KR100794218B1 - 63 Methods Of Screening Anticancer Agent By Using DNp63 Promoter - Google Patents

Abstract

The present invention relates to a method for screening an anticancer agent using a promoter of DNp63, wherein the DNp63 promoter, a recombinant vector comprising the same, and the recombinant vector, which induce expression of a DNp63 protein in contact with a potential anticancer agent in epithelial cell-derived cancer cells It relates to a screening method and kit using.

DNp63 promoters, anticancer agents, screening methods

Description

Method of Screening Anticancer Agent by Using DNp63 Promoter

Figure 1 shows the location of the DNp63 promoter site cloned in the present invention.

2 shows the process by which ET-gene recombination is performed.

3 is a cleavage map of the vector pBACe3.6 plasmid used in the present invention.

4 is a cleavage map of the pGETrec vector used for ET-gene recombination.

5 is a part having IRES-NLS-GFP-Km used as a cassette.

6 is a cleavage map of the pEGRP-C1 vector into which a cassette is inserted.

7 is a cassette for ER-gene recombination obtained after PCR with a primer with a cancer sequence of 50 bp after cloning.

8 shows that the established recombinant vector expresses epithelial cancer cells specifically. ME180 cells, which are DNp63 overexpressing epithelial cancer cell lines, and HeLa cells, which are cancer cell lines that do not express DNp63 as a negative control, were identified.

9 shows that the established recombinant vector has a weak expression level before TGF-β treatment, but the expression of GFP is significantly regulated through the increase in the brightness of GFP after the treatment.

80% of human cancers are epithelial cell-derived cancers. Based on the idea that cancers may be derived from stem cells, they are specifically expressed in stem cells and cancer cells, and the expression of ΔNp63α is known to be inhibited during differentiation. Functionality can be very important. In addition, ΔNp63α has a function of inhibiting the function of p53 in the proliferation and death of cells, and functions as a gene for regulating cancer during overexpression. As a result, quantitative balance of p53 and ΔNp63α in stem cells promotes cell proliferation and differentiation. It is thought to control. Therefore, it is inferred that stability and protein position of ΔNp63α will play a very important role in functioning as a cancer gene.

DNp63 is a homologue of p53, a cancer-causing inhibitor, and is expressed as a protein having a function different from that of TAp63 due to a promoter (transcriptional regulatory region) inside the ORF of the TAp63. DNp63, which is expressed in this manner, does not have an amino-terminus transcriptional activity domain, unlike TAp63, and is specifically expressed in epithelial cancer cells as a cancer generating gene that functions as an antagonist of p53. Nuclear protein p63 is located on chromosome 3q and appears to have homology with p53. p53 protein is a cancer suppressor gene that contains a multifunctional DNA-binding protein that is important for regulating cell cycle and cell death. p63 exists in three isoforms. Each produces two groups of transcripts by two selective promoters. The first encodes a full-length protein with an N-terminal transcriptional active domain, such as p53. This can cause cell death. The second encodes a truncated protein and lacks the N-terminal transcriptional activity domain (ΔNp63). ΔNp63 inhibits p53 transcriptional activity by and / or full length of p53 in a dominant negative manner.

US patent application US20020094547A1 (differential diagnosis of cancer and other conditions based on expression of p63) The invention relates to a gene product of p63, a nucleic acid comprising this gene, mRNA and a cDNA comprising the gene. And the use of products of this gene in the treatment or diagnosis of certain diseases such as cancer. The present invention relates to kits in which such diagnostic and therapeutic methods are used. In the US patent application, a method that can be distinguished by measuring a gene or protein of p63 in differentiated lung cancer cells and undifferentiated lung cancer cells has been proposed. The absence of p63 suggests that it is an undifferentiated lung cancer cell.

In international patent application WO04048520A2 (name of invention: REDD1, A Transcriptional Target of p63 and p53, and method of use therefor), the common transcription associated with the regulation of p53-dependent DNA damage response called REDD1 and the differentiation of p63 mediated epithelial cells It describes the target.

European patent application EA0003326B1 (name of the invention: Method of cancer treating) is a method for treating human cancer, in which organic nonprotein compounds are contacted with human proteins of the p53 family and then stabilized, and the stabilized proteins are Disclosed is a method for treating cancer characterized by contact with one or more proteins participating in wild-type activity.

