CN106967750A - A kind of method that utilization particle bombardment mediates genetic transformation mao bamboon - Google Patents
A kind of method that utilization particle bombardment mediates genetic transformation mao bamboon Download PDFInfo
- Publication number
- CN106967750A CN106967750A CN201710205876.3A CN201710205876A CN106967750A CN 106967750 A CN106967750 A CN 106967750A CN 201710205876 A CN201710205876 A CN 201710205876A CN 106967750 A CN106967750 A CN 106967750A
- Authority
- CN
- China
- Prior art keywords
- culture medium
- concentration
- mao bamboon
- bamboo
- preculture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
- C12N15/895—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection using biolistic methods
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of method that utilization particle bombardment mediates genetic transformation mao bamboon.The formula of special culture media during acquisition and preculture of the method for the present invention including mao bamboon mature embryo, the extraction of the plasmid containing target gene, particle gun parameter setting, resistance screening, transformed plant identification, positive plant cultivation and transplanting and other steps, and conversion and induction respectively.The present invention solves the problem of mao bamboon is difficult to carry out genetic transformation, can effectively shorten the cycle (screening obtains resistance seedling after one month, can obtain positive plant in two to four months) for obtaining transgenosis bamboo, improve the probability for obtaining transgenosis mao bamboon.And the method for the present invention is reproducible, there is important effect and wide application prospect to industrial bamboo genetic improvement and bamboo functional genomics research etc..
Description
Technical field
The present invention relates to a kind of method that utilization particle bombardment mediates genetic transformation mao bamboon, belong to plant transgenic technology neck
Domain.
Background technology
Bamboo class is grass family (Gramimineae) Bambusoideae (Bambusoideae) perennial evergreen plant.Whole world bamboo
Class resource belongs to more about 70,1250 kinds, and China's bamboo resource has 39 category, kind more than 500, bamboo grove area, the accumulation Deng Junju worlds
First, 40 ° of areass to the south of north latitude are mainly distributed on, are both one of important forest reserves, while being also important renewable money
Source.Mainly there are two methods for the raising of bamboo fibre quality：One is conventional breeding mode, but because bamboo blooms with uncertain
Property, and Post flowering is the features such as be death, it is huge by being limited；Two be that it is entered on a molecular scale by genetic engineering means
Row improvement.But so far, the superiority of bamboo fibre is mainly verified by some physico-chemical analysis, but not in molecular level
It is upper to be furtherd investigate.
At present, bamboo genoid clone and its genetic improvement in terms of research still locate starting and the exploratory stage.In gene cloning
Aspect, although having cloned the related synthase gene of regulation and control bamboo lignin on cizu, green bamboo, mao bamboon in succession, has no in bamboo
Success carries out the research report of genetic transformation.
Mao bamboon (Phyllostachys pubescens) is as a kind of important forest reserves of south China, with higher
Society, economy and ecological benefits, in bamboo industry have critical role.Mao bamboon (Phyllostachys pubescens) is
The scattered type bamboo plant of single shaft.Mao bamboon seed cdna type difference is big, the mao bamboo seed embryo callus induction rate of different genotype and
Callus quality difference is also larger, and repeatability is bad, only a small amount of about mao bamboon callus induction and the report of regeneration at present
Road；And Agrobacterium bacteriostatic agent such as carboxylic Bian penicillin and cephalo penicillin etc. are commonly used during screening and culturing, mao bamboon is cured
The injury of injured tissue is larger, there is no successfully the example of genetic transformation mao bamboon to be reported at present.
Agrobacterium-mediated transformation is mainly used in dicotyledon, and is above subject to many limitations in monocotyledon application, main
Will the problem of be that Agrobacterium mainly infects dicotyledon and only a few monocotyledon, most of monocotyledon is particularly
Grass is insensitive, and most of most important grain, industrial crops are graminaceous monocotyledonous in the world, so that
Limit its scope of application.In addition, Agrobacterium-mediated genetic transformation can the successful dependence to genotype also compare
It is relatively strong, even dicotyledon also has many kinds to be limited and be difficult to by Agrobacterium-mediated Transformation by genotype.
The content of the invention
It is an object of the present invention to provide a kind of method of the genetic transformation of bamboo.
The method of the genetic transformation for the bamboo that the present invention is provided comprises the following steps：
(1) embryo of bamboo seed is subjected to preculture in pre-culture medium, obtains the mature embryo after preculture；
(2) target gene is converted into the mature embryo after the preculture using particle bombardment, cultivates, obtain transgenosis bamboo
Son.
