CN106947740A - CPS1 reporter gene human liver cell systems and its construction method and application - Google Patents
CPS1 reporter gene human liver cell systems and its construction method and application Download PDFInfo
- Publication number
- CN106947740A CN106947740A CN201710157350.2A CN201710157350A CN106947740A CN 106947740 A CN106947740 A CN 106947740A CN 201710157350 A CN201710157350 A CN 201710157350A CN 106947740 A CN106947740 A CN 106947740A
- Authority
- CN
- China
- Prior art keywords
- cps1
- tdtomato
- cell
- human liver
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/067—Hepatocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0693—Tumour cells; Cancer cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
- C12Y603/04—Other carbon-nitrogen ligases (6.3.4)
- C12Y603/04016—Carbamoyl-phosphate synthase (ammonia) (6.3.4.16)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5014—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing toxicity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
- G01N33/5067—Liver cells
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- Toxicology (AREA)
- General Engineering & Computer Science (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Oncology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses CPS1 reporter gene human liver cell systems and its construction method and application; human liver cell system is built with aminoacyl phosphate synthetase 1 (CPS1) and reporter gene; the CPS1 reporter gene human liver cells of acquisition have the function of the primary adult hepatic parenchymal cells of people; including albumin secretion, cytochrome P 450 enzymes metabolism and ammonia metabolism function; it can be applied in artificial liver, drug metabolism study, drug toxicity evaluation or drug screening, have broad application prospects.
Description
Technical field
The invention belongs to the recombinant cell lines in bioengineering field, more particularly to a kind of carbamylphosphate synthetase
1 (CPS1)-reporter gene human liver cell system and its construction method and application.
Background technology
In the organ of all participation drug biotransformations, liver is topmost place.Medicine is in the metabolism of liver
A kind of major way that medicine is eliminated.Because medicine is directly related to its pharmacological activity and toxic characteristic in the metabolism of liver, enter
And influence the security and validity of medicine clinically.Therefore, medicine is preclinical new drug development process in the metabolism of liver
In a very important link.Using reasonable, effective model prediction medicine effect and potential toxicity to drug metabolism
Evaluation it is most important.For block mold, in vitro study model is with its quick, accurate, high-throughout advantage in medicine
Widely used in the liver bioconversion research of thing by the scientific worker of medicament research and development, but in these models, liver cell
The maintenance of character and associated metabolic function evaluates particularly important to obtaining relatively accurate drug metabolism.
Undoubtedly, from the primary hepatocyte and histotomy of normal structure, with I, II phase metabolic enzyme activity, it is
Carry out the ideal vitro platform of Preclinical Drug metabolism research.However, due to being originated, isolation and culture of cell method
The limitation for the factor such as different, cytoactive difference is huge, original cuiture human liver cell can not meet large-scale safety of medicine
Property screening need.In addition, the liver cell of in vitro culture loses rapidly most of biological activity, the cellar culture liver of more than 3 days
Cell generally cannot function as the model of drug evaluation.In order to improve its biological activity, people are developing a variety of liver cells
Cultural method, including co-culture with liver stromal cell, sandwich culture, Organoid culture etc., having been found to can be to some extent
Improve activity and the time-to-live of liver cell.
At present, can be from liver ancestral cells, embryonic stem cell, inducing pluripotent stem cells, a variety of adult ancestral cells
Induction is broken up and obtains hepatic lineage from body cell by pedigree reprogramming, and this also turns into the important sources of hepatocyte.
The embryonic stem cell (hESCs) of people is a kind of height neoblast that finds, can cultivate in vitro from body early embryo, is had
The totipotency of embryonic development is that, with the tissue and the characteristic of cell differentiation to 3 germinal layers, can be induced under given conditions point
Turn to liver cell.How hESCs to be induced to liver cell and broken up, and it is in recent years to obtain the cell with mature hepatocytes function
The emphasis of stem-cell research field concern.Pass through sequential addition different cytokines and/or small molecule combinatorial, the embryo of different genera
Tire stem cell can successfully be induced to differentiate into hepatocyte-like cells (the Baharvand et similar with mature hepatocytes in vitro
Al.Int J Dev Biol.2006,50 (7):645-652;Cai et al.Hepatol.2007,45 (5):1229-1239;
Hay et al.Stem Cells.2008,26 (4):894-902.), and people's inducing pluripotent stem cells can also be by similar
Method is induced to differentiate into hepatocyte-like cells (Si-Tayeb et al.Hepatology.2010,51 (1):297-305;
Sullivan et al.Hepatology.2010,51 (1):329-335.).Although different research teams uses different thin
Intracellular cytokine and/or small molecule combinatorial, different schemes identical place is all to use multistep processes.It is thus particularly early in each stage
Stage phase, the deviation that cell differentiation direction occurs can all be built up in follow-up each stage, and acutely be amplified, so as to cause induction
Heterogeneousization is presented in inefficiency, the cell that induction is obtained.This heterogeneousization is shown as in stem cell liver into induction differentiation:Finally
The cell of acquisition, not only including mature hepatocytes, while also including hepatic progenitor cells, liver stem cells and other intermediate state cells.
