CN101984065B - Agrobacterium rhizogenes mediated spraying decoration transgenosis method and application - Google Patents
Agrobacterium rhizogenes mediated spraying decoration transgenosis method and application Download PDFInfo
- Publication number
- CN101984065B CN101984065B CN2010102684479A CN201010268447A CN101984065B CN 101984065 B CN101984065 B CN 101984065B CN 2010102684479 A CN2010102684479 A CN 2010102684479A CN 201010268447 A CN201010268447 A CN 201010268447A CN 101984065 B CN101984065 B CN 101984065B
- Authority
- CN
- China
- Prior art keywords
- cotton
- plant
- agrobacterium
- transformation
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to an agrobacterium rhizogenes mediated spraying decoration transgenosis method. In the method, a process that the agrobacterium rhizogenes suspension is directly sprayed on the stamen before pollen-shedding stage and the stamen in the pollen-shedding stage under the condition of living body in the field environment is adopted, thus having simpler operation and avoiding the damage to the organ of flower at the same time. Calculated as the number of the transgenosis plant/transforming flower, the transformation efficiency in the cotton can be 10%. The method of the invention has great practical application value in the plant genetic transformation and molecular breeding. The transforming material used in the invention can be Malvaceae cotton, or monocotyledonous and dicotyledoneae seedling plants such as rice, corn, wheat, soybean, rapeseed plant, cucumber, tomato, tobacco, fruit trees, forest, flowers and officinal plants and the like, and has a certain application value in the genetic transformation and molecular breeding of the monocotyledonous and dicotyledoneae seedling plants.
Description
Technical field
The present invention relates to the cotton gene engineering, relate in particular to a kind of transgenic method of the method converting cotton through agriculture bacillus mediated spraying decoration.
Background technology
Plant genetic engineering is to use recombinant DNA technology, and foreign gene is imported in the recipient plant cell, makes recipient plant obtain new inherited character.The eighties in 20th century, to obtain on the basis of a series of major progresses at cell and tissue culture, molecular biology research field, plant genetic engineering is to having obtained swift and violent development.Cotton is the important cash crop of China, and the agricultural and the development of cotton spinning industry are had very important effect, but traditional breeding method is limited between kind more or the karyomit(e) between planting is recombinated, and has significant limitation.Therefore utilize genetic engineering technique to cultivate new cotton variety and have crucial meaning.The Cotton in China biotechnology research originates in the seventies in 20th century; Flourish along with plant transgene research in recent years, transgenic technology update and perfect, transgenic technology has been applied in the practice of bt-cotton, antiweed, disease-resistant, the improvement breeding that improves the yield and quality; And pest-resistant, antiweed, transgenic new variety (being) such as disease-resistant have been obtained; Some has got into commercialization production, has obtained remarkable economic efficiency and social benefit, and particularly scientist such as the Guo of the Chinese Academy of Agricultural Sciences three heaps big area of cultivating successful transgenic cotton against pests is promoted; Greatly promoted the development of Cotton in China industry; Output of cotton is significantly improved, has also reduced Utilization of pesticides in a large number, demonstrated fully genetically modified crops important economy and society in agriculture prodn and be worth.Therefore; Abundant utilization transgenic technology on high yield, fine cotton variety, further imports disease-resistant worm, antiweed, salt tolerant alkali, gene such as drought-resistant; Obtain the good transgene cotton germplasm novel material of resistance, the transgene cotton new variety are had important practical significance.The transgenic technology that is applied to cotton mainly contains agriculture bacillus mediated foreign gene introduction method and direct pollen tube passage method, the particle bombardment that imports of foreign gene, and these 3 kinds of methods also are that most widely used plant genetic transforms means.