In the above method, the bombardment parameters of the particle bombardment are as follows：Bronze amount：80-240ug；Target distance：6-
12cm；Bombarding pressure：1100-1550psi；Vacuum：27.
In the above method, the bombardment parameters of the particle bombardment are as follows：Bronze amount：160ug；Target distance：6cm；Bombardment
Pressure：1350psi；Vacuum：27.
In the above method, the pre-culture medium is that MS a great number of elements solution, B5 organic elements solution, B5 trace elements is molten
The culture medium that liquid, MS iron salt solutions, 2,4-D, KT, IBA, sucrose and coagulator are uniformly mixed so as to obtain.
In the above method, the MS a great number of elements solution includes KNO3、NH4NO3、CaCL2、MgSO4·7H2O and KH2PO4。
In the above method, the B5 organic elements solution includes inositol, nicotinic acid, nicotinic acid sulphur ammonium and puridoxine hydrochloride.
In the above method, the B5 trace element solutions include KI, H3BO3、MnSO4·4H2O、ZnSO4·7H2O、
Na2MoO4·2H2O and CoCl2·6H2O。
In the above method, the MS iron salt solutions include FeSO4·7H20 and NA2EDTA。
In the above method,
Concentration of the 2,4-D in the pre-culture medium is 2mg/L；
Concentration of the KT in the pre-culture medium is 0.2mg/L；
Concentration of the IBA in the pre-culture medium is 0.4mg/L；
The KNO3Concentration in the pre-culture medium is 1.9g/L；
The NH4NO3Concentration in the pre-culture medium is 1.65g/L；
The CaCl2Concentration in the pre-culture medium is 0.33224g/L；
The MgSO4·7H2Concentration of the O in the pre-culture medium is 0.37g/L；
The KH2PO4Concentration in the pre-culture medium is 0.17g/L；
Concentration of the inositol in the pre-culture medium is 0.1g/L；
Concentration of the nicotinic acid in the pre-culture medium is 0.001g/L；
Concentration of the nicotinic acid sulphur ammonium in the pre-culture medium is 0.01g/L；
Concentration of the puridoxine hydrochloride in the pre-culture medium is 0.001g/L；
Concentration of the KI in the pre-culture medium is 0.00075g/L；
The H3BO3Concentration in the pre-culture medium is 0.003g/L；
The MnSO4·4H2Concentration of the O in the pre-culture medium is 0.01g/L；
The ZnSO4·7H2Concentration of the O in the pre-culture medium is 0.002g/L；
The Na2MoO4·2H2Concentration of the O in the pre-culture medium is 0.00025g/L；
The CoCl2·6H2Concentration of the O in the pre-culture medium is 0.000025g/L；
The FeSO4·7H20 concentration in the pre-culture medium is 0.0279g/L；
The NA2EDTA·2H2Concentration of the O in the pre-culture medium is 0.0373g/L；
Concentration in pre-culture medium described in the sucrose is 30g/L；
The coagulator is agar；
Concentration of the agar in the pre-culture medium is 8g/L.
In the above method, the pH value of the pre-culture medium is 5.8.
In the above method, the time of the preculture is 5 days.
In the above method, the condition of the preculture is 25 DEG C, dark.
In the above method, the step of step (1) and step (2) also include hypertonic culture.
In the above method, the culture medium of the hypertonic culture is to mix mannitol, sorbierite and the pre-culture medium
The culture medium arrived.
In the above method,
Concentration of the mannitol in the hypertonic culture medium is 0.2mol/L；
Concentration of the sorbierite in the hypertonic culture medium is 0.2mol/L.
In the above method,
The target gene is gus gene；
The gus gene is that the mature embryo after the preculture is converted by plant expressing vector pCAMBIA1303-N.
In the above method, the embryo of the bamboo seed is the mature embryo of bamboo seed.
It is a further object to provide above-mentioned pre-culture medium.
It is a still further object of the present invention to provide above-mentioned hypertonic culture medium.
Final object of the present invention is to provide the new application of above-mentioned pre-culture medium and/or above-mentioned hypertonic culture medium.
The invention provides the application of above-mentioned pre-culture medium and/or above-mentioned hypertonic culture medium in the genetic transformation of bamboo.
In the above method or above-mentioned application, the bamboo is mao bamboon.
Beneficial effects of the present invention：At present, particle bombardment is widely used in the base of the various plants such as corn, paddy rice, wheat
Because conversion, the particularly conversion to polyploid wheat are especially prominent.It is also many because Sinobambusa is in graminaceous monocotyledonous
Times body, therefore Select gene marksmanship of the present invention carries out genetic transformation to bamboo.Compared with agrobacterium-mediated transformation, particle bombardment of the invention
It is not limited by host, target acceptor type and organization type, can carry out the conversion of polygenes and large fragment, and degree of controllability is high, operation
It is easy, quick.