Because intermediate state cell does not possess the distinctive function of liver cell or hepatocyte function lowly, so that the cell that induction is obtained
Allomeric function is low, there is significant deficiency in drug metabolism evaluation.
At the same time, index (such as cell survival rate) at present in drug evaluation often from terminal type, so that medicine
The monitoring of thing mechanism becomes complicated, it is necessary to increase more settings to obtain relatively accurate result.Therefore, set up simple straight
The evaluation platform with primary hepatocyte characteristic that see, can be carried out real-time monitored will greatly promote drug metabolism evaluation.
The content of the invention
It is an object of the present invention to provide a kind of carbamyl phosphate synthetase 1 (CPS1) reporter gene human liver cell system
Construction method.
The construction method of CPS1 reporter genes human liver cell system provided by the present invention, comprises the following steps:
1) skeleton carrier for single guide RNA (sgRNA) coded sequence for carrying targeting CPS1 genes is built, referred to as
sgCPS1;
2) targeting vector of CPS1 genes, abbreviation CPSLR-2A-tdTomato are built;
3) sgCPS1 and CPSLR-2A-tdtomato are transfected into human liver cell system, stabilization is obtained through screening
TdTomato marks CPS1 CPS1-tdTomato speaker's hepatic cell line.
In the construction method of above-mentioned CPS1 reporter genes human liver cell system, the step 1) in be used to build and carry CPS1
The tool carrier of single-stranded guide RNA (sgRNA) skeleton carrier of gene includes px458, px330, px461 and px333, is preferably
pX458.The skeleton carrier of the single guide RNA (sgRNA) of CPS1 genes is carried using tool carrier pX458 as the vector construction that sets out
The method of (being named as pX458-sgCPS1), comprises the following steps:
1.1) design targeting CPS1 genes (No. GenBank:1373) sgRNA, CPS1 is obtained according to CPS1sgRNA sequences
The target sequence of gene is:AGCTGTGCAGAAATCTCGCA (is located at CPS1 genes from 5 ' end 4759-4778 bit bases), root
CPS1sgRNA coded sequences are obtained according to the target sequence of CPS1 genes, Bbs I enzymes are added at CPS1sgRNA coded sequences two ends
Sequence is cut, final oligonucleotide sequence of the acquisition comprising CPS1sgRNA coded sequences is as follows:
oligo1:5’-CACCAGCTGTGCAGAAATCTCGCA-3 ' (band underscore base is Bbs I cleavage sequences),
oligo2:5’-TTTGACGCTCTAAAGACGTGTCGA-3 ' (band underscore base is Bbs I cleavage sequences);
1.2) the oligonucleotides oligo1 and oligo2 comprising CPS1sgRNA coded sequences of synthesis anneal and phosphorus
Acidifying;
1.3) tool carrier pX458 is subjected to digestion with BbsI, reclaims, purifies digestion tool carrier pX458;
1.4) it will anneal and the oligonucleotides oligo1 and oligo2 comprising CPS1 sgRNA coded sequences of phosphorylation connect
Enter in the tool carrier pX458 through digestion;
1.5) connection product is converted into DH5 α competence bacteriums, is coated on Amp+Culture plate, 37 DEG C of overnight incubation (16-
20 hours);
1.6) recombinant plasmid is extracted from the monoclonal bacterium grown, obtains carrying the weight of CPS1sgRNA coded sequences
Group carrier is skeleton carrier, is named as pX458-sgCPS1, its nucleotide sequence is as shown in sequence 1 in sequence table.
