Further research shows that Prostratin and IDB can also improve other hERG mutant channels (such as hERG)^I31S、hERGG^601S、hERG^S818LEtc.) in the current density (fig. 5, F). In addition, electrophysiological and western immunoblot results showed that Prostratin and IDB treatment had little effect on wild-type hERG channel function (fig. 6, a-F), suggesting the relative specificity of these two PKC agonistsRepair of hERG mutant channel function.

Both Prostratin and IDB are agonists of PKC. Prostratin is a non-tumorigenic phorbol ester PKC agonist that widely activates 3 major forms of PKC. IDB is a novel PKC agonist, primarily activating PKC epsilon. Next, the present inventors investigated the pairs of Prostratin and IDB on hERG^A561VWhether the modulation of (a) is dependent on their PKC agonist function. Based on both Prostratin and IDB, PKC epsilon was activated and RNAi knockdown of PKC epsilon expression was used to determine whether they could still repair hERG^A561VThe transportation defect of (2). Western blot results showed that PKC epsilon siRNA was able to significantly reduce expression of PKC epsilon (fig. 7, a). When siRNA reduced PKC epsilon expression, Prostratin and IDB were directed against hERG^A561VThe current-increasing effect was abolished (FIG. 7, B), while the Western blot results showed that they lost the effect on hERG^A561VRepair function of transport defects (fig. 7, C). These results indicate that Prostratin and IDB are on hERG^A561VThe modulation of (c) is dependent on the activation of PKC epsilon.

Prostratin and IDB increase hERG in hiPSC-derived cardiomyocytes^A561VFunction of (2)

The hERG potassium channel plays an important role mainly in cardiac myocytes, and mediates Ikr current in repolarization of action potential of cardiac myocytes. hERG expression in hiPSC-CM cardiomyocytes^A561VThe protein was able to significantly reduce endogenous Ikr current (FIG. 8, A-B), probably due to hERG^A561VHas a dominant negative effect, and endogenous hERG forms a tetramer, resulting in retention of the hERG channel in the endoplasmic reticulum. Ikr Current is based on literature methods [ Zhang, S.isolation and characterization of I (Kr) in cardiac myocytes by Cs + characterization. am J Physiol Heart Physiol 290, H1038-1049(2006) ] using hERG channels to permeate Cs⁺The ion characteristics are recorded. In addition, expression of hERG^A561VThe repolarization process of hiPSC-derived cardiomyocytes slowed down, the time course of action potentials extended (fig. 8, C-D), and caused early onset and late depolarization (EAD) phenomena in some atrial cardiomyocytes, similar to the electrophysiological characteristics of hiPSC cardiomyocytes derived from LQTS2 patients. More importantly, the hERG was expressed after 3. mu.M Prostratin and 2. mu.M IDB treatment^A561VThe current Ikr endogenous to the hiPSC-derived cardiomyocytes was significantly increased (fig. 8A-8B), the action potential duration was also restored to the level of normal hiPSC-derived cardiomyocytes (fig. 8, C-D), and the phenomenon of depolarization (EAD) of the atrial cardiomyocytes did not occur any more (fig. 9). Furthermore, treatment of normal hiPSC-CM cardiomyocytes with both compounds had little effect on the action potential time course (fig. 10). Taken together, Prostratin and IDB can slow down cardiomyocytes due to expression of hERG^A561VThe resulting LQTS 2-associated electrical activity profile, and this enhancement is likely to be through repair of hERG^A561VAnd the transportation defect is realized.

The above experimental data show that the transgenic nematode acs-20(tm3232) constructed by the inventor; hERG^{chimera/A536W}And acs-20(tm 3232); hERG^{chimera/A536W/A561V}Can effectively screen hERG potassium channel inhibitor and LQTS related hERG mutant channel function correction agent. PKC agonists Prostratin and IDB are functional correctors of the hERG mutant channel and have promise for treatment of LQTS.

Discussion of the related Art

Ion channels function only when transported to the cell membrane. An increasing number of studies have found that disorders in the intracellular transport of channel proteins are the causative mechanisms of diseases including LQTS, cystic fibrosis, deafness, epilepsy and the like. The use of small molecule compounds to correct this transport defect has provided the possibility for the treatment of disease, but there are few reports at present, mainly due to the lack of suitable high throughput screening systems. In this context, the inventors expressed the modified hERG channel in nematodes, constructed two transgenic nematodes, and successfully screened compounds that inhibit intracellular trafficking of the normal hERG channel and compounds that are corrected for trafficking-defective mutant hERG channels using these two nematode screening systems, respectively.

