CN106978399A - The mouse macrophage and construction method of nlrp3 gene knockouts - Google Patents
The mouse macrophage and construction method of nlrp3 gene knockouts Download PDFInfo
- Publication number
- CN106978399A CN106978399A CN201710083814.XA CN201710083814A CN106978399A CN 106978399 A CN106978399 A CN 106978399A CN 201710083814 A CN201710083814 A CN 201710083814A CN 106978399 A CN106978399 A CN 106978399A
- Authority
- CN
- China
- Prior art keywords
- nlrp3
- cell
- sequence
- genes
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0645—Macrophages, e.g. Kuepfer cells in the liver; Monocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of cell line of nlrp3 gene knockouts and construction method, using CRISPR technologies, by one insertion A of gene of NLRP3 in DNA sequence, another lacks AG to this method and causes cell to completely lose the expression of the albumen.And in terms of the deletion cells system form speed of growth with control cell without obvious difference.TNF α expression can be activated using endotoxin LPS, the immune response of deletion cells system is activated, there was no significant difference with normal cell；And NLRP3 activator is used, the Disability of its inflammatory corpusculum activation, the substantially secretion without the β of IL 1.Cell line NLRP3 afunction in the present invention is confirmed, and other functions are uninfluenced.To sum up, NLRP3 deletion cells system Nlrp3/RAW can be used as research NLRP3 protein functions, NLRP3 inflammatories corpusculum, the negative good cell model screened of medicine in the present invention.
Description
Technical field
The present invention relates to cell line, in particular to the cell line and construction method of a kind of nlrp3 gene knockouts.
Background technology
NLRP3 is also cryopyrin, belongs to NOD samples receptor family (NLRs), and disease is recognized as a kind of pattern recognition receptors
Pathogen associated molecular pattern, activation is a kind of to be combined by NOD acceptor NLRP3, ASC acceptors and the caspase-1 albumen constituted
Body --- inflammatory corpusculum, activates cell factor the IL-1 β and IL-18 in downstream, the activation of inflammatory corpusculum is the important innate immunity
Reaction.Last decade is also very burning hot for NLRP3 research, the uric acid of its energy hazard recognition signaling molecule such as damaged cell release
Crystal and ATP, can also recognize the RNA produced in the perforation toxin discharged during pathogen infection, some virus replications
Deng.Because of the popularity of its Receptor recognition, can be activated by polytype danger signal or pathogen, and have proven at present its
Played a significant role in a variety of lysises.And as the core of inflammatory reaction, NLRP3 inflammation corpusculum may be various inflammatory
The treatment of disease provides new target spot.It has in basic research and clinical disease treatment is of great significance.
RAW246.7 is the continuous cell line of mouse macrophage, NLRP3 expression is lacked in RAW246.7 cells, just
In the research of NLRP3 protein functions.Because utilizing CRISPR technologies, the genome of cell is operated, and can screening-gene
The cell homozygote of knockout, stable beneficial to cell phenotype is passed on.Although current person monocytic cell's type lymthoma on sale on the market
The cell line of NLRP3 loss of expression in THP1 cells, but it does not verify that it is lacked in protein level, and have no thin in mouse source
Missing nlrp3 genes report in born of the same parents system.
The content of the invention
It is an object of the invention to provide a kind of cell line of NLRP3 gene knockouts and construction method.The present invention is utilized
The characteristics of CRISPR technologies targeting specific and high cutting efficiency, carries out mutation transformation to the genome of cell, and this can be terminated completely
The expression of gene, reaches the effect of knockout；Because it is transformed cell in genomic level, and diplochromosome is dashed forward
Become, the cell line that obtained nlrp3 genes are knocked out completely, and the sufficiently stable heredity of character energy, it is further research to be
NLRP3 protein functions provide more reliable cell model.