The present invention is material from mao bamboon mature embryo, and the High-efficient Genetic Transformation technology of bamboo is explored using particle bombardment,
A kind of method that genetic transformation mao bamboon is mediated there is provided utilization particle bombardment.This method can solve mao bamboon and be difficult to carry out heredity turn
The problem of change, shorten the cycle for obtaining genetically modified plants, substantially increase the probability for obtaining transgenosis mao bamboon.The method of the present invention
The reference that other industrial bamboos such as particle bombardment such as cizu, D.farinosus mediates genetic transformation is can be used as, also for implementation simultaneously
Gene orderly improvement breeding research in industrial bamboo is broken through, elite germplasm new resources are formulated by particle bombardment and are explored industrial
The new way of bamboo genetic improvement is laid a good foundation.Have in terms of industrial bamboo genetic improvement and bamboo functional genomics research
Important effect and wide application prospect.
Brief description of the drawings
Fig. 1 is the instantaneous conversion efficiency that different genes rifle parameter combination bombards preculture different number of days mature embryo.
Fig. 2 is the screening survival rate that different genes rifle parameter combination bombards preculture different number of days mature embryo.
Fig. 3 is the positive rate that different genes rifle parameter combination bombards preculture different number of days mature embryo.
Fig. 4 is biolistic bombardment mao bamboon mature embryo transformation tissue culture process.A：Mao bamboon seed；B：Preculture 3d mao bamboons are ripe
Embryo；C：Preculture 5d mao bamboon mature embryos；D：Preculture 7d mao bamboon mature embryos；E：The hypertonic culture of preculture 7d mao bamboons mature embryo；F：
Mao bamboon mature embryo GUS is dyed after bombardment；G：Transformation seedlings resistance screening；H：Convert transplantation of seedlings；I：Transgenosis mao bamboon seedling；J：Conversion
Seedling Molecular Identification；Wherein, 1 swimming lane is 2000bp DNA Maker, and 2 swimming lanes are positive control, and 3 swimming lanes are negative control, 4-15
Swimming lane is transformed plant；K：Positive transgenic Leaves of Bamboo Phyllostachys pubescens GUS is dyed.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.
Quantitative test in following embodiments, is respectively provided with three repetition experiments, results averaged.
The acquisition time of mao bamboon seed in following embodiments is 07 month 2016, and acquisition modes belong to purchase.Directly come
The supplier in source is Tan Ruxue (Sole Proprietorship), and their location is Yunnan Province Kunming, contact method：Join in Yunnan Province Kunming
The building 1-103 of garden 18, postcode：650106.The picker of primary source is Tan Ruxue, and ibid, the acquisition time is contact method
05 month 2016, gain location was Yunnan Province's Zhaotong City.
A kind of method that embodiment 1, particle bombardment mediate genetic transformation mao bamboon
First, the preparation of experiment material
1st, the preparation of pCAMBIA1303-N vector plasmids
By plant expressing vector pCAMBIA1303-N (Beijing DingGuo ChangSheng Biology Technology Co., Ltd, MCV035-
N destination carrier) is denoted as, the carrier carries gus reporter gene, kanamycins and hygromycin gene.
Destination carrier is converted to escherichia coli DH5a by heat shock method.Picking Escherichia coli single bacterium colony, containing
In the LB nutrient solutions of 100mg/L kanamycins, 37 DEG C, 150rpm, incubated overnight.Carried after being verified through bacterium solution PCR using plasmid is small
Kit extracts the plasmid containing destination carrier, and concentrates or be diluted to required concentration, standby.
2nd, mao bamboon seed is disinfected
Be soaked in water mao bamboon seed (Fig. 4 A) 24h under the conditions of 25 DEG C, then on superclean bench, is soaked with 70% ethanol
30S, aseptic water washing 3 times are steeped, then (period is shaken every 2-3min with 5%-6% liquor natrii hypochloritis's immersion 10min
Swing), aseptic water washing 5 times finally soaks 10min, aseptic water washing 5 times, the hair after being sterilized with 0.1% mercuric chloride solution
Bamboo kind.