US patent application US6479285 (named p53 as a regulator of cell differentiation) provides a method of inhibiting the activity of p53 and screens these tissues as a screening tool to find substances that can overcome p53-related blocks in differentiation. It can be used. However, the expression level of DNp63 has not been used for screening of anticancer drugs.

The present inventors have found that the expression level of DNp63 can be used for the screening of anticancer agents and completed the present invention.

The present invention seeks to provide a method for screening anticancer agents using the DNp63 promoter.

The present invention relates to a DNp63 promoter characterized by having SEQ ID NO: 1 which induces expression of the DNp63 protein by contact of a potential anticancer agent in epithelial cell derived cancer cells.

The present invention relates to a recombinant vector for screening an anticancer agent comprising a reporter gene for confirming expression with the promoter.

More specifically, the reporter gene relates to a recombinant vector for screening an anticancer agent, characterized in that the green fluorescent protein (GFP).

The present invention relates to cancer cells derived from epithelial cells for screening anticancer agents transformed with the recombinant vector.

The present invention comprises the steps of transforming the recombinant vector into epithelial cell-derived cancer cells;

Contacting the potential anticancer substance with the cancer cell;

It relates to an anticancer substance screening method comprising the step of measuring the expression amount of the reporter in the cancer cells.

The present invention is epithelial-derived cancer cells transformed with the recombinant vector;

A container for contacting the cancer cell with a potential anticancer substance; And

It relates to an anticancer drug diagnostic kit comprising a device for measuring the expression amount of green fluorescent protein in the cancer cells.

In a first aspect, the present invention relates to a DNp63 promoter having SEQ ID NO: 1 which induces expression of the DNp63 protein by contact of a potential anticancer agent in epithelial cell-derived cancer cells.

Potential anticancer agents according to the present invention refer to substances effective for killing cancer cells.

In a second aspect, the present invention relates to a recombinant expression vector for screening an anticancer agent, comprising a promoter gene for confirming expression with the promoter.

The term vector, as used herein, refers to a nucleic acid molecule capable of binding and transferring another nucleic acid thereto. The term expression vector includes plasmids, cosmids or phages capable of synthesizing proteins encoded by each recombinant gene carried by the vector. Preferred vectors are vectors capable of self-replicating and expressing the nucleic acid to which they are bound.

In a third aspect, the present invention relates to epithelial cell-derived cancer cells transformed with the recombinant vector.

The term 'transformation' used in the present invention means that foreign DNA or RNA is absorbed into a cell and the genotype of the cell is changed.

Suitable epithelial cell derived cancer cells include, but are not limited to, HeLa cells, HaCAT, ZR-75-1, or ME180.

Transforming the recombinant vector into epithelial cell-derived cancer cells in a fourth aspect;

Contacting the potential anticancer substance with the cancer cell;

It relates to an anticancer substance screening method comprising the step of measuring the expression amount of the reporter in the cancer cells.

The method of confirming the expression of a promoter in cancer cells can be performed using a reporter gene. Reporter genes are not limited to specific genes. Any gene that expresses a product that can be easily measured can be used. Suitable reporter genes are well known to those skilled in the art. Examples of reporter genes include other enzyme detection systems such as CAT (chloramphenicol acetyl transferase), luciferase, beta-galactosidase; Bacterial luciferase, alkaline phosphatase and green fluorescent material (GFP) are included, but are not limited to these. Detection of reporter genes is well known to those skilled in the art. When a reporter gene is detected by its enzymatic activity, it generally comprises providing the enzyme with its appropriate substrate and detecting the reaction product (eg the light produced by luciferase). Detection can include simply detecting the presence or absence of the reporter gene product. Another method may include quantification of the expression level of the reporter gene product. The method of quantification can be absolute quantification or can be quantified compared to the expression level of the housekeeping gene. Such detection may be performed manually or may be performed automatically as in a high-throughput screening system.

High throughput test methods for the presence, absence or quantification of gene expression are well known to those skilled in the art. For example, US Pat. No. 5,559,410 describes a high throughput screening method for proteins and US Pat. No. 5,585,635 describes a high throughput screening method for nucleic acid binding. U.S. Patents 5,576,220 and 5,541,061 also describe high throughput screening methods for ligand / antibody binding.