The step 2) in the carrier that sets out that is used to build CPS1 gene targeting carriers be (but to be not limited to comprising tdTomato
TdTomato, can also including GFP, EGFP, YFP etc. a variety of fluorescent reporter genes) prokaryotic expression carrier, such as pET-
Tdtomato, pQE-tdtomato, pUC-tdtomato etc., but above-mentioned carrier is not limited only to, as long as the load including tdtomato
Body can be used, preferably pET32-tdtomat.Using pET32-tdTomato as the CPS1 gene targeting carriers for the vector construction that sets out
The method of (being named as pET32-CPSLR-tdTomato), comprises the following steps:
2.1) the left arm Insert Fragment (CPSL) and right arm Insert Fragment (CPSR) of CPS1 genes, left arm Insert Fragment are obtained
(CPSL) nucleotide sequence is as shown in sequence 2 in sequence table, the nucleotide sequence such as sequence table of right arm Insert Fragment (CPSR)
Shown in middle sequence 3;
2.2) double enzymes are carried out to left arm Insert Fragment (CPSL) and pET32-tdTomato carriers with Kpn I and EcoR V
Cut, two kinds of double digestion products are attached, connection product is converted into DH5 α competence bacteriums, Amp is coated on+LB cultures are flat
Plate, 37 DEG C are incubated overnight (16-20 hours), select monoclonal growth bacterium and extract recombinant plasmid, obtain carrying left arm insertion piece
The recombinant vector of section (CPSL), is named as pET32-CPSL-tdTomato;
2.3) right arm Insert Fragment (CPSR) and pET32-CPSL-tdTomato carriers are entered with Hind III and Sal I
Row double digestion, two kinds of double digestion products are attached, and connection product is converted into DH5 α competence bacteriums, Amp is coated on+LB is trained
Flat board is supported, 37 DEG C are incubated overnight (16-20 hours), select monoclonal growth bacterium and extract recombinant plasmid, obtain carrying left arm and insert
Enter the recombinant vector of fragment (CPSL) and right arm Insert Fragment (CPSR), be named as pET32-CPSLR-tdTomato, its nucleosides
Acid sequence is as shown in sequence 4 in sequence table.
The step 3) in the human liver cell system of transfection be for immortal human normal liver cell system or human liver tumor cell;Its
In, the immortal human normal liver cell system commercially obtains, preferably following any cell lines:CRL-11233、
OUMS-29/TK, HepLL, cBAL, LO2, numbering or domestic conventional number that numbering is ATCC.
The step 3) in cell transfecting and screening technique be:By pX458-sgCPS1 (skeleton carrier of CPS1 genes)
Plasmid and pET32-CPSLR-tdTomato (targeting vector of CPS1 genes) plasmid in mass ratio 1:3 ratios are mixed, and every 106People
Hepatic cell line cell is mixed with 2 μ g mixing plasmids, and 1050V 30pulse shock by electricity twice, and cell is resuspended in into 2mL includes 10%
(V/V) in the DMEM in high glucose culture medium of hyclone, 200 μ g/mL G418 is added after 24 hours and are screened, after 15 days, obtained
G418 resistance clones, extract its genomic DNA, with the oligonucleotides from CPS1DNA sequences and tdtomato gene orders
It is used as primer (sequence:5 '-GAAGATCTTTGTGTGAATCTTCAGGAATA-3 ' and 5 '-CCATGTTGTTGTCCTCGGAGGA-
3 ') enter performing PCR to expand and pcr amplification product is sequenced, obtain CPS1-tdtomato human liver cells system reporter cell.
The human liver cell system is HepG2 cells or LO2, respectively obtains CPS1-tdtomato report HepG2 cells
(HepG2-CPS-tdTomato, HCT) or CPS1-tdtomato report LO2 cells (LO2-CPS-tdTomato, LCT).
The CPS1-tdTomato human liver cells system reporter cell obtained in aforementioned manners, it is specific particularly in embodiment to obtain
The deposit number arrived is CGMCC No.13810, and the CPS1-tdtomato of entitled HepG2-CPS-tdTomato (HCT) is reported
HepG2 cells, or deposit number are CGMCC No.13811, the CPS1- of entitled LO2-CPS-tdTomato (LCT)
Tdtomato report LO2 cells fall within the present invention.
The CPS1-tdtomato report HepG2 cells obtained using human hepatoma cell line HepG2 are named as HepG2-CPS-
TdTomato (HCT), was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms on 03 15th, 2017
Center (address:Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Institute of Microorganism, Academia Sinica, postcode:
100101), deposit number is CGMCC No.13810;
The CPS1-tdtomato report LO2 cells obtained using people's immortalized cell line LO2 are named as LO2-CPS-
TdTomato (LCT), was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms on 03 15th, 2017
Center (address:Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Institute of Microorganism, Academia Sinica, postcode:
100101), deposit number is CGMCC No.13811.