2nd, particle bombardment mediation genetic transformation mao bamboon
1st, the preculture of mao bamboon seed
Mao bamboon seed after sterilization is placed on band paper plate, mao bamboon mature embryo is hooked up out using embryo, is placed in MB6 culture mediums
On preculture is carried out under 25 DEG C, dark condition, the number of days of preculture is respectively 3 days, 5 days and 7 days, respectively obtains preculture not
With mao bamboon mature embryo (the mao bamboon mature embryo after the mao bamboon mature embryo after preculture 3 days, preculture 5 days, the preculture 7 days of number of days
Mao bamboon mature embryo afterwards).Mao bamboon mature embryo and preculture of mao bamboon mature embryo, preculture of the preculture after 3 days after 5 days are after 7 days
Mao bamboon mature embryo form respectively as shown in Fig. 4 B, 4C, 4D.
The formula of above-mentioned pre-culture medium (MB6) is as follows:MS a great number of elements solution+B5 organic element solution+B5 trace elements
Solution+MS iron salt solutions+2,4-D 2mg/L+KT 0.2mg/L+IBA 0.4mg/L+ sucrose 30g/L+ agar 8g/L, pH 5.8.
Above-mentioned MS a great number of elements solution is made up of solute and solvent, and solvent is water, solute and its end in pre-culture medium
Concentration is as follows：KNO3 1.9g/L、NH4NO3 1.65g/L、CaCl2 0.33224g/L、MgSO4·7H2O 0.37g/L、KH2PO4
0.17g/L；
Above-mentioned B5 organic elements solution is made up of solute and solvent, and solvent is water, solute and its end in pre-culture medium
Concentration is as follows：Inositol 0.1g/L, nicotinic acid 0.001g/L, nicotinic acid sulphur ammonium 0.01g/L, puridoxine hydrochloride 0.001g/L；
Above-mentioned B5 trace element solutions are made up of solute and solvent, and solvent is water, solute and its end in pre-culture medium
Concentration is as follows：KI 0.00075g/L、H3BO3 0.003g/L、MnSO4·4H2O 0.01g/L、ZnSO4·7H2O 0.002g/L、
Na2MoO4·2H2O 0.00025g/L、CoCl2·6H2O 0.000025g/L；
Above-mentioned MS iron salt solutions are made up of solute and solvent, and solvent is water, solute and its final concentration in pre-culture medium
It is as follows：FeSO4·7H20 0.0279g/L, NA2EDTA·2H2O 0.0373g/L。
2nd, the hypertonic culture of mao bamboon mature embryo
The mao bamboon mature embryo of preculture different number of days is placed on hypertonic culture medium plate center (diameter 3cm scopes) respectively
Hypertonic light culture 4h, condition of culture is 25 DEG C, dark, respectively obtains the mao bamboon mature embryo after hypertonic culture.Wherein, preculture 7
Form of the mao bamboon mature embryo after hypertonic culture after it is as shown in Figure 4 E.
The formula of above-mentioned hypertonic culture medium is：MB6 culture mediums+mannitol 0.2mol/L+ sorbierites 0.2mol/L, pH
5.8。
3rd, the biolistic bombardment of mao bamboon mature embryo
On superclean bench, the mao bamboon mature embryo after the hypertonic culture obtained respectively to step 2 using particle gun is banged
Hit.The different particle gun parameter (bronze consumption, target distance, bombarding pressure) of selection carries out biolistic bombardment (vacuum：27),
The optimal bombarding conditions of screening.The orthogonal array of particle gun parameter is shown in Table 1.The specific experiment of PDS-1000/He type particle guns
Step is as follows：
(1) micro- bullet is prepared (bronze mother liquor)
1) 80mg bronzes are weighed and add Eppendorf pipes.
2) ethanol of 1mL 75% is added, is fully vortexed, 15min, 1500rpm centrifugations 5min is stood.
3) supernatant is abandoned, 1mL sterilized waters is added, is fully vortexed, 1500rpm centrifugations 5min.It is repeated 3 times.
4) supernatant is abandoned, 50% sterile glycerine of 1mL is added, is fully vortexed, -20 DEG C of preservations.
(2) DNA parcel and biolistic bombardment operation
1) 50 μ L bronzes suspensions (referring to bronze mother liquor) are taken to be managed in Eppendorf.
2) 5 μ L DNAs (1 μ g/ μ L), 50 μ L 2.5M CaCl are sequentially added2With 20 μ L 0.1M spermidines.(side is vortexed
Side is added, and is often added equally, can be vibrated 2-3 seconds).
3) by above-mentioned mixed sample, vortex 1min stands 1min, is repeated 10 times on ice.
4) 30min is stood on ice.10000rpm centrifuges 10sec, removes supernatant.
5) precipitation is rinsed 2 times (10000rpm centrifuges 10sec, removes supernatant) with 250 μ L absolute ethyl alcohols.
6) finally with 60 μ L absolute ethyl alcohol resuspended particles.