In a fifth aspect, the present invention provides a method comprising cloning a ΔNp63α gene and a reporter gene capable of identifying the same into a vector;

Transforming the cloned vector into epithelial cell-derived cancer cells and expressing the cloned vector;

Contacting the latent substance with the cancer cell; And

The position of the ΔNp63α gene relates to a method for screening an anticancer agent comprising the step of confirming migration from the nucleus to the cytoplasm.

In a sixth aspect the present invention is epithelial-derived cancer cells transformed with the recombinant vector;

A container for contacting the cancer cell with a potential anticancer substance; And

It relates to an anticancer drug diagnostic kit comprising a device for measuring the expression amount of green fluorescent protein in the cancer cells.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following examples are illustrative of the present invention, and the content of the present invention is not limited by the following examples.

The inventors of the present invention have a promoter (about 56Kb) stored in pBACe3.6 having about 150kb of p63 Mus musculus genomic DNA containing a promoter portion of DNp63 that is specifically expressed in epithelial cancer cells. , And in humans. DNp63 is expressed in vertebrates and fugu has the same genes and regulators as compared to humans. In addition, since it has a nucleotide sequence of 1/10 of the human genome, there is an advantage in finding an evolutionarily conserved nucleotide sequence through gene comparison. The recombinant vector was established by the ET-gene recombination technique using GFP (Green Fluorescence Protein) including the internal ribosomal entry site (IRES) behind the 56 Kb promoter.

ET-gene recombination is attached to 5'- and 3'-site of the DNA fragment to be inserted as shown in Figure 2, by attaching a homologous arm of about 50bp corresponding to 5 'and 3' of the insertion position, A new technology that inserts DNA fragments into the BAC plasmid site at the intended site by gene recombination of the same-arm arm, and is used when subcloning through existing restriction enzyme cleavage linkage of more than 100 kb is impossible.

In RET / ET recombination, the DNA molecule of interest is modified by homologous genetic recombination in Escherichia coli expressing a protein derived from Reda / Redb from a lambda phage or a phage derived from RecE / RecT from a Rac phage. RecE and Reda have 5 'to 3' exonuclease activity and RecT and Redb are DNA annealing proteins. Genetic recombination occurs through homologous moieties. The homology to gene parts can be arbitrarily determined, allowing accurate and specific exchange of genetic information between two DNA molecules.

Example 1 Preparation of Recombinant Vector

Vector pBACe3.6 was used. The sacBII gene was inserted as a positive selection marker. The sacBII gene obtained from Bacillus amyloliquefaciens was derived from Nat Sternberg's P1 vector. Toxicity of the sacBII gene is caused by the conversion of fructose derived from polysaccharides to polyfructose (leban). It is toxic to E. coli. Cloning vectors and recombinant clones do not carry the sacBII gene, making them resistant to sugar. Therefore, undesirable clones are susceptible to sugar and thus cannot form colonies in a medium containing sugar. (Ref. Fregen, E et al. (1999) A modular, positive selection bacterial artificial chromosome vector with multiple cloning site.Genomics 58: 250-253)

An insert was inserted into EcoRI of pBACe3.6, and the clone number containing the p63 genomic DNA sequence is 329J23 Escherichia coli. The sequence of the promoter is shown in SEQ ID NO: 1.

A cleavage map of the pGETrec plasmid used for ET-gene recombination is shown in FIG. 4. The pGETrec vector is a vector expressing RecE and RecT, which are enzymes for ET gene recombination, and overexpress the protein by the arabinose induction system. Induction was performed using IPTG (final concentration = 1 mM), and DH10B bacteria were used to make competent cells for electrophoresis by induction for 3 hours.