Since Umbeck in 1987 and Firoozababy etc. obtained the transgenic plant of first expression alien gene through Agrobacterium tumefaciens mediated conversion, this method had obtained rapid application in the cotton genetic transformation.Current through the acquired nearly 200 kinds of transgenic plant of various transgenic technologys, wherein utilize conversion method for agrobacterium tumefaciens to obtain more than 80%.This method is good with the low copy of transgenic, genetic stability, can transform extremely people's attention of big segmental DNA, transformation efficiency advantages of higher, is that present transformation mechanism research is the clearest, most widely used method.What the genetic transformation of cotton adopted is agrobacterium tumefaciens, for the soil happiness occupies bacterium, and gramstaining be negative (Li Junlan, 2002).(1) has intermediate carrier or binary vector with the goal gene importing to utilize the process of Agrobacterium foreign gene transfer generally to be.Intermediate carrier or the binary vector that (2) will have a goal gene import Agrobacterium.(3) make agroinfection host (acceptor) vegetable cell or tissue.(4) screening transformant and induce its regeneration plant.(5) transfer-gen plant is carried out Molecular Detection.The agriculture bacillus mediated explant that transgenosis was suitable for is very extensive, comprises blade, stem section, plumular axis, petiole, cotyledon, rataria or mature seed.What on cotton, use always is hypocotyl.
(1999) such as Guo's three heaps adopt agrobacterium-mediated transformation that the Bt gene is imported in the main breeds such as cotton No. 3 of middle cotton institute 12, nasal mucus, have obtained the transgenic cotton plant of high resistance helicoverpa armigera.Meng Zhao red (2001) etc. change in the cotton cells through the Ti-plasmids that agrobacterium-mediated transformation will contain gus gene, NPT gene, Bt gene, and the result shows that gus gene can be given progeny cell by genetic stability in transformed calli cell mitogen breeding.The precious equality of Lee (2001) utilizes agrobacterium-mediated transformation that Bt gene fusion tfdA gene is imported cotton, obtains regeneration plant; Jiao Gaili etc. (2002) cut off with the 10mm lateral root of cotton No. 7 of new land kind Cok-er312 and Shanxi and the aseptic seedling of growing 8~12 days is the transformation receptor material, have successfully obtained the transgenic cotton plant.Li Xiao etc. (2002) transform the male sterile recovery system of brown cotton " G007 ", and there is not the chimerism between conversion and non-transformed cell in the transformant of generation.
Agrobacterium-mediated transformation is compared with other transgenic method, and it is clear to have a transformation mechanism, and transformation efficiency is high; Method is ripe, and is simple and easy to do, metastatic gene clear and definite (sequence between the border, the T-DNA left and right sides); Can transform big segmental DNA, the foreign gene of conversion is incorporated in the Plant Genome with single or low copy, and genetic stability is good; Meet characteristics such as Mendelism, become crop gene transformation methods commonly used such as cotton.
But the factor that influences agrobacterium-mediated transformation is more, mainly contains whether explant type and physiological status, explant are cultivated in advance, Vir gene activation situation, pH value, temperature, osmotic pressure, inositol concentration and some carbohydrates.The agriculture bacillus mediated genetic transforming method of cotton; Because the transgenic seedling cycle that its transformation receptor material strictness receives genotypic restriction, obtain through the regeneration approach is long, obtain transgenic seedling because its dedifferentiation and again differentiation cause somatic variation and factors such as mutation rate height, restricted agriculture bacillus mediated genetic transforming method in the cotton gene application in engineering.
Pollen tube channel approach (pollen tube pathway) is that people (1978) such as period-luminosity space proposes the transgenic technology that foreign DNA after the self-pollination of design after the dna fragmentation hybridization theory imports plant.Cotton ovule is before pollination; Megarchidium is the system of a sealing; The pollination back is stretched into pollen tube, and some nucellar cells from the hole of bead to the blastular degenerate and form a passage, is beneficial to pollen tube and gets into blastular; Foreign DNA can get into blastular through pollen tube channel, participates in the seed of new formation thereby transform the ovum, zygote or the body early embryo cell that still do not possess the normal cell wall.Because these cells do not possess normal cell walls, can be used as natural protoplastis, be easy to DNA and transform, the after fertilization cell DNA duplicates active, is easy to the integration of foreign DNA.With isotopic tracer technique confirmed foreign DNA through pollen tube channel rather than through pollen tube get into blastular (Gong is luxuriant, 1988; Huang Guocun, 1998).Huang Junqi etc. (1981) use pollen tube passage method and successfully disease-resistant gene are imported in high yield, high-quality, the susceptible cotton variety, obtain cotton 3118 new variety of anti-verticillium, anti-blight.Ni Wanchao etc. (1998) import nasal mucus cotton No. 3 through pollen tube passage method with the Bt gene, have selected first transgenic cotton against pests GK1 through authorization of China.