7) on super-clean bench, 75% alcohol swab cleans bombardment room, and then each accessory 15min of 75% ethanol disinfection dries.
8) the coated gold grain points of 10 μ L DNA are taken (to be drop by drop added dropwise in particle bullet carrier center membrane, treat the first drop
After drying, it is added dropwise second and drips, prevent that bronze particles diffusion is too big).
9) power switch of vavuum pump and particle gun is opened.
10) helium bottle valve is opened, helium adjusting rod is rotated, it is 1500psi or so higher than the selected mould that can split to make air pressure.
11) film door can be split by screwing off, and can be split film and be placed on door center (to put just, prevent gas leakage), door is screwed on, use
Special spanner is reinforced.
12) corpuscular emission device is removed bombardment room, screws off lid, added and stop net, particulate slide glass is arranged on and fixed
In groove (fine-grained one is face-down), lid is screwed on, corpuscular emission device is put back into bombardment room.
13) sample disc is placed on to the appropriate location of bombardment room, bombardment room door is shut.
14) sample disc is placed on to the appropriate location of bombardment room, bombardment room door is shut.
15) corpuscular emission device is taken out, particulate film carrier is unloaded and stops that net (stops that net and particulate slide glass fixing groove are put into
Soaked in 70% alcohol).
16) film door can be split by screwing off, and removing can split film fragment.
17) if PDS-1000/He is not used, turn off the main valve of helium tank, pin FIRE switches, bleed off gas acceleration
Helium pressure in pipe, finally turns off all power supplys.
The particle gun parameter orthogonal test table of table 1
After biolistic bombardment, on superclean bench, the mao bamboon mature embryo after biolistic bombardment is continued in 25 DEG C, dark bar
Hypertonic light culture 16h is carried out under part.
4th, renewal cultivation
After hypertonic light culture, on superclean bench, mao bamboon mature embryo is gone on MB6 culture mediums in 25 DEG C, dark condition
Lower recovery light culture 7d, obtains the mao bamboon mature embryo bombarded after renewal cultivation.And the mao bamboon after 3d takes part to bombard is ripe
Embryo is placed in sterile EP pipes, adds GUS dye liquors (50mM phosphate buffers, 0.1% more than 3 times of volumes of mao bamboon mature embryo
Triton X-100,2mM iron potassium oxides, 2mM ferrous oxidation potassium, 10mM EDTA, 2mM X-Gluc), it is subsequently placed in 37 DEG C of constant temperature
Incubator is carried out after dark reaction, reaction 48-72h, checks mao bamboon mature embryo of the dyeing in blueness, and calculate instantaneous conversion efficiency.
Instantaneous conversion efficiency=in blue mao bamboon embryo number/dyeing total number.
As a result show：Different genes rifle parameter combination bombards the instantaneous conversion efficiencies of preculture different number of days mature embryo
As shown in Figure 1.As shown in Figure 1, with the increasing of bronze amount, the increase of instantaneous conversion efficiency；Embryo of the preculture after 5 days is more suitable
Genetic transformation material.When biolistic bombardment parameter is following numerical value：Bronze amount：160ug；Target distance：6cm；Bombarding pressure：
1350psi (particle gun parameter combination 6), instantaneous conversion efficiency highest (Fig. 1).
5th, screening and culturing
After renewal cultivation, the mao bamboon mature embryo bombarded after renewal cultivation is gone into 1/2MS screening and culturing mediums, and (1/2MS is cultivated
Base+hygromycin 5mg/L+ sucrose 30g/L+ agar 8g/L, pH 5.8) on sprout long root, condition of culture is 25 DEG C, round the clock the time be
14/8h, cultivates 30d, obtains transgenosis mao bamboon seedling (Fig. 4 I).And it is different to count different genes rifle parameter combination bombardment preculture
The screening survival rate of the mao bamboon mature embryo of number of days.Screen survival rate=seedling number/total embryo number.
Screening survival rate such as Fig. 2 institutes of the mao bamboon mature embryo of different genes rifle parameter combination bombardment preculture different number of days
Show.As can be seen from Figure 2：160ug bronzes amount bombards mao bamboon mature embryo, mao bamboon screening survival rate highest, 240ug bronzes amount time
It, 80ug bronze amounts are minimum.