To achieve the above object, a kind of mouse RAW cell lines for NLRP3 expression deletions that the present invention is provided, the cell
In the full-length genome of system, first paragraph exon genes sequence (the NLRP3 genes of the NLRP3 genes on o.11 chromosome one
Sequence is logined in NCBI, and its number of logining is GI:372099099, first paragraph exon genes sequence as shown in SEQ IDNO.1, its
At the site of 59543119-59543398 in NLRP3 gene orders) on insert a base A, cause the gene frameshit
And expression is terminated in advance；Base AG is lacked on another chromosome in the first paragraph exon genes sequence of NLRP3 genes, is made
Can not correctly it be expressed into the gene, so as to reach the purpose of NLRP3 gene knockouts.
Preferably, in the full-length genome of the cell line, on the NLRP3 genes of o.11 chromosome one
A base A is inserted on one section of site of exon genes sequence 92, and (92 site corresponds on NLRP3 genes 59543210
Point), base AG missings (this on 92 and 93 sites in NLRP3 gene first paragraph exon genes sequences on another chromosome
Two sites correspond to 59543210 and 59543211 sites).
Present invention also offers a kind of side of the macrophage system of the above-mentioned NLRP3 gene knockouts of utilization CRISPR technique constructions
Method, comprises the following steps：
1) Lenti-V2-mN3 plasmids are built
A. according to mouse NLRP3, the first paragraph exon genes sequence of the upper NLRP3 genes of o.11 chromosome one
(NLRP3 gene orders are logined in NCBI, and its number of logining is GI:372099099, first paragraph exon genes sequence such as SEQ
Shown in IDNO.1, it is located at the site of the 59543119-59543398 in NLRP3 gene orders), analysis obtains sgRNA sequences,
According to the score (Fig. 1) of sgRNA sequences, choosing marking highest sequence is：
GAAGATTACCCGCCCGAGAA；
B. the sequence characteristic of end, design synthesis are connected according to LentiCRISPR V2 abbreviation Lenti-V2 carriers (Fig. 2)
Upstream and downstream primer sequence：
mN3-1:CACCGGAAGATTACCCGCCCGAGAA,
mN3-2：AAACTTCTCGGGCGGGTAATCTTCC；
Annealed and the complementary fragment mN3 containing cohesive end is obtained after phosphorylation, its sequence is：
5’-CACCGGAAGATTACCCGCCCGAGAA
CCTTCTAATGGGCGGGCTCTTCAAA-5’
C. the fragment mN3 containing cohesive end is connected to by the postdigestive Lenti-V2 carriers of BsmBI, obtaining
Lenti-V2-mN3 plasmids, sequencing result display target sequence is successfully connected into carrier.
2) 293T cells are transfected, slow virus particle is obtained
293T cells are spread into 6 orifice plates, plasmid pMD2.G, psPAX2, lenti-V2-mN3 that slow virus is packed are pressed
According to 1：1：1, every kind of plasmid is each according to 1.5 μ g transfectional cells, and wherein pMD2.G, which can form virus envelope, psPAX2, can express gag
Not only contain with the viral packaging of pol progress, lenti-V2-mN3 plasmids and be packaged into pseudovirion packaging signal, long end
Repetitive sequence, also containing cas9 albumen and guide RNA sequence and puromycin resistance screening genes；Transfection changes liquid after 12 hours,
Plasmid is expressed in cell and then packs slow virus particle, transfection 48h cells and supernatant is collected, 12000 turns 4 degree from
After the heart 10 minutes, it is the suspension containing slow virus particle that supernatant is obtained again.
3) RAW infects slow virus and obtains single cell clone
A) screening RAW Cells with Antibiotics puromycin sensitive concentration
There is the effect of killing to cell in the case of high concentration in puromycin antibiotic.After slow-virus infection, accordingly
Resistant gene be inserted into chromosomal expression resistance, as doubtful positive cell, its carry puromycin resistant genes, can support
Lethal effects of the anti-puromycin to cell.RAW sensitive concentrations are filtered out, positive cell can be retained and make negative cells dead
Die.RAW cells are spread into 12 orifice plates, the puromycin of various concentrations is added, continuous observation cell state daily obtains energy
The concentration of enough antibiotic for killing cell completely in finite time at 7 days.And this concentration is set to later stage screening RAW cells
The sensitive concentration for the RAW cells tested in sensitive concentration, experiment is 2.5 μ g/ml；
B) slow-virus infection, screens the positive cell recombinated
Macrophage RAW cells are screened using antibiotic puromycin, then to the RAW passages of screening to 6 orifice plates
In, the suspension that the DMEM complete mediums and half volume of half volume contain slow virus particle, RAW are added into culture hole
After cell is cultivated 24 hours in 6 orifice plates, cell dissociation is transferred in new 10cm plates while adding 10ml fresh cultureds
Base, and according to the sensitive concentration of RAW cells, add 25ug puromycin antibiotic-screening positive cells, as NLRP3 genes
The cell line of knockout.