Pollen tube passage method is applied to the cotton gene engineering; Not only broken the genotype restriction of transformation receptor material; Need not large-scale instrument and equipment; And whole conversion process is implemented big Tanaka, to conversion condition require fairly simple, to cultivate cycle of new variety by transgenic line short, can directly obtain normal seed, therefore obtained using widely in the cotton genetic transformation at home.But it is big to the ovary physical abuse that this method transforms the back, the seed rate lower (single cotton boll can be received 10 following seeds) that gets of single cotton boll; Transformation efficiency is lower, and (flower according to transforming is figured; Its transformation efficiency about 0.03%~0.1%), workload is big, and the carrier framework structure that transforms usefulness also is integrated in the cotton gene group; Foreign DNA is generally multiple copied in the transgenic line that obtains, and offspring's speed of isozygotying is slower.
Particle bombardment (particle gun) claim particle bombardment method (Microprojectile bombardment again; Particlebombardment; Biolistics).Be to rely on a kind of transformation technology that high-speed metal particle is introduced foreign gene viable cell.Its ultimate principle is to quicken to have metallic particles, goldc grains or the tungsten particle of gene as power through gunpowder explosion effluve or high pressure gas, and makes it get into the band parietal cell.Plasmid at first is deposited in little bullet (goldc grains or tungsten particle) surface in this process; The little bullet that is combined with dna molecular obtains enough momentum through acceleration; And then penetrate plant cell wall entering target cell, disengage subsequently in dna molecular and the genome that is incorporated into the host at random.Finer and Mullen (1990) are that transformation receptor imports to GUS and NPT II gene in the cotton with particle bombardment at first with the cotton embryonal suspension cell, have successfully obtained transgene cotton; Wu Jingyin etc. (1994) applying gene rifle blast technique imports to the cotton shoot apical meristem with the recombinant plasmid of CPTI gene and NPT II gene, cultivates to obtain the kalamycin resistance plant; Liu Chuanliang etc. (2003) adopt the particle gun leading-in technique that external source is imported the stem apex or the shoot apical meristem of acceptor cotton variety, successfully breed transgenic cotton flower variety (being).
Particle bombardment is owing to introduce whole plasmid expression vector in the cell through metallic particles, and the transgenic line foreign DNA of acquisition is generally multiple copied, and expression vector skeleton structure sequence also is integrated in the genome; This method also needs acceptor material to pass through tissue culture procedures to obtain regrowth, cause the strictness of transformation receptor material to receive genotypic restriction, transgenic seedling cycle of obtaining through the regeneration approach is long, obtain transgenic seedling because its dedifferentiation and again differentiation cause somatic variation and mutation rate is high; The metallic particles that transforms usefulness is relatively more expensive, and technical costs is higher.Therefore this method is used less in the cotton genetic transformation.
It is a kind of plant in-situ transesterification genetic method that floral organ soak to transform, promptly a kind of need not organizing or cell cultures means and reach plant at live body but not the genetic transforming method under the state of exsomatizing.This method is to utilize the acceptor material inflorescence to contact with Agrobacterium, under condition of living body, accomplishes cytogenetics and transforms, and screen the acquisition transfer-gen plant through the offspring.This method is simple to operate, directly operation under the envrionment conditions of land for growing field crops, possessed whole advantages of agriculture bacillus mediated genetic transforming method through regeneration approach acquisition transgenic seedling; Reported since successfully being used for the Arabidopis thaliana genetic transformation through flower-dipping method under the laboratory condition from author in 1998; This method has obtained widespread use, but in the cotton genetic transformation, does not appear in the newspapers.