6th, the PCR detections of transfer-gen plant
Using hygromycin gene special primer HYG-F (GCAGCCACTGGTAACAGGAT) and HYG-R
(ACTGTCGGGCGTACACAAAT) the transgenosis mao bamboon seedling to above-mentioned acquisition enters performing PCR detection, and PCR amplifications obtain size and are
2000bp transgenosis mao bamboon seedling is the positive transgenic mao bamboon that foreign gene is successfully incorporated into genomic DNA, and is counted
The positive rate of the mao bamboon mature embryo of different genes rifle parameter combination bombardment preculture different number of days.PCR, detection are repeated through multiple batches of
The positive transgenic mao bamboon of 2000bp target stripe can be amplified to nearly 100 plants.The Ago-Gel of part pcr amplification product
Electrophoresis result is as shown in fig. 4j.
Different genes rifle parameter combination bombardment preculture different number of days mao bamboon mature embryo positive rate as shown in figure 3, from
It can be seen from the figure that：The positive rate highest of mao bamboon mature embryo of the preculture after 5 days, especially particle gun parameter combination are bronze amount
160ug/ rifles, target distance 6cm, during bombarding pressure 1350psi, positive rate is higher, reaches as high as 10%.
According to above-mentioned instantaneous conversion efficiency, screening survival rate and transfer-gen plant positive rate, final biolistic bombardment parameter
Optimum combination it is as follows：Bronze amount：160ug；Target distance：6cm；Bombarding pressure：1350psi.
7th, the GUS detections of transgenosis mao bamboon
The root culture medium for the positive transgenic mao bamboon that above-mentioned steps 6 are obtained is cleaned, nutritive cube (peat soil is moved into：Quartz
Sand：Soil=2:1:1) cultivated in, using artificial water spray retaining ring border humidity, condition of culture is：25 DEG C of daytime temperature, night temperature 18
DEG C, light application time 14h/d.After domestication hardening 20-30 days, it is transplanted into equipped with garden is native, (schemes in a diameter of 30cm flowerpot
4H)。
GUS tissue chemical analysis are carried out to the blade of positive transgenic mao bamboon.Comprise the following steps that：Taken out in tissue culture bottle
Mao bamboon partial blade, adds the GUS dye liquors more than 3 times of volumes of blade, is placed in 37 DEG C of constant incubators and carries out dark reaction, reaction
After 48-72h, decolorization is carried out in 100%, 75%, 50% graded ethanol, after the completion of decolouring, under inverted microscope, is seen
Examine the expression of Reporter gene GUS.
By the GUS detection and analysis to positive transgenic Leaves of Bamboo Phyllostachys pubescens, find to express on positive transgenic Leaves of Bamboo Phyllostachys pubescens
Reporter gene GUS, illustrates that pCAMBIA1303-N carriers are successfully incorporated into mao bamboon genome and translate and expressed (such as
Fig. 4 K).
Comparative example, agriculture bacillus mediated mao bamboon genetic transforming method
According to document " method of generating large-scale sympodial bamboos through Agrobacterium mediation ", (patent authorization number is
ZL20101023093.X, the license time be 2012-06-13) in method, use Agrobacterium by acceptor material of mao bamboon
Mediated method carries out genetic transformation, breeds by callus induction, preculture, Agrobacterium are infected and co-cultured, kanamycin-resistant callus tissue group
The step of knitting screening, the mao bamboon callus and regrowth of the positive are not obtained on screening and culturing medium.Therefore, document " Agrobacterium
During agrobcterium-mediated transformation in the method that mediated method produces large-scale sympodial bamboo class ", including conversion respectively
Special culture media is not appropriate for the genetic transformation of mao bamboon.
Claims (10)
1. a kind of method of the genetic transformation of bamboo, comprises the following steps：
(1) embryo of bamboo seed is subjected to preculture in pre-culture medium, obtains the mature embryo after preculture；
(2) target gene is converted into the mature embryo after the preculture using particle bombardment, cultivates, obtain transgenosis bamboo.
2. according to the method described in claim 1, it is characterised in that：
The bombardment parameters of the particle bombardment are as follows：Bronze amount：80-240ug；Target distance：6-12cm；Bombarding pressure：1100-
1550psi；Vacuum：27.
3. method according to claim 2, it is characterised in that：
The bombardment parameters of the particle bombardment are as follows：Bronze amount：160ug；Target distance：6cm；Bombarding pressure：1350psi；Very
Reciprocal of duty cycle：27.