In this study, the inventors have for the first time constructed a screening method that allows identification of compound molecules that affect the intracellular trafficking of hERG in vivo. FDA mandates that lead compounds must be tested for hERG pharmacological action before entering a phase of the clinic to assess the toxic side effects of the compound on the heart. However, the existing screening methods can only screen inhibitors for inhibiting the function of the hERG channel on the cell membrane, and cannot screen small molecular compounds for inhibiting the intracellular transport of the hERG channel. The inventors' method provides a new approach and method for hERG toxicology testing.

The large-scale screening system based on nematode behaviors is the first system capable of accurately screening transport-defective hERG mutant channel correcting compounds. This screening system has the unique advantage that, firstly, the hERG channel inhibitor can block the hERG channel function on the cell membrane, so that the nematode can not produce behavior defect, therefore, the animal behavior-based in vivo screening platform screens out the hERG mutant channel correction agent which is mainly non-inhibitor. In addition, the screening methods described herein are simple and easy to operate, and the nematodes are very low in culture and maintenance costs. Since the current high-throughput compound screening platform for ion channels is generally expensive and has high operation and maintenance costs, only a few laboratories and medical companies can afford [ Clare, j.j.targeting ion channels for drug discovery. discov Med 9,253- "260 (2010) ]. The popular screening platform provided by the inventor can allow more laboratories to be added to screening of ion channel disease drugs.

Protein Kinase C (PKC) is a class of Ca²⁺And/or a phospholipid-dependent serine-threonine protein kinase, perform a number of important physiological functions, such as regulating cell proliferation, apoptosis, migration. PKC has at least 10 subtypes, which can be classified into 3 major classes according to their structure and function: traditional PKC (cPKCK, alpha, beta I, beta II and gamma) is Ca²⁺Dependent and activatable by Diglyceride (DAG), Phosphatidylserine (PS); novel PKC (npKC, delta, epsilon, eta, theta) is Ca²⁺Is independent and can be activated by DAG and PS; atypical PKC (aPKC, zeta, iota, lambda) Ca-independent²⁺But can only be activated by PS. PKC exists as a number of broad-spectrum and subtype-selective inhibitors and agonists. Prostratin is a non-tumorigenic phorbol ester PKC agonist that widely activates 3 major forms of PKC. IDB is a novel PKC agonist, primarily activating PKC epsilon. The present inventors' studies showed that Prostratin and IDB are directed against hERG^A561VThe regulation of PKC depends on their activation of protein kinase PKC epsilon, revealing that PKC signals are involved in the transport of misfoldingRepair of defective hERG mutants. Previous studies have shown that PKC signaling pathways regulate a number of cardiomyocyte ion channels, such as sodium channel (SCN5A), K_ATPAnd KCNQ1 potassium channel, and the like. Activation of PKA and PKC can partially restore LQTS1 mutant channel function by enhancing KCNQ1 and PIP2interactions [ Matavel, a.&Tapes, c.m. pka and PKC particulate saving QT type 1 phenotypeby saving channels-pips 2interactions channels (Austin)4,3-11 (2010). The present inventors have shown that Prostratin and IDB can eliminate hERG due to expression mutation in hiPSC-derived cardiomyocytes^A561VThe resulting prolongation of the action potential time course, their role should depend on hERG^A561VRepair of transport defects because these two compounds have little effect on the time course of action potential of normal hiPSC-derived cardiomyocytes. The present inventors' studies have found that Prostratin and IDB differ from previously recognized novel functions, i.e., they promote membrane transport of LQTS-related hERG mutant channels, increasing I_krThe current has the prospect of treating LQTS.

Claims (20)

1. A fusion protein, comprising:

the fragment from the N end of the nematode ERG family potassium ion channel UNC-103 protein at the N end between 1 st and 85 th amino acid residues is used as the N end of the fusion protein, and the fragment at least comprises the 1 st to 79 th amino acid residues at the N end of the UNC-103 protein;

hERG amino acid residues 369-889 or amino acid residues 1-889; and

the C-terminal amino acid residues from 599-829 positions of the C-terminal of the UNC-103 protein as the C-terminal of the fusion protein;

wherein, the amino acid sequence of the hERG is shown as SEQ ID NO. 18, and the amino acid sequence of the UNC-103 protein is shown as SEQ ID NO. 19.

2. The fusion protein of claim 1, further comprising a detectable protein or enzyme encoded by a reporter gene.

3. The fusion protein of claim 2, wherein the detectable protein encoded by the reporter gene is a fluorescent protein.

4. The fusion protein of any one of claims 1 to 3, wherein the fragment between amino acid residues 1 to 85 from the N-terminus of the UNC-103 protein consists of amino acid residues 1 to 79, 80, 81, 82, 83, 84 or 85 from the N-terminus of the UNC-103 protein.