Preferably, the step 1) in, sgRNA sequences, its sequence is：GAAGATTACCCGCCCGAGAA.
Preferably, the step 2) in, the primer pair for phosphorylation of annealing：
mN3-1:CACCGGAAGATTACCCGCCCGAGAA,
mN3-2：AAACTTCTCGGGCGGGTAATCTTCC.
The beneficial effects of the present invention are：
Missing NLRP3 expression completely, beneficial to the research of research NLRP3 protein functions, is beneficial in mouse RAW cell lines
For the research of NLRP3 inflammatory corpusculums, the negative cell model screened of NLRP3 target agents can be used as.
Brief description of the drawings
Fig. 1 is different sgRNA marking situation maps；
Fig. 2 is lenti-V2 Vector map figure；
Fig. 3 is that the sgRNA selected connects the result figure being sequenced after lenti-V2；
Fig. 4 is pMD2.G and psPAX2 Vector map；
Fig. 5 is the WB detection figures that NLRP3 is expressed in control cell and deletion cells system；
The sequence fragment figure that Fig. 6 amplifies for the identification primer of design；
Fig. 7 is to occur insertion and deletion mutation figure in cell line NLRP3 sequences；
Fig. 8 is no significant difference figure in deletion cells system and control cell form；
Fig. 9 is that sensitiveness and normal cell difference that deletion cells system induced by endotoxin is stimulated is not notable；
Figure 10 is that deletion cells system IL-1 β secretions are substantially less than normal cell system.
Embodiment
In order to preferably explain the present invention, below in conjunction with the specific embodiment main contents that the present invention is furture elucidated, but
Present disclosure is not limited solely to following examples.
The method that embodiment 1 builds the cell line of NLRP3 gene knockouts
1) Lenti-V2-mN3 plasmids are built
A. according to sequence (sequence 1) NLRP3 gene orders of mouse NLRP3 cDNA exons 1 login in
NCBI, its number of logining is GI:372099099, first paragraph exon genes sequence is as shown in SEQ IDNO.1, and it is located at NLRP3
At the site of 59543119-59543398 in gene order, root obtains sgRNA it was predicted that analyzing, and selects marking highest
SgRNA (Fig. 1), its sequence is GAAGATTACCCGCCCGAGAA；
B. the sequence characteristic of end, design synthesis upstream and downstream are connected according to sgRNA score and Lenti-V2 carriers (Fig. 2)
Primer sequence：
mN3-1:CACCGGAAGATTACCCGCCCGAGAA,
mN3-2：AAACTTCTCGGGCGGGTAATCTTCC；
The fragment mN3 containing cohesive end is formed after it is carried out into annealing phosphorylation according to fixed program, its sequence is such as
Under：
5’-CACCGGAAGATTACCCGCCCGAGAA
CCTTCTAATGGGCGGGCTCTTCAAA-5’
MN3 is connected to by the postdigestive Lenti-V2 carriers of BsmBI, obtaining Lenti-V2-mN3 plasmids, is sequenced
As a result display target sequence is successfully connected into carrier (Fig. 3).
2) 293T cells are transfected, slow virus particle is obtained
293T cells are spread into 6 orifice plates, plasmid pMD2.G (Fig. 4) that slow virus is packed, psPAX2 (Fig. 5),
Lenti-V2-mN3 is according to 1：1：1, every kind of plasmid is each according to 1.5 μ g transfectional cells；Wherein pMD2.G can be formed virus envelope,
PsPAX2 can express gag and pol and carry out viral packaging, lenti-V2-mN3 plasmids not only containing packaging signal, the repetition of long end
Sequence, also containing cas9 albumen and guide RNA sequence in pseudovirion can be packaged into；Transfection changes liquid, one after 12 hours
Need to add 500 μ l complete mediums extra-nutrition after it, after persistently cultivating 48 hours,
Plasmid is expressed in cell and then packs slow virus particle, and transfection 48h collects cells and supernatant,
After 12000 turns 4 degree centrifuge 10 minutes, it is the suspension containing slow virus particle that supernatant is obtained again.