4. according to any described method in claim 1-3, it is characterised in that：
The pre-culture medium be by MS a great number of elements solution, B5 organic elements solution, B5 trace element solutions, MS iron salt solutions,
The culture medium that 2,4-D, KT, IBA, sucrose and coagulator are uniformly mixed so as to obtain；
Or, the MS a great number of elements solution includes KNO3、NH4NO3、CaCL2、MgSO4·7H2O and KH2PO4；
Or, the B5 organic elements solution includes inositol, nicotinic acid, nicotinic acid sulphur ammonium and puridoxine hydrochloride；
Or, the B5 trace element solutions include KI, H3BO3、MnSO4·4H2O、ZnSO4·7H2O、Na2MoO4·2H2O and
CoCl2·6H2O；
Or, the MS iron salt solutions include FeSO4·7H20 and NA2EDTA·2H2O。
5. method according to claim 4, it is characterised in that：
Concentration of the 2,4-D in the pre-culture medium is 2mg/L；
Concentration of the KT in the pre-culture medium is 0.2mg/L；
Concentration of the IBA in the pre-culture medium is 0.4mg/L；
The KNO3Concentration in the pre-culture medium is 1.9g/L；
The NH4NO3Concentration in the pre-culture medium is 1.65g/L；
The CaCl2Concentration in the pre-culture medium is 0.33224g/L；
The MgSO4·7H2Concentration of the O in the pre-culture medium is 0.37g/L；
The KH2PO4Concentration in the pre-culture medium is 0.17g/L；
Concentration of the inositol in the pre-culture medium is 0.1g/L；
Concentration of the nicotinic acid in the pre-culture medium is 0.001g/L；
Concentration of the nicotinic acid sulphur ammonium in the pre-culture medium is 0.01g/L；
Concentration of the puridoxine hydrochloride in the pre-culture medium is 0.001g/L；
Concentration of the KI in the pre-culture medium is 0.00075g/L；
The H3BO3Concentration in the pre-culture medium is 0.003g/L；
The MnSO4·4H2Concentration of the O in the pre-culture medium is 0.01g/L；
The ZnSO4·7H2Concentration of the O in the pre-culture medium is 0.002g/L；
The Na2MoO4·2H2Concentration of the O in the pre-culture medium is 0.00025g/L；
The CoCl2·6H2Concentration of the O in the pre-culture medium is 0.000025g/L；
The FeSO4·7H20 concentration in the pre-culture medium is 0.0279g/L；
The NA2EDTA·2H2Concentration of the O in the pre-culture medium is 0.0373g/L；
Concentration in pre-culture medium described in the sucrose is 30g/L；
The coagulator is agar；Concentration of the agar in the pre-culture medium is 8g/L.
6. method according to claim 5, it is characterised in that：
The pH value of the pre-culture medium is 5.8；
Or, the time of the preculture is 5 days；
It is dark or, the condition of the preculture is 25 DEG C；
Or, the step (1) and step (2) also include hypertonic culture the step of；
Or, the culture medium of the hypertonic culture is the culture medium for being uniformly mixed so as to obtain mannitol, sorbierite and the pre-culture medium；
Or, concentration of the mannitol in the hypertonic culture medium is 0.2mol/L；
Or, concentration of the sorbierite in the hypertonic culture medium is 0.2mol/L.
7. any described pre-culture medium in claim 1-6.
8. any described hypertonic culture medium in claim 1-6.
9. the hypertonic culture medium described in pre-culture medium and/or claim 8 described in claim 7 is in the genetic transformation of bamboo
Application.
10. according to any described method in claim 1-6 or the application described in claim 9, it is characterised in that：The bamboo
Son is mao bamboon.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710205876.3A CN106967750A (en) | 2017-03-31 | 2017-03-31 | A kind of method that utilization particle bombardment mediates genetic transformation mao bamboon |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710205876.3A CN106967750A (en) | 2017-03-31 | 2017-03-31 | A kind of method that utilization particle bombardment mediates genetic transformation mao bamboon |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106967750A true CN106967750A (en) | 2017-07-21 |
Family
ID=59336653
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710205876.3A Pending CN106967750A (en) | 2017-03-31 | 2017-03-31 | A kind of method that utilization particle bombardment mediates genetic transformation mao bamboon |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106967750A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108660151A (en) * | 2018-05-25 | 2018-10-16 | 中国林业科学研究院亚热带林业研究所 | A kind of method of moso bamboo genetic transformation |
| CN111778258A (en) * | 2020-01-18 | 2020-10-16 | 西南科技大学 | MYB140 gene, constructed vector and expressed transgenic tobacco plant |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1712537A (en) * | 2004-06-24 | 2005-12-28 | 华中农业大学 | Culture of indica rice tran-gene tree from agrobacterium medium |