CPS1 reporter genes human liver cell system provided by the present invention cell, finds using Immunofluorescence test, substantial amounts of
Cell expresses red fluorescent protein, and the function with the primary adult hepatic parenchymal cells of people, including albumin secretion, cell color
Plain P450 enzymes metabolism and ammonia metabolism function.
The CPS1 reporter gene human liver cells of the present invention are tied up in drug metabolism study, drug toxicity evaluation or drug screening
Application fall within the present invention.
The invention provides a kind of aminoacyl phosphate synthetase 1 (CPS1) reporter gene human liver cell system and its structure side
Method and application.The present invention not only constructs aminoacyl phosphate synthetase 1 (CPS1) reporter gene human liver cell system, and can obtain
With relatively in the past higher ammonia metabolism ability and with primary adult hepatic parenchymal cells function include albumin secretion, CYP3A4 generations
Thank to the liver cell of activity, and the liver cell purity with ammonia metabolism function obtained is higher (referring to embodiment 4).The present invention's
CPS1 reporter gene human liver cells system can be applied in drug metabolism study, drug toxicity evaluation or drug screening, with wide
Application prospect.
The present invention is described in further details with reference to specific embodiment.
Brief description of the drawings
Fig. 1 is CPS1 gene targeting strategy schematic diagrames;
Fig. 2 is the schematic diagram of CPS1 gene targeting carrier pET32-CPSLR-tdTomato building process;
Fig. 3 is CPS1 gene targeting carriers pET32-CPSLR-tdTomato digestion qualification result;
Fig. 4 is the cell phenotype and fluorescent protein expression situation that CPS1-tdtomato reports HepG2, LO2;
Fig. 5 be CPS1-tdtomato report HepG2 and LO2 (HCT and LCT) cell functional character (albumin secretion,
CYP3A4 activity and ammonia metabolism ability) and fluorescence intensity correlation
Fig. 6 is that CPS1-tdtomato reports application of the HepG2 cells in micromolecular compound screening;
Fig. 7 obtains influence of the small molecule phenylbutyrate sodium to reporter cell hepatocyte function gene expression for screening;
Fig. 8 is that CPS1-tdtomato reports application of the HepG2 cells in small molecule toxicity assessment.
Embodiment
The present invention is intended to provide a kind of carbamyl phosphate synthetase 1 (CPS1) reporter gene human liver cell system, the present invention
CPS1 gene targeting strategies after research of the inventor based on following several respects, analysis as shown in figure 1, to complete complete scheme, have
Body is implemented to complete the present invention:
Aminoacyl phosphate synthetase 1 (CPS1) and its gene
Carbamylphosphate synthetase 1 is encoded by the carbamylphosphate synthetase 1 positioned at genome 2q35.DNA bases
Because of common 120kb in group, wherein have 38 extrons and 37 intrones, one polypeptide containing 1500 amino acid of coding
(Summar ML, et al.Gene 2003;311:51-57.Takakusa H, et al.Biochem Biophys Res
Commun 2012;420:54-60.).165kDa carbamylphosphate synthetase 1 is produced in cytoplasm, is then transferred into
Mitochondria is modified to the form of the 160kDa sizes of maturation.Ripe carbamylphosphate synthetase I and its co-factor N- acetyl
Glutamic acid simultaneously consumes 2 molecule ATP, catalysis ammonia and bicarbonate formation carbamyl phosphate.The synthesis of carbamyl phosphate
Mainly divide three steps:ATP effect under phosphorylation bicarbonate, by carbonic acid phosphoric anhydride and ammonia synthesis carbamate, finally in ATP
Effect is lower to be formed by the phosphorylation of carbamate.
Carbamylphosphate synthetase 1 (CPS1) is first enzyme of liver cell urea cycle, is also rate-limiting enzyme.Urea is followed
The function of ring is by the nontoxic urea of poisonous ammonia synthesis, so as to avoid the generation of hyperammonemia.Thus CPS1 genes and function
It is completely one of deciding factor that liver cell plays solution ammonia function.Simultaneously CPS1 be also hepatocyte function marker gene it
One.