3) RAW infects slow virus and obtains single cell clone
A) screening RAW Cells with Antibiotics puromycin sensitive concentration
There is the effect of killing to cell in the case of high concentration in puromycin antibiotic.After slow-virus infection, accordingly
Resistant gene be inserted into chromosomal expression resistance, as doubtful positive cell, its carry puromycin resistant genes, can support
Lethal effects of the anti-puromycin to cell.RAW sensitive concentrations are filtered out, positive cell can be retained and make negative cells dead
Die.RAW cells are spread into 12 orifice plates, the puromycin of various concentrations is added, continuous observation cell state daily obtains energy
The concentration of enough antibiotic for killing cell completely in finite time at 7 days.And this concentration is set to later stage screening RAW cells
The sensitive concentration for the RAW cells tested in sensitive concentration, experiment is 2.5 μ g/ml；
B) slow-virus infection, screens the positive cell recombinated
Macrophage RAW cells are screened using antibiotic puromycin, then to the RAW passages of screening to 6 orifice plates
In, the suspension that the DMEM complete mediums and half volume of half volume contain slow virus particle, RAW are added into culture hole
After cell is cultivated 24 hours in 6 orifice plates, cell dissociation is transferred in new 10cm plates while adding 10ml fresh cultureds
Base, and according to the sensitive concentration of RAW cells, 25ug puromycin antibiotic-screening puromycin resistance positive cells are added,
The as cell line of NLRP3 gene knockouts.
The cell line of the picking of embodiment 2 and screening NLRP3 gene knockouts
1) the doubtful correct single cell colonies of culture are expanded
The cell line of NLRP3 gene knockouts is cultivated, after antibiotic is added three days, cell death is more.Now need to change
Liquid is simultaneously added antibiotic and entered in cell.When cultivating 7-10 days, it may appear that single cell clone.For wanting for single cell colonies
It should be completely independent to ask, and do not occur simultaneously with peripheral cell colony and apart from each other.
2) single cell colonies expand culture
The picking 1 in super-clean bench) in single colony for irising out, the monoclonal cell of acquisition spread into 24 orifice plates, now cell
Growth is slower.Cell can gradually cover with complete opening within 4-5 days, by the passage covered with, divide into 3 12 orifice plates, add enough
Culture medium and antibiotic, obtain eugonic cell, that is, obtain the cell line of NLRP3 gene knockouts.
The cell line identification of the NLRP3 gene knockouts of embodiment 3
1st, identified from protein level cellular genome
Doubtful correct cell line total protein is extracted using Western and IP lysates, the concentration of albumen is determined with G250.
The SDS-PAGE glue of preparation 10%, the albumen for adding about 100 μ g distinguishes electrophoresis 30min and 90min under conditions of 80V, 120V.