Summary of the invention
To above prior art condition, the present invention provides a kind of method of improved spraying decoration method converting cotton.This method is with reference to the Arabidopis thaliana method for transformation, and characteristics such as, male and female color big according to the cotton floral organ, the back pollination of blooming are optimized with Agrobacterium diluent prescription, transformation time, method for transformation aspect the conversion of spraying decoration method.Adopt under the envrionment conditions of land for growing field crops on the method for transformation Agrobacterium suspension is directly sparged on the cotton pistil, easier than the operation of floral organ immersion method for transformation, and the unexpected injury of having avoided the dip operation process that plant is caused.
The agriculture bacillus mediated spraying decoration method of cotton provided by the invention genetic transforming method is specific as follows:
The Agrobacterium that 1) will contain goal gene is diluted to 0.3~0.5OD with suspension-s, and described suspension-s contains sucrose and SilwetL-77.
2) under condition of living body, transform: utilize miniature watering can big Tanaka, agrobacterium suspension is sparged on the flower before the cotton loose powder or on gynoecium and the column cap, utilize Agrobacterium that goal gene is integrated in the cotton gene group.Collect cotton seeds after the cotton boll maturation to be transformed, be seeded in the land for growing field crops, utilize the selection markers genescreen can obtain transfer-gen plant.
Agrobacterium suspension among the present invention contains the SilwetL-77 that 5~10% sucrose or 5~10% sucrose add 20~50 μ L/L, and wherein the factor of most critical is a sucrose, and the viscosity of sugar can make the abundant cotton floral organ of Agrobacterium histocyte combine.Adding SilwetL-77 can increase the permeability of cotton floral organ cytolemma, and Agrobacterium is combined with cotton floral organ histocyte.
The present invention adopts directly agrobacterium suspension is sparged the method on the cotton flower, spends about spraying 400~600 μ L suspension-s for every.Agrobacterium suspension through atomizing is covered on the floral organs such as column cap and flower pesticide uniformly, has guaranteed that Agrobacterium fully contacts with the floral organ tissue, can not influence pollination owing to humidity is excessive simultaneously.
The above-mentioned acquisition that contains the Agrobacterium of goal gene is with the plasmid plant expression vector that contains goal gene, transforms through electric shock or thermal shock to import in the agrobatcerium cell.Used plant expression vector includes but not limited to pBin serial carrier (like pBin19 etc.), pBI serial carrier (like pBI121 etc.), Gateway serial carrier (like pH2GW7 etc.), pCAMBIA serial carrier (like pCAMBIA1302 etc.); Used Agrobacterium includes but not limited to: LBA4404, EHA105 etc.
The present invention utilizes improved spraying decoration method method for transformation, has successfully obtained transgenic cotton plant.This method for transformation is simple, conditional request is extensive, the transformation period is short, workload is little, ovary is had no mechanical damage; Single cotton boll must plant rate height (seed of single cotton boll can both be gathered in the crops basically), transformation efficiency high (calculate transformation efficiency according to the flower that is transformed and reach 1%~4%, reached 0.2~0.3% according to transforming the T0 that obtains for seed calculation transformation efficiency) after transforming.This method transformation mechanism is clear, has broken the genotype restriction of acceptor material, can directly transform the cotton breeding material, has bigger practical value.
Description of drawings
Fig. 1 is plasmid pGBIF4ABC-EPSPS among the embodiment.
Fig. 2 is that PCR detects the electrophoresis result of T1 for transfer-gen plant Bt gene among the embodiment.
Fig. 3 is that PCR detects the electrophoresis result of T1 for transfer-gen plant EPSPS gene among the embodiment.
Embodiment
Below in conjunction with accompanying drawing, through instance the present invention is further specified, but the scope that does not limit the present invention in any way.
Embodiment: agriculture bacillus mediated spraying decoration method transforms and obtains transgenic cotton plant
One, materials and methods
1) cotton material: cotton material is selected free kind Y18R for use.
2) bacterial classification: Agrobacterium LBA4404.
3) carrier: pGBIF4ABC-EPSPS (Fig. 1).The plant expression vector that this laboratory makes up contains two independently expression cassettes, and promotor is 35S Promoter, and terminator is Nos.First expression cassette encoding sox is glyphosate resistance gene EPSPS, and second expression cassette encoding sox is Bt gene and Cpti gene Fusion gene.