Next, a vector having IRES-NLS-GFP-Km, which was used as a cassette, was prepared. IRES-NLS-GFP was used in the pBS / KS vector (Emma Dormand 1999). A schematic diagram of the cassette portion used is shown in FIG. 5. The cassette was cut out with EcoRI, SalI and sub-cloned into the MCS (multiple cloning portion) of the pEGFP-C1 vector (Clontech). Information on the pEGFP-C1 vector used is shown in FIG. 6. After cloning the primers for ET-gene recombination after PCR with primers with 50 bp of cancer (forward: TGCCCTCTCTCCATCCCCTGCCATTCCCTCCAACACAGATTACCCGGGC (SEQ ID NO: 2), reverse: GCCCAGAAACCATATTGTTTTGTTAAATATTATTTGGTGATGTCTAGGA (SEQ ID NO: 3)) after cloning. 400 ng of the cassette obtained by the above method was induced by pGETrec and transformed into DH10B Escherichia coli, which produced the competent cells, by electroporation.

Example 2 Established Recombinant Vector Confirms Epithelial Cancer Cell Specific Expression

In our recombinant vector, IRES-GFP is inserted after DNp63 promoter. GFP (Excitation maximum = 488 nm; emission maximum = 507 nm) has the advantage that it can be easily identified under a microscope by emitting a green wavelength at a specific absorbance, and IRES regulates the expression of GFP specifically in the promoter of DNp63 upstream. .

It was confirmed that the established recombinant vector specifically expresses epithelial cancer cells in ME180 cells, a DNp63 overexpressing epithelial cancer cell line, and HeLa cells, a cancer cell line not expressing DNp63 as a negative control (see FIG. 8).

As can be seen in Figure 8, it was confirmed through the GFP that the expression level is high in the cancer cell line ME180 overexpressing DNp63. However, when HeLa cells do not express GFP, it was confirmed that recombinant vectors are specifically regulated in cell lines.

Example 3 Confirmation of Promoter Function of DNp63 Gene Available for Anticancer Screening

In addition, the promoter of DNp63 gene, which is specifically expressed in the cell, may be used for anticancer drug screening only when the expression level in the cell signal is controlled. In our laboratory, it was confirmed that the expression level of DNp63 is increased with respect to TGF-β signal. Based on this, it was confirmed in human mammary epithelial (HME) cells that the recombinant vector increased GFP brightness for TGF-β signal.

As can be seen from the results of FIG. 9, the established recombinant vector has a weak expression level before TGF-β treatment, but it shows that the expression of GFP is specifically controlled through the increase in the brightness of GFP after the treatment.

DNp63 is an indicator gene specifically expressed in epithelial cancer cells, and the recombinant vector according to the present invention, which has only a specific transcriptional regulatory region of this gene, expresses a fluorescent protein, and thus can be easily identified with the naked eye. Do. In addition, as can be seen from the above, the expression of the cell line-specific and signaling system-specific expression is controlled, suggesting that the expression level of DNp63, an index gene of epithelial cancer cells, may be a criterion for judging the action of anticancer drugs. do. In other words, substances that inhibit the expression of GFP, a fluorescent protein in epithelial cancer cells with recombinant vectors, may be useful as anticancer agents, and the test method is simpler and more cost-effective than those previously used for screening anticancer agents. It has little advantage and short time to check, so a large amount of anticancer substance can be used for screening in the future.

In addition, since DNp63 is strongly suspected as an indicator gene for epithelial cancer cell expressing stem cells, anti-cancer substances that specifically eliminate the expression of DNp63 prevent the cancer from recurring by inhibiting the growth of stem cells. Recombinant vector usable for screening breakthrough anticancer agents.

Attach sequence list electronic file

Claims (7)

delete delete PBACe3.6 recombinant vector for screening an anticancer agent comprising a DNp63 promoter of SEQ ID NO: 1 and a reporter gene for confirming the promoter expression. 4. The recombinant vector for screening anticancer agents according to claim 3, wherein the reporter gene is a green fluorescent protein (GFP). Cancer cells for screening anticancer agent transformed with the recombinant vector according to claim 3. Transforming the recombinant vector according to claim 3 into epithelial-derived cancer cells; Contacting the potential anticancer substance with the cancer cell; Anticancer substance screening method comprising the step of measuring the expression amount of the reporter in the cancer cells. Epithelial-derived cancer cells transformed with the recombinant vector according to claim 4; A container for contacting said cancer cell with a potential anticancer substance; And Anti-cancer drug diagnostic kit comprising a device for measuring the expression amount of the green fluorescent protein in the cancer cells.

Images