After electrophoresis is finished, the wet film 80min that walks around of 100V condition is used.Closed with 2%BSA Blocking Buffer room temperatures jog
60min, plus primary antibody Monoclonal ANTI NLRP3antibody produced in mouse, are incubated at room temperature 120min.With
TBS containing 0.05%Tween-20 is washed after film 3 times, plus secondary antibody Anti-Mouse IgG (whole-molecule)-
Peroxidase, room temperature jog is incubated 60min.Film is washed using TBST 5 times to wash unnecessary antibody, then is sent out with ECL chemistry
Light kit develops the color (Fig. 6).As a result show：NLRP3 expression is lacked completely.：
2nd, genomic level is identified cellular genome
Cellular genome is extracted using TAKARA full-length genome extracts kit, extracting method is as follows：Add 1ml
DNAiso Reagent, cell is blown and beaten to scattering completely, be stored at room temperature 5min with rifle；
2nd, centrifuge, 4 DEG C of 10000g or room temperature centrifugation 10min go to supernatant in new EP pipes；
3rd, the absolute ethyl alcohol of added DNAiso Reagent 1/2 volume in 1 is added into above-mentioned lysate.Overturn repeatedly
Mix 1-3min.4000g room temperatures centrifuge 2min, precipitate DNA；
4th, slow to add the ethanol of 1ml 75% (being sure not to touch precipitation) along centrifugation tube wall, gently turn upside down washing centrifuge tube
After wall, 4 DEG C of centrifugation 5min of 12000g, ethanol is carefully discarded；
5th, repeat step 4；
6th, the genomic DNA precipitation after ethanol will be removed to be dried at room temperature for 5-15s (drying time is long, can be difficult molten
Solution), it is slowly added to appropriate H2O (can be 40 microlitres) dissolving DNA, is obtained after DNA, then using the DNA of this monoclonal cell as
Masterplate, uses following primer：
N3JDP1:CTTCGTTTTCTGGAAGTGG；
N3JDP2:AAAACCCATGGTCAGAGAA,
NLRP3 Gene Partial fragments are expanded, amplification length is to connect after the completion of 936bp, amplification to obtain into T idlings
The bacteria colonies of single clone, send sequencing, and the sequence is shown in SEQ IDNO.2.Sequencing result shows, 20 of NLRP3 genes
There is the mutation of two kinds of situations in monoclonal, the sequencing result for the cell line that protein expression is lacked completely shows No. 11 in PAM regions
A base A is inserted on NLRP3 genes in the cell line one of chromosome and causes frameshift mutation, on another chromosome
One base AG of NLRP3 gene delections, the frameshift mutation (Fig. 7) for causing cell to express, you can speculate in the cell line No. 11
Two NLRP3 genes of chromosome there occurs frameshift mutation, be the immediate cause for causing NLRP3 loss of expression.
The cell line biological analysis of embodiment 4NLRP3 gene knockouts
1) cellular morphology is observed
During deletion cells cell line and RAW continuous passage simultaneously, find both not only in form without significant
Difference, and its speed of growth is similar.After continuous passage ten times, the expression of the NLRP3 albumen of cell is detected and to the section
Gene order-checking, it is found that the cell line built is sufficiently stable (Fig. 8).
The cell line functional verification of embodiment 5NLRP3 gene knockouts
A) by Nlrp3- ,/- after being passed on once with normal RAW cell recoveries, takes the Nlrp3-/- RAW and RAW of equivalent thin
Born of the same parents add the TNF-α secreted in LPS processing cells, detection culture supernatant into 12 orifice plates, and experimental result is shown in two kinds of cells
The secretory volume of middle TNF-α is without significant difference, it was demonstrated that in the case of its stimulation to this experiment LPS, the secretion of deletion cells system TNF-α
Amount and control cell indifference (Fig. 9).
B) NLRP3 inflammatories corpusculum Activity determination
The IL-1 β of mature form secretory volume is to weigh the important indicator of inflammatory corpusculum activation in supernatant.Take equivalent
Nlrp3-/- RAW is with RAW cells into 12 orifice plates, and the program activated according to inflammatory corpusculum handles cell：Cell is used first
1ug/ml LPS pretreatment cells, being subsequently added activation NLRP3 inflammatories corpusculum perforation toxin protein hemolysin respectively stimulates cell
6 hours.The IL-1 β secreted in detection supernatant, in Nlrp3-/- RAW and RAW cells, form the energy of NLRP3 inflammatory corpusculums
Power.
We have found that Nlrp3-/- RAW and RAW generations under conditions of the processing of NLRP3 inflammatory corpusculums activator in testing result
The IL-1 β of table inflammatory corpusculum activation secretory volume has extremely significant difference (Figure 10) in two kinds of cells, lacks Nlrp3-/- pole
The big IL-1 β that have impact on the activation of NLRP3 activators secretion, further relates to the expression that Nlrp3-/- RAW has lacked nlrp3, shadow
Ring the activation of itself inflammatory corpusculum.Therefore, research RAW lacks Nlrp3 cell line, can turn into research Nlrp3 inflammatory corpusculums
The fabulous model of function.