4) toolenzyme and modifying enzyme: various restriction enzymes and modifying enzyme are available from TaKaRa company, NEB company and Fermentas company.
5) chemical reagent: pharmaceutical chemicals is domestic and international analytical pure.
6) primer is synthetic: synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
Two, agriculture bacillus mediated spraying decoration method transforms and obtains transgenic cotton plant
1. the preparation of cultivation of Agrobacterium and transformed bacteria liquid
Picking contains Agrobacterium mono-clonal of plasmid pGBIF4ABC-EPSPS, is inoculated in 50mL YEB (containing kantlex 50mg/L, the Streptomycin sulphate 50mg/L) liquid nutrient medium 28 ℃ of 250rpm incubated overnight.Draw incubated overnight bacterium liquid 2mL and be inoculated in 200mL YEB (containing kantlex 50mg/L, the Streptomycin sulphate 50mg/L) liquid nutrient medium (placing the 1L triangular flask), 28 ℃ of 250rpm incubated overnight are until OD
600=0.8~1.Cultured bacterium liquid at the centrifugal 15min of 4500rpm, is abandoned supernatant, collecting precipitation, resuspended with diluent (containing the sterile water solution that 5~10% sucrose or 5~10% sucrose add SilwetL-77) to OD
600=0.4~0.5, be used for Plant Transformation.
2. plant is selected to prepare and transformation time
Choose open-air growth and be in full-bloom stage, the plant of robust growth is as transformant.Do selfing (acceptor material of planting in isolated area can not done selfing) to second day flower in full bloom with the selfing clip first day afternoon, and 5 o'clock to the 10 o'clock morning on the secondth, (extremely firm loose powder before the loose powder) transformed then.
3. Agrobacterium bacterium liquid infects the cotton flower
Adopted the Agrobacterium of two kinds of diluents (containing the sterile water solution that 5~10% sucrose or 5~10% sucrose add SilwetL-77) dilutions; Utilizing miniature watering can to sparge the cotton flower transforms; Every spray once is approximately 200 μ L suspension-s, 2~3 times (about 400~600 μ L suspension-s) of every flower spray.Flower to transforming is isolated (acceptor material of planting in isolated area can not done isolation), the mark of listing then with the selfing clip.
4.T0 for seed results and T1 for screening
Behind the seed maturity T0 is mixed receipts for seed, be seeded in the land for growing field crops, use kantlex and herbicide screening resistant plant.Kantlex screening three times is a cotyledon period for the first time, is applied on the cotyledon with the kantlex solution of writing brush with 1mg/mL, and whether spottiness occurs the inspection cotyledon after 3~4 days, and immaculate plant is transgenic candidate plant.Programmed screening is 2~4 true leaf periods, and the true leaf of the candidate plant that screening is for the first time obtained is smeared the kantlex solution of 1mg/mL, and the plant that immaculate occurs is transgenic candidate plant.Screen for the third time 5~6 true leaf periods, the true leaf of the candidate plant that programmed screening is obtained is smeared the kantlex solution of 1mg/mL, and the plant that immaculate occurs is transgenic candidate plant.The transgenic candidate plant that at last three screenings is obtained is screened with glyphosate herbicidal, and what do not have death is T1 for the transgenic positive plant.
5.T1 detect for transgenic positive plant PCR
To the plant of performance kantlex and glyphosate resistance, PCR detects Bt gene and EPSPS gene, and the genome process for extracting adopts improved method of CTAB.The design primer sequence is following:
The Bt gene primer
Bt-Fp (forward primer) GCCATACAACTGCTTGAGTAACCCAG
Bt-Rp (reverse primer) GTTGCAGTAACTGGAATGAACTCG
The EPSPS gene primer
EPSPS-Fp (forward primer) GCGAAATGGGCGTGCAGGTGAAATC
EPSPS-Fp (reverse primer) GGCGGCGACAGCGAGAATCGG
Utilizing Bt gene primer and EPSPS gene primer is dna profiling with resistant transgenic plant genome, amplification Bt gene and EPSPS gene, and amplification system is:
Template 1 μ l (10pg)
PCR?Buffer 5μl
2.5mM?dNTP 3μl
Forward primer (10 μ M) 1 μ l
Reverse primer (10 μ M) 1 μ l
Taq 1μl(2.5U)
ddH2 38μl。
The PCR condition: 94 ℃, 5min; 94 ℃, 45Sec; 58 ℃, 45Sec; 72 ℃, 45Sec; 30cycle; 72 ℃, 10min.