The reason for selecting carbamylphosphate synthetase 1 (CPS1) gene and advantage
Carbamylphosphate synthetase 1 (CPS1) is first enzyme of liver cell urea cycle, is also whole solution ammonia process
Rate-limiting enzyme.The function of urea cycle is by the nontoxic urea of poisonous ammonia synthesis, so as to avoid the generation of hyperammonemia.Research
Hyperammonemia can be shortly died from after the mouse birth of display CPS1 missings, CPS1 genes are shown and fully functional in liver cell
Play the important function of solution ammonia function.The development of liver cell gradually expresses CPS1 genes to avoid the damage of ammonia into progenitor stage
Wound, CPS1 expression and the maturity of cell, functional status and solution ammonia activity are proportionate.CPS1 is in cytoplasm
Produce, be then transferred into mitochondria and be modified to mature form.CPS1 gene targeting strategies are as shown in figure 1, present invention selection CPS1
For target gene, by the way that CPS1 is marked in genomic level, screening separation obtains the clone of the different expression intensities of CPS1
Strain, obtains the correlation of hepatocyte function and CPS1 expressions and cell fluorescence intensity, and based on this reporting platform
High-throughout small molecule Screening Platform is set up, and then is available for that hepatocyte function can be improved or suppresses hepatocyte function
Small molecule.Active carbamylphosphate synthetase 1 (CPS1) function in mitochondria, thus when liver cell by
When damage, particularly mitochondrial toxicity are damaged, the change of Mitochondrial Shape can be by CPS1 albumen in Intramitochondrial aggregation
Status display comes out.Thus, when carrying out spike to CPS1 albumen using fluorescence labels, the liver that can real-time monitor compound is thin
Cellular toxicity, i.e. cell fluorescence are from cytoplasm is positioned to full cell, and in high aggregation, and intensity drastically strengthens, and shows compound
Hepatotoxicity it is big.
The selection of hepatic cell line
Except mature hepatocytes, existing hepatic cell line is due to its steady sources, and in vitro culture is easy and can keep phase
To stable metabolism enzyme concentration, the external hepatic metabolism for being used for medicine frequently as cell model is studied.But still need to therefrom select to fit
Suitable cell line.Present invention research is found:
HepG2 cell lines are most representative and the most frequently used human liver tumor cell systems, are one served many purposes
Strain cell, the cell line remains the function that can be lost after many primary cells are continuously cultivated in vitro, can such as secrete a variety of blood
Starch albumen;In addition, HepG2 cells can also express many I phases and II phase metabolic enzymes.In testing in vitro, do not have generation with other
The cell for thanking to activity is compared, and HepG2 cells remain the CYP450 metabolic activities of many exogenous materials (including medicine), can be with
Activation and removing toxic substances external source poisonous substance, so as to preferably effect of the reflection poisonous substance in body.
LO2 cell lines are a kind of domestic immortal human liver cell lines filtered out using normal liver cell, possess part
Hepatocyte function such as amino removing and Albumin Secretion etc., propagation is rapid and passage is stable.However, it is swollen to build the liver cell for being or liver
Oncocyte functional level makes it be used for the effect used in connection with such as drug metabolism suitable well below the primary hepatocyte of fresh separated
It is limited.
In addition, how cell line avoids the regression of its function during Long Term Passages in vitro, will utilize cell line
Build the problem of must paying attention in evaluation study.
Researched and analysed based on more than, although the human liver cell of transfection can be that immortal human normal liver cell system or people liver are swollen
Oncocyte system, such as immortal human normal liver cell system can be following any cell lines:CRL-11233、OUMS-29/TK、
HepLL, cBAL, LO2 (numbering or domestic conventional number that numbering is ATCC).Preferred HepG2 cells in the embodiment of the present invention
System and LO2 cell lines.
Method therefor is conventional method unless otherwise instructed in following embodiments, and specific steps can be found in:
《Molecular Cloning:A Laboratory Manual》(Sambrook, J., Russell, David W.,
Molecular Cloning:A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring
Harbor)。
The percent concentration is mass/mass (W/W, unit g/100g) percent concentration, matter unless otherwise instructed
Amount/volume (W/V, unit g/100mL) percent concentration or volume/volume (V/V, Unit/mL/100mL) percent concentration.
The acquirement approach of various biomaterials described in embodiment be only to provide it is a kind of test obtain approach with up to
To specifically disclosed purpose, the limitation to biological material source of the present invention should not be turned into.In fact, used biomaterial
Source be it is extensive, it is any keep on the right side of the law the biomaterial that can be obtained with moral ethics can be according to carrying in embodiment
Show and be replaced.