Other unspecified parts are prior art.Although above-described embodiment is made that to the present invention and retouched in detail
State, but it is only a part of embodiment of the invention, rather than whole embodiments, people can also according to the present embodiment without
Other embodiment is obtained under the premise of creativeness, these embodiments belong to the scope of the present invention.
Sequence table
<110>Hua Zhong Agriculture University
<120>The cell line and construction method and purposes of NLRP3 expression deletions
<210> 1
<211> 255
<212> DNA
<213>First paragraph extron portion gene
<400> 1
AGTGTCCGTTGCAAGCTGGCTCAGTATCTAGAGGACCTTGAAGATGTGGACCTCAAGAAATTCAAAATGCATT
TGGAAGATTACCCGCCCGAGAAAGGCTGTATCCCAGTCCCCAGGGGCCAGATGGAGAAGGCAGATCACTTGGA
TCTAGCCACACTCATGATTGACTTCAATGGCGAGGAGAAGGCCTGGGCCATGGCTGTGTGGATCTTTGCTGCG
ATCAACAGGCGAGACCTCTGGGAAAAAGCTAAGAAG
<210> 2
<211>936
<212> DNA
<213>NLRP3 Gene Partial fragments
<400> 2
CTTCGTTTTCTGGAAGTGGAGACTTTTAATACCATTCTTCTTTACTCCCATGGGGTTTTCATTCCTGCACTGC
CAGTGTGGACCTAAGCCCCGAGACCCTCGAAAGGGCTGCTGCTGAAGATGACGAGTGTCCGTTGCAAGCTGGC
TCAGTATCTAGAGGACCTTGAAGATGTGGACCTCAAGAAATTCAAAATGCATTTGGAAGATTACCCGCCCGAG
AAAGGCTGTATCCCAGTCCCCAGGGGCCAGATGGAGAAGGCAGATCACTTGGATCTAGCCACACTCATGATTG
ACTTCAATGGCGAGGAGAAGGCCTGGGCCATGGCTGTGTGGATCTTTGCTGCGATCAACAGGCGAGACCTCTG
GGAAAAAGCTAAGAAGGACCAGCCAGAGTGGAGTGAGTAAACAGAAGGGTTTTTGGTTTTGTTTGTTTGTTTG
TTTGTTTCTTACAGTAAGGTACACGTGACATAAAAGGTGGAATTTTAGTAATTTTACATATATGGCTTAGCAA
CAAGAAAACATATGGTTGTGCAACCAACTTCTCATCTTGCACAACTGAAGCTCCCAACACACTAGATGATAAG
TCCCCATTACCTAACCCCATCTCCTAGCAACCACCGCTGTTTTCTGTCCCTGTGAACTTTACCTCTATGGATT
CCTCGTGCAGGTAGATTCATGGAGGGCTTGTTTCTTTTGGCTGGCTTACTTCACTTAGCATAATGTGTTCAGG
TACATCAGAATTTCCTTCTTAAAAAAGGTTAATGTTGAATATTCATGTGTGTCTATTACATTGTGCTTGTCTC
ATCTGTGCATATCCATTTGCTATGGATAACTATGTCTATTCAACATCTTCAGTTCTCTGGTTTTGAGTTCGAG
TCTCAAGTATCCCAGGCTGGCTCCAAACACAGAATCCTCTTTTCTCTGACCATGGGTTTT
Claims (5)
1. a kind of mouse macrophage of nlrp3 gene knockouts, it is characterised in that：In the full-length genome of the cell line, the
A base A is inserted in the first paragraph exon genes sequence of NLRP3 genes on No. 11 chromosomes one, another dyeing
Base AG is lacked on body in the first paragraph exon genes sequence of NLRP3 genes, wherein, first paragraph exon genes sequence is such as
Shown in SEQ IDNO.1.
2. the mouse macrophage system of nlrp3 gene knockouts according to claim 1, it is characterised in that：The cell line
Full-length genome in, on the site of first paragraph exon genes sequence 92 on the NLRP3 genes of o.11 chromosome one insert
Base AG lacks on 92 and 93 sites in NLRP3 genes first paragraph exon genes sequence on one base A, another chromosome
Lose.