After reaction finishes, the PCR product carried out 1% agarose gel electrophoresis and detects, if transform the Bt gene fragment that successfully can detect 1.8kb and 500bp the EPSPS gene fragment (Fig. 2, Fig. 3).
Independently transgenic event has been carried out in this experiment altogether 3 times, transforms 500 flowers at every turn, has obtained 33 strain transfer-gen plants at last altogether.
More than experiment showed, and utilize this method to carry out genetic transformation efficiently cotton, significant to cotton gene engineering and molecular breeding.
Claims (9)
1. the agriculture bacillus mediated spraying decoration method of cotton genetic transforming method may further comprise the steps:
The Agrobacterium that 1) will contain goal gene is diluted to 0.3~0.5OD with suspension-s, and described suspension-s contains sucrose and SilwetL-77.
2) under condition of living body, transform: utilize miniature watering can big Tanaka, agrobacterium suspension is sparged on the flower before the cotton loose powder or on gynoecium and the column cap, utilize Agrobacterium that goal gene is integrated in the cotton gene group.Collect cotton seeds after the cotton boll maturation to be transformed, be seeded in the land for growing field crops, utilize the selection markers genescreen can obtain transfer-gen plant.
2. cotton method for transformation according to claim 1 is characterized in that: contain the SilwetL-77 that 5~10% sucrose or 5~10% sucrose add 20~50 μ L/L in the described agrobacterium suspension.
3. cotton method for transformation according to claim 1; It is characterized in that: described agriculture bacillus mediated spraying decoration method adopts spray method; Agrobacterium suspension evenly is sprayed on the floral organs such as cotton column cap and flower pesticide with miniature watering can, and every colored consumption of suspension-s is 400~600 μ L.
4. cotton method for transformation according to claim 1 is characterized in that: described agriculture bacillus mediated spraying decoration method transformation time is to the firm loose powder stage before the loose powder.
5. cotton method for transformation according to claim 1 is characterized in that: during the acquisition of the said Agrobacterium that contains goal gene goal gene is inserted in the plant expression vector, this expression vector is imported in Agrobacterium again.
6. cotton method for transformation according to claim 5 is characterized in that: used plant expression vector includes but not limited to pBin serial carrier (like pBin19 etc.), pBI serial carrier (like pBI121 etc.), Gateway serial carrier (like pH2GW7 etc.), pCAMBIA serial carrier (like pCAMBIA1302 etc.).
7. cotton method for transformation according to claim 1 is characterized in that: used Agrobacterium includes but not limited to: LBA4404, EHA105 etc.
8. according to the described cotton method for transformation of claim 1~7, it is characterized in that described cotton plants is the healthy and strong complete plant that blooms, the spraying position is the flower of full-bloom stage under the cotton condition of living organism.