The primer and DNA fragmentation are synthesized by calm and peaceful company of Sino-U.S. and AudioCodes company.
Embodiment is implemented lower premised on technical solution of the present invention, gives detailed embodiment and specific
Operating process, embodiment will be helpful to understand the present invention, but protection scope of the present invention is not limited to following embodiments.
Embodiment 1, the single-stranded guide RNA (sgRNA) for designing carbamyl phosphate synthetase 1 (CPS1) gene and skeleton are carried
Body is built
1) the single-stranded guide RNA (sgRNA) of design carbamyl phosphate synthetase 1 (CPS1) gene is real using MIT cutting edges of a knife or a sword
Test room website (network address:Crispr.mit.edu) the clear and definite CPS1 genes of sgRNA target design softwares (No. GenBank:1737)
SgRNA recognition sites, obtain CPS1 genes target sequence be:AGCTGTGCAGAAATCTCGCA (is located at CPS1 genes certainly
5 ' end 4759-4778 bit bases), and plus the cohesive end formation pairing that can be produced with Bbs I digestions in this sequence
Nucleotides, particular sequence is as follows:
oligo1:5’-CACCAGCTGTGCAGAAATCTCGCA-3 ',
oligo2:5’-TTTGACGCTCTAAAGACGTGTCGA-3’;
Underscore annotated sequence can include homing sequence sgRNA with Bbs I digestion termini-complementaries, Oligo1 and Oligo 2,
The frame sequence formation sgRNA that can be included after annealing with tool carrier pX458 plasmids.
2) oligonucleotide sequence comprising CPS1gRNA coded sequences of synthesis is pressed into following reaction system and reaction condition
Anneal and carry out phosphorylation
Reaction system is as follows:
Digestion condition is:37 DEG C 3 hours.
Reclaimed with gel purification kit (being purchased from Beijing Tiangeng company), purify the carrier pX458 through BbsI digestions.
4) it will anneal and the oligonucleotides comprising CPS1sgRNA coded sequences of phosphorylation connected into BbsI digestion carriers
pX458
Linked system is as follows:
Condition of contact is:Room temperature is connected 10 minutes.
5) convert
Connection product is converted into DH5 α competence bacteriums, Amp is coated on+(concentration 100mg/mL) LB culture plates, 37 DEG C
It is incubated overnight (16-20 hours)
6) sequencing identification
Recombinant plasmid is extracted from the monoclonal bacterium grown to be sequenced, the institute of sequence 1 in nucleotide sequence such as sequence table
Show, sequencing result shows to obtain the recombinant vector that sequence correctly carries CPS1sgRNA coded sequences, is named as pX458-
SgCPS1 (skeleton carrier of CPS1 genes).
In the embodiment, step 3) in be used to build the guide RNA (gRNA) for carrying CPS1 genes tool carrier and include
But px458, px330, px461 and px333 are not limited to, the present embodiment is illustrated by taking pX458 as an example.Also other instruments be can select
Carrier obtains the skeleton carrier of CPS1 genes with identical process, no longer repeats one by one.
Embodiment 2, the targeting vector pET32-CPSLR-tdTomato for building CPS1 genes
As shown in Fig. 2 the targeting vector pET32-CPSLR-tdTomato of CPS1 genes building process includes following step
Suddenly:
1) CPS1 gene left arm Insert Fragments (CPSL) and right arm Insert Fragment (CPSR) amplimer, primer sequence are designed
(following primer sequence please be provide) as follows:
CPS1 gene left arm Insert Fragment (CPSL) amplimer:
Forward primer (CPSL-F):5‘-GAAGATCTTTGTGTGAATCTTCAGGAATA-3’
Reverse primer (CPSL-R):5’-CGGATATCTGCTGCTTTTCCAGCACTGT-3’;
CPS1 gene right arm Insert Fragment (CPSR) amplimer:
Forward primer (CPSR-F):5’-ACGCGTCGACAGATGCAGACACCCCAGCC-3’
Reverse primer (CPSR-R):5’-CCCAAGCTTGAAGTAATGAAAGTCTTGAC-3’.
2) PCR amplifications CPS1 gene left arm Insert Fragments (CPSL) and right arm Insert Fragment (CPSR) PCR reaction systems are:
PCR reaction conditions are:98 DEG C of 1min, 30 × (98 DEG C of 15s, 68 DEG C of 2min30s), 68 DEG C of 7min.