3. a kind of method of the mouse macrophage of nlrp3 gene knockouts described in utilization CRISPR technique construction claims 1,
It is characterized in that：Comprise the following steps：
1) Lenti-V2-mN3 plasmids are built
A. according to the sequence of mouse NLRP3 cDNA exons 1, analysis obtains sgRNA sequences；
B. the sequence characteristic of end is connected according to the score of sgRNA sequences and Lenti-V2 carriers, annealing phosphorylation is carried out and obtains
Fragment mN3 containing cohesive end, its sequence is：
5’-CACCGGAAGATTACCCGCCCGAGAA
CCTTCTAATGGGCGGGCTCTTCAAA-5’；
C. the fragment mN3 containing cohesive end is connected on Lenti-V2 carriers, obtains Lenti-V2-mN3 plasmids；
2) 293T cells are transfected, slow virus particle is obtained
293T cells are spread into 6 orifice plates, plasmid pVSV-G, psPAX2, lenti-V2-mN3 that slow virus is packed are according to 1：
1：1, every kind of plasmid is each according to 1.5 μ g transfectional cells；Plasmid is expressed in cell, culture centrifugation, and it is containing slow to obtain supernatant
The suspension of virion；
3) RAW infects slow virus and obtains single cell clone
RAW cells are screened using antibiotic puromycin, then to the RAW passages of screening into 6 orifice plates, to culture hole
In add the suspension that the DMEM complete mediums and half volume of half volume contain slow virus particle, add antibiotic
Puromycin continues to cultivate screening positive cell, obtains single granulocyte colony, and picking list granulocyte colony continues to screen, Ran Houjian
Survey, i.e., the cell line of NLRP3 expression deletions.
4. the method for the mouse macrophage of CRISPR technique construction nlrp3 gene knockouts is utilized according to claim 3,
It is characterized in that：The step 1) in, sgRNA sequences, its sequence is：GAAGATTACCCGCCCGAGAA.
5. the side of the mouse macrophage of CRISPR technique construction nlrp3 gene knockouts is utilized according to claim 3 or 5
Method, it is characterised in that：The step 2) in, the primer pair for phosphorylation of annealing：
mN3-1:CACCGGAAGATTACCCGCCCGAGAA,
mN3-2：AAACTTCTCGGGCGGGTAATCTTCC.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710083814.XA CN106978399A (en) | 2017-02-16 | 2017-02-16 | The mouse macrophage and construction method of nlrp3 gene knockouts |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710083814.XA CN106978399A (en) | 2017-02-16 | 2017-02-16 | The mouse macrophage and construction method of nlrp3 gene knockouts |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106978399A true CN106978399A (en) | 2017-07-25 |
Family
ID=59338656
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710083814.XA Pending CN106978399A (en) | 2017-02-16 | 2017-02-16 | The mouse macrophage and construction method of nlrp3 gene knockouts |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106978399A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109735568A (en) * | 2019-01-28 | 2019-05-10 | 贵州大学 | Stablize the construction method of expression FGF-1 albuminous cell strain |
| CN110402894A (en) * | 2019-07-30 | 2019-11-05 | 中国人民解放军总医院第五医学中心 | A kind of drug diathesis liver injury model and its construction method and application |
| CN110684736A (en) * | 2019-08-15 | 2020-01-14 | 扬州大学 | Chicken Shp-2 gene knockout cell line based on CRISPR-Cas9 editing technology and construction method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103668472A (en) * | 2013-12-31 | 2014-03-26 | 北京大学 | Method for constructing eukaryon gene knockout library by using CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system |
| CN103667195A (en) * | 2013-12-17 | 2014-03-26 | 南京大学 | Drug screening cell model with NLRP3 (NLR family, pyrin domain containing 3) as target spot and application of drug screening cell model |
| CN105950656A (en) * | 2016-05-31 | 2016-09-21 | 青岛农业大学 | Method for rapidly obtaining gene knockout cell strains |
-
2017
- 2017-02-16 CN CN201710083814.XA patent/CN106978399A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667195A (en) * | 2013-12-17 | 2014-03-26 | 南京大学 | Drug screening cell model with NLRP3 (NLR family, pyrin domain containing 3) as target spot and application of drug screening cell model |