9. cotton method for transformation according to claim 1; It is characterized in that: used converting material not only can be the cotton of Malvaceae, can also be used for the genetic transformation of Gramineae, pulse family, Cruciferae, Solanaceae, Curcurbitaceae, umbellate form flower section and other fruit trees, forest, flowers, seminal propagation plant such as medicinal.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010102684479A CN101984065B (en) | 2010-09-01 | 2010-09-01 | Agrobacterium rhizogenes mediated spraying decoration transgenosis method and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010102684479A CN101984065B (en) | 2010-09-01 | 2010-09-01 | Agrobacterium rhizogenes mediated spraying decoration transgenosis method and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101984065A CN101984065A (en) | 2011-03-09 |
CN101984065B true CN101984065B (en) | 2012-05-02 |
Family
ID=43641235
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2010102684479A Expired - Fee Related CN101984065B (en) | 2010-09-01 | 2010-09-01 | Agrobacterium rhizogenes mediated spraying decoration transgenosis method and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101984065B (en) |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102181479B (en) * | 2011-03-14 | 2013-05-15 | 东北农业大学 | Agrobacterium-mediated soybean transgenic method |
CN102352377A (en) * | 2011-10-18 | 2012-02-15 | 天津科润农业科技股份有限公司 | Agrobacterium mediated cucumber transgenic method |
CN103276013B (en) * | 2013-05-29 | 2015-02-25 | 陕西师范大学 | Method for transient expression of exogenous gene by cotton cotyledon |
CN109566402B (en) * | 2019-01-14 | 2021-09-14 | 安徽农业大学 | Method for rapidly and synchronously obtaining male sterile and maintainer line transgenic plants of black-bone dish |
CN110982837B (en) * | 2019-12-16 | 2022-08-02 | 北京市农林科学院 | Preparation method of pepper genetic transformation system |
CN113632724A (en) * | 2021-07-28 | 2021-11-12 | 山西省农业科学院棉花研究所 | Method for improving gene transformation efficiency of cotton living body |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101186926B (en) * | 2007-11-30 | 2010-09-29 | 北京未名凯拓农业生物技术有限公司 | Modified method for transforming gramineous crop by agrobacterium mediated flower-dipping method |
CN101736013B (en) * | 2008-11-21 | 2013-04-03 | 中国科学院遗传与发育生物学研究所 | Method for cultivating transgenic plant |
-
2010
- 2010-09-01 CN CN2010102684479A patent/CN101984065B/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN101984065A (en) | 2011-03-09 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20220124998A1 (en) | Methods and compositions for rapid plant transformation | |
Li et al. | Establishment of an Agrobacteriuim-mediated cotyledon disc transformation method for Jatropha curcas | |
CA2240454C (en) | Method for transforming indica rice | |
CN101182523B (en) | Plants flower pesticide specificity promoter and uses thereof | |
CN101984065B (en) | Agrobacterium rhizogenes mediated spraying decoration transgenosis method and application | |
CN102925488B (en) | Magnetic nanocarrier-mediated plant transgenic method | |
CN109566396A (en) | A kind of plant hybridization system and application | |
CN107338230A (en) | The application of OsMPK11 albumen and its encoding gene in plant drought resistance is regulated and controled | |
Maligeppagol et al. | Genetic transformation of chilli (Capsicum annuum L.) with Dreb1A transcription factor known to impart drought tolerance | |
CN106544344A (en) | A kind of application of tissue-specific promoter in regulation and control crop yield | |
Carneiro | Coffee biotechnology and its application in genetic transformation | |
EP4110929A1 (en) | Immature inflorescence meristem editing | |
WO1996025504A1 (en) | Genetic modification of plants | |
CN102477091B (en) | Rice male sterile protein and coding gene and application thereof | |
CN107338231A (en) | The application of OsMPK21-1 albumen and its encoding gene in plant drought resistance is regulated and controled | |
CN107177565A (en) | Anti- tomato stem wilt gene mLCB2b and its application | |
US20110047651A1 (en) | Transformation and engineered trait modification in miscanthus species | |
CN102533851A (en) | Corn gene normal position transformation method mediated by high throughput agrobacteria | |
CN102559676A (en) | Rice root specific promoter and application thereof | |
US10047369B2 (en) | Citrus derived transcription and translation regulatory elements for tissue specific expression | |
CN113862282B (en) | Soybean PCL homologous gene editing site and application thereof | |
Franche et al. | Genetic transformation of trees in the Casuarinaceae family | |
CN107058381A (en) | A kind of method for obtaining salt tolerant genetically engineered soybean material | |
CN106086063A (en) | A kind of RNAi carrier built based on isocaudarner and application thereof | |
CN107475283A (en) | A kind of corn gene method of the agriculture bacillus mediated pollen of ultrasonic assistant |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120502 Termination date: 20210901 |