After reaction terminates, 1% agarose gel electrophoresis detection is carried out to pcr amplification product, is separately recovered and purifies
2300bp left arm Insert Fragment (CPSL) and 2000bp right arm Insert Fragment (CPSR).
3) left arm Insert Fragment (CPSL) and right arm Insert Fragment (CPSR) are connected into pZERO cloning vectors (north respectively
Jing Quan formulas King Company) in,
Linked system is:
Condition of contact is:Room temperature 10min.
4) convert
Connection product is converted into DH5 α competence bacteriums, Amp is coated on+(100mg/mL) LB culture plates, 37 DEG C of incubations
Overnight (16-20 hours).
5) sequencing identification
Recombinant plasmid is extracted from the monoclonal bacterium grown to be sequenced, and is selected positive colony and is sequenced, sequencing knot
Fruit shows to obtain the correct left arm Insert Fragment (CPSL) of sequence and right arm Insert Fragment (CPSR), left arm Insert Fragment
(CPSL) nucleotide sequence is as shown in sequence 2 in sequence table, the nucleotide sequence such as sequence table of right arm Insert Fragment (CPSR)
Shown in middle sequence 3.
6) with KpnI and EcoRV, to left arm Insert Fragment (CPSL) and pET32-tdTomato carriers, (pET32 carriers are business
Purchase, tdtomato coding red fluorescent proteins, effect is to provide traceable reporting tag) double digestion is carried out, digestion system is:
Digestion condition is:37 DEG C 3 hours.
It is attached after two kinds of double digestion products are reclaimed, linked system is:
Condition of contact is:Room temperature 10min
4) convert
Connection product is converted into DH5 α competence bacteriums, Amp is coated on+(concentration 100mg/mL) LB culture plates, 37 DEG C
It is incubated overnight (16-20 hours), selects monoclonal growth bacterium and enter performing PCR and KpnI/EcoRV digestions identification, be named as
pET32-CPSL-tdTomato。
7) right arm Insert Fragment (CPSR) and pET32-CPSL-tdTomato carriers are carried out with HindIII and SalI double
Digestion
Digestion system is:
Digestion condition is:37 DEG C 3 hours.
It is attached after two kinds of double digestion products are reclaimed,
Linked system is:
Condition of contact is:Room temperature 10min.
Connection product is converted into DH5 α competence bacteriums, Amp is coated on+(concentration 100mg/mL) LB culture plates, 37 DEG C
It is incubated overnight (16-20 hours), selects monoclonal growth bacterium and enter performing PCR and digestion identification, digestion qualification result is as shown in Figure 3
(the 1st swimming lane:Ribonucleic acid marker DL15000, the 2nd swimming lane:CPSLR-tdTomato (i.e. pET32-CPSL-tdTomato),
3rd swimming lane:CPSLR-tdTomato Kpn I/EcoR V, the 4th swimming lane:CPSLR-tdTomato Kpn I/Hind III, the 5th
Swimming lane:CPSLR-tdTomato EcoRV/Hind III, the 6th swimming lane:CPSLR-tdTomato Sal I/Hind III), enzyme
Cut qualification result and show vector construction success, then carry out sequencing identification, nucleotide sequence is as shown in sequence 4 in sequence table, sequencing
As a result show to obtain the recombinant vector that sequence correctly carries left arm Insert Fragment (CPSL) and right arm Insert Fragment (CPSR),
It is named as pET32-CPSLR-tdTomato (targeting vector of CPS1 genes).
Present embodiment shows that using pET32-tdtomat as the vector construction CPS1 gene targeting carriers pET32- that sets out
CPSLR-tdTomatop process, also can select the other carriers that set out (carrier is not limited only to pet vector series, if including
Tdtomato carrier can be used, such as pQE-tdTomato, pUC-tdTomato etc.) CPS1 genes are obtained with identical process
Targeting vector, is no longer repeated one by one.
In addition, fluorescent reporter group is also not necessarily limited to tdTomato, the fluorophor such as also can select GFP, EGFP, YFP,
Also do not repeat one by one herein.