5. The fusion protein of claim 1, wherein the fusion protein is a fusion protein consisting of amino acid residues 1 to 79 of the N-terminus of UNC-103 protein, amino acid residues 369 to 889 of hERG, or amino acid residues 1 to 889 of UNC-103 protein and amino acid residues 599 to 829 of the C-terminus of UNC-103 protein.

6. The fusion protein of claim 1, wherein the hERG has gain-of-channel-function mutations at amino acid residues 369-889 or amino acid residues 1-889, wherein the mutations are A536W, A653T, or both A536W and A653T.

7. The fusion protein of claim 1, wherein the hERG has amino acid residues 369-889 or amino acid residues 1-889: (1) a mutation that gains access to channel function, wherein the mutation is a536W, a653T, or both a536W and a 653T; and (2) mutations that result in a disorder of hERG intracellular trafficking selected from one or more of I31S, T65P, N470D, a561V, G601S, and S818L.

8. A polynucleotide molecule, wherein the nucleotide sequence of said polynucleotide molecule is selected from the group consisting of:

(a) a polynucleotide sequence encoding the fusion protein of any one of claims 1-7; and

(b) a sequence complementary to the polynucleotide sequence of (a).

9. The polynucleotide molecule of claim 8, wherein the nucleotide sequence of said polynucleotide molecule is set forth in SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3.

10. An expression vector comprising the polynucleotide molecule of claim 8 or 9.

11. A genetically engineered cell comprising the polynucleotide molecule of claim 8 or 9 or into which the expression vector of claim 10 has been transferred.

12. A method for screening hERG channel inhibitor or LQTS-related hERG mutant channel function correcting agent, or a method for detecting hERG pharmacological action,

the method of screening for an hERG channel inhibitor comprises: co-incubating a compound to be screened with a transgenic nematode expressing a fusion protein of claim 6, and observing and comparing the behavioral performance of the nematode before and after co-incubation, wherein a compound that improves or restores the behavioral deficit of the nematode before co-incubation as compared to before co-incubation is identified as an inhibitor of the hERG channel;

the method for the LQTS-related hERG mutant channel function correcting agent comprises the following steps: co-incubating a compound to be screened with a transgenic nematode expressing a fusion protein of claim 7, and observing and comparing the behavioral performance of the nematode before and after co-incubation, wherein a compound that causes behavioral defects in the nematode and trafficking of the fusion protein to the cytoplasmic membrane after co-incubation as compared to before co-incubation is identified as an LQTS-associated hERG mutant channel function-correcting agent;

the hERG pharmacological action detection method comprises the following steps: co-incubating a compound to be screened with a transgenic nematode expressing a fusion protein according to claim 6, and observing and comparing the behavioral performance of the nematode before and after co-incubation, wherein a compound that improves or restores the behavioral deficits of the nematode before co-incubation after co-incubation compared to before co-incubation is identified as a compound that inhibits hERG channel function, with potential side effects that lead to LQTS.

13. The method of claim 12, wherein the behavioral deficit is dyskinesia, dysbiosis, or both dyskinesia and dysbiosis.

14. The method of claim 12 or 13, wherein the transgenic nematode has either or both of the following characteristics:

(i) the polynucleotide sequence encoding the fusion protein is integrated into the genome of the transgenic nematode;

(ii) the transgenic nematode isacs-20A gene-deficient nematode.

15. The method of claim 12, wherein the co-incubating comprises: co-incubating the test mixture with the transgenic nematodes in a nematode medium containing an inducing agent and an antibiotic.

16. The method of claim 15, wherein the inducing agent is IPTG, the antibiotic is carbenicillin, and the nematode culture medium is NGM.

17. The method of claim 15 or claim 16, wherein the transgenic nematode is a nematode of stage L4.

18. The method of claim 15, wherein the nematode medium is inoculated with a targetifd-2Andc15c7.5several days later, the compound to be tested is added into the culture medium, and several hours later, the transgenic nematode is inoculated into the culture medium.

Use of a PKC epsilon agonist in the manufacture of a substance for correcting an LQTS-related hERG mutant channel function or in the manufacture of a medicament for the treatment of type II LQTS, wherein the PKC epsilon agonist is Prostratin or Ingenol 3, 20-Dibenzoate.

20. The fusion protein of any one of claims 1 to 7, the polynucleotide molecule of any one of claims 8 to 9, the expression vector of claim 10, the genetically engineered cell of claim 11 for the use of:

(1) for screening for hERG channel inhibitors;

(2) screening hERG mutant channel function correcting agent related to LQTS; and

(3) the kit is used for detecting the pharmacological action of hERG.

Images