| CN103668472A (en) * | 2013-12-31 | 2014-03-26 | 北京大学 | Method for constructing eukaryon gene knockout library by using CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system |
| CN105950656A (en) * | 2016-05-31 | 2016-09-21 | 青岛农业大学 | Method for rapidly obtaining gene knockout cell strains |
Non-Patent Citations (1)
| Title |
|---|
| WAN-TING HE等: "Gasdermin D is an executor of pyroptosis and required for interleukin-1βsecretion", 《CELL RESEARCH》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109735568A (en) * | 2019-01-28 | 2019-05-10 | 贵州大学 | Stablize the construction method of expression FGF-1 albuminous cell strain |
| CN110402894A (en) * | 2019-07-30 | 2019-11-05 | 中国人民解放军总医院第五医学中心 | A kind of drug diathesis liver injury model and its construction method and application |
| CN110684736A (en) * | 2019-08-15 | 2020-01-14 | 扬州大学 | Chicken Shp-2 gene knockout cell line based on CRISPR-Cas9 editing technology and construction method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106047877B (en) | sgRNA and CRISPR/Cas9 lentivirus system for targeted knockout of FTO gene and application | |
| CN104560864B (en) | Utilize the 293T cell lines of the knockout IFN β genes of CRISPR Cas9 system constructings | |
| CN108486108A (en) | It is a kind of knock out people's HMGB1 genes cell strain and its application | |
| CN107446954A (en) | A kind of preparation method of SD rat T cells deleting genetic model | |
| CN103627673B (en) | A kind of human glioma cell line and its method for building up and application | |
| CN106978399A (en) | The mouse macrophage and construction method of nlrp3 gene knockouts | |
| CN113973779B (en) | Method for artificially inducing polyploid loaches | |
| CN105200014B (en) | Duck tembusu virus infection clones attenuated vaccine strain and its preparation method and application | |
| CN110396546A (en) | One kind gene relevant to the high reproductive trait of pig and SNP marker and application | |
| CN109212230B (en) | Sensitized polystyrene nano-microsphere for detecting canine parvovirus structural protein VP2 antibody and preparation method and application thereof | |
| WO2020007002A1 (en) | Method for acquiring and creating sterile mutant | |
| CN106318975A (en) | Method for constructing swine-borne BVDV-22 strain infectious cDNA (complementary deoxyribonucleic acid) clone and application thereof | |
| CN108070567A (en) | A kind of urine derived cell strain of immortalization and its construction method | |
| CN107607699A (en) | One kind evaluation main flow flue gas in tobacco induces trachea model method for building up, evaluation method outside inflammatory reaction animal body | |
| CN105039241B (en) | Shelled Turtle Trionyx Sinensis heart cell continuous cell line and its construction method and cryopreservation method | |
| CN107916297B (en) | Kit for identifying phoenix-tail type high-quality dendrobium officinale and application thereof | |
| CN108130314A (en) | A kind of monoclonal cell cultural method | |
| CN107384956A (en) | Knock out application of the p53 genes in neuroglial cytoma propagation and transfer is suppressed | |
| CN105695384A (en) | Recombinant salmonella capable of expressing red fluorescence protein and building method of recombinant salmonella | |
| CN106244662A (en) | A kind of detect the gum base type tobacco product method to human mouth cells in vitro Micronucleus | |
| CN101845504B (en) | Primer sequence for identifying resistance of cucumber against alternaria cucumerina and identification method thereof | |
| CN107177630A (en) | A kind of anti-PCV2 transgene pigs preparation method without exogenous marker gene | |
| CN110951694B (en) | Preparation method of autologous trophoblast and culture method of SNK cells | |
| CN107018955A (en) | A kind of transgene pig of the type of resisting porcine circovirus 2 | |
| CN112941020A (en) | Application of chicken circular RNA in promoting proliferation of myoblasts |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170725 |