Embodiment 3, structure CPS1-tdtomato report Bel7402s (HepG2) and hepatic cell line (LO2)
By pX458-sgCPS1 (skeleton carrier of CPS1 genes) plasmids and pET32-CPSLR-tdTomato (CPS1 genes
Targeting vector) plasmid press 1:3 (mass ratio) ratios are mixed, and every 106Human liver cell system cell (HepG2 or LO2) is mixed with 2 μ g
Plasmid is mixed, and 1050V 30pulse are shocked by electricity twice, and cell is resuspended in into the DMEM in high glucose that 2mL includes 10% (V/V) hyclone
In culture medium, 200 μ g/mL G418 (Geneticin, Geneticin) are added after 24 hours and are screened, after 15 days, obtained
G418 resistance clones, extract its genomic DNA, with the oligonucleotides from CPS1DNA sequences and tdtomato gene orders
It is used as primer (sequence:5 '-GAAGATCTTTGTGTGAATCTTCAGGAATA-3 ' and 5 '-CCATGTTGTTGTCCTCGGAGGA-
3 ') enter performing PCR to expand and pcr amplification product is sequenced, obtain CPS1-tdtomato human liver cells system reporter cell.
CPS1-tdtomato reports HepG2, LO2 cell are respectively labeled as HepG2-CPS-tdTomato (HCT) and LO2-CPS-
tdTomato(LCT).Cell phenotype and fluorescent protein expression situation such as Fig. 4 (label rules:Intermediate fluorescence intensity is characterized with M;Number
Word characterizes clone number.) shown in.
The CPS1-tdtomato report HepG2 cells obtained using human hepatoma cell line HepG2 are named as HepG2-CPS-
TdTomato (HCT), was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms on 03 15th, 2017
Center (address:Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Institute of Microorganism, Academia Sinica, postcode:
100101), deposit number is CGMCC No.13810;The CPS1-tdtomato reports obtained using people's immortalized cell line LO2
LO2 cells are named as LO2-CPS-tdTomato (LCT), are preserved in Chinese microorganism strain preservation on 03 15th, 2017
Administration committee's common micro-organisms center (address:Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Chinese Academy of Sciences microorganism is ground
Study carefully institute, postcode:100101), deposit number is CGMCC No.13811.
Functional character (the albumin point of embodiment 4, CPS1-tdtomato report HepG2 and LO2 (HCT and LCT) cell
Secrete, CYP3A4 activity and ammonia metabolism ability) and fluorescence signal correlation determination
The CPS1-tdtomato report HepG2 cells obtained will be screened or LO2 cells (HCT or LCT) press 2 × 105/cm2
Plant in 96 orifice plates (the saturating blackboard in bottom, Grenier, Germany) or 12 orifice plates, be placed on 37 DEG C of overnight incubations (10-14 hours), profit
With the high intension image system collection cell fluorescence signals of GE.Culture medium is replaced with without phenol red DMEM, cell culture incubator, 37 is put into
DEG C, 5%CO2It is incubated 24 hours, collects supernatant, adds NH containing 1mM4Cl, with albumin enzyme linked immunological kit (Bethyl
Albumin ELISA kit), CYP3A4 activity detection kits (Promega V9002-P450-GloTM CYP3A4Assay
With Luciferin-IPA), ammonia content quantification kit (Ammonia Assay Kit, purchased from Sigma-Aldrich companies)
With urea detection kit (QuantichromTMUrea Assay Kit DIUR-048, purchased from Bioassay companies) detection is carefully
Intracrine albumin, CYP3A4 activity, the ability that ammonia is removed and urea is produced, and collect cell.Extracted and tried using intracellular rna
Agent box (QiagenMini Kit) cell total rna is extracted, using 1 μ g total serum IgEs, tried using GoldScript reverse transcriptions
Agent box carries out cDNA synthesis, and reaction system and composition of each stage are as follows:
1) total system is 20 μ L, and respectively using 1 μ g RNA as template, the first reaction system is prepared in EP pipes:
1 μ g total serum IgEs,
1 μ L Oligo dT,
1 μ L dNTP Mix (10mM),
DEPC water is mended to 10 μ L.
65 DEG C of effect 5min, are immediately placed on ice, cool down 2min.
2) the second reaction system is prepared in another EP pipes:
3) by above-mentioned 2 pipe liquid blending, room temperature effect 10min often adds 1 μ L GoldScript RTase, 42 in pipe
DEG C effect 50min, 70 DEG C of effect 15min, reverse transcription product is directly used in PCR reactions or is stored in -20 DEG C.
4) cDNA of acquisition is passed through into Toyobo THUNDERBIRDTMQPCR Mix carry out quantitative analysis, quantitative
PCR reaction systems are:
PCR reaction conditions are:95 DEG C of 3min, 40 × (95 DEG C of 10s, 60 DEG C of 35s).
Detect intracellular CPS1 gene expression doses.As a result (label is regular as shown in Figure 5:Cell-fluorescence intensity-