| CN101849504A (en) * | 2009-11-27 | 2010-10-06 | 胡尚连 | Large-scale sympodial bamboo callus induction and plant regeneration high efficiency culture medium and culture method thereof |
| CN101906434A (en) * | 2010-07-19 | 2010-12-08 | 胡尚连 | Method for generating large-scale sympodial bamboos through Agrobacterium mediation |
| CN105028212A (en) * | 2015-08-28 | 2015-11-11 | 浙江农林大学 | Establishment method of efficient regeneration system of mniochloa abersend |
-
2017
- 2017-03-31 CN CN201710205876.3A patent/CN106967750A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1712537A (en) * | 2004-06-24 | 2005-12-28 | 华中农业大学 | Culture of indica rice tran-gene tree from agrobacterium medium |
| CN101849504A (en) * | 2009-11-27 | 2010-10-06 | 胡尚连 | Large-scale sympodial bamboo callus induction and plant regeneration high efficiency culture medium and culture method thereof |
| CN101906434A (en) * | 2010-07-19 | 2010-12-08 | 胡尚连 | Method for generating large-scale sympodial bamboos through Agrobacterium mediation |
| CN105028212A (en) * | 2015-08-28 | 2015-11-11 | 浙江农林大学 | Establishment method of efficient regeneration system of mniochloa abersend |
Non-Patent Citations (4)
| Title |
|---|
| SHINJIRO OGITA ET AL.: "A practical protocol for particle bombardment-mediated transformation of Phyllostachys bamboo suspension cells", 《PLANT BIOTECHNOLOGY》 * |
| 张蕾等: "《植物发育生物学实验指导》", 31 October 2010, 武汉大学出版社 * |
| 朱宝成等: "《植物细胞与基因工程研究》", 31 January 2003, 中国科学技术出版社 * |
| 玉云祎等: "转基因技术在观赏植物育种中的应用", 《北京林业大学学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108660151A (en) * | 2018-05-25 | 2018-10-16 | 中国林业科学研究院亚热带林业研究所 | A kind of method of moso bamboo genetic transformation |
| CN111778258A (en) * | 2020-01-18 | 2020-10-16 | 西南科技大学 | MYB140 gene, constructed vector and expressed transgenic tobacco plant |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2881392T3 (en) | Methods and compositions for rapid plant transformation | |
| Raji et al. | Agrobacterium-and biolistic-mediated transformation of maize B104 inbred | |
| Zhang et al. | A simple and efficient in planta transformation method for pommelo (Citrus maxima) using Agrobacterium tumefaciens | |
| CN106119281A (en) | A kind of agriculture bacillus mediated Semen Tritici aestivi stem apex genetic transforming method rapidly and efficiently | |
| CN110078807A (en) | Promote the protein and its encoding gene of potassium ion efficient absorption | |
| CN108300735A (en) | A kind of Lilium tenuifolium efficient genetic trasformation system based on somatic embryo occur | |
| CN101984065B (en) | Agrobacterium rhizogenes mediated spraying decoration transgenosis method and application | |
| CN108977445A (en) | Application of the arabidopsis microRNA400 in regulation cadmium-resistant vegetable | |
| CN106967750A (en) | A kind of method that utilization particle bombardment mediates genetic transformation mao bamboon | |
| CN101831459B (en) | Method for acquiring transgene cotton | |
| CN104450779A (en) | Fast and efficient agrobacterium-mediated rice stem tip genetic transformation method | |
| CN103320377B (en) | Culture medium for cultivating transgenic plant | |
| CN109468333A (en) | Citrus laccase family gene CsiLAC4 and its application | |
| CN102559748B (en) | Simple and convenient agrobacterium tumefaciens-mediated sugarcane transgene method | |
| Frame et al. | Maize (Zea mays L.) | |
| Begum et al. | Genetic transformation of the EPSPS herbicide resistance gene in Agrobacterium mediated peanut (Arachis hypogaea L.) and effective revival of transgenic plants. | |
| CN105802931A (en) | CRK4 protein and application of coded gene thereof in regulating and controlling growth of plant stems and leaves | |
| CN104726488A (en) | Method for culturing stress-resistance herbicide-resistance transgenic aerobic rice | |
| CN108165572A (en) | A kind of agriculture bacillus mediated needle thorn growing point transformed wheat method | |
| CN103589750A (en) | Method for deleting transgenic rice marker genes on plant level | |
| CN107058382A (en) | The preparation method of transgenosis coniferous tree plant | |
| CN104017823B (en) | Screening method for fast and effectively reducing false positive rate of peanut genetic transformation plant | |
| WO2013010368A1 (en) | Use of rice aerenchyma formation key gene oslsd2 | |
| CN103421812B (en) | Method for cultivating high-temperature-resistant arabidopsis through gene KcNHX1 of karelinia caspia | |
| CN108753816A (en) | The transgenic arabidopsis strain and its construction method of SYTA gene overexpressions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170721 |
|
| RJ01 | Rejection of invention patent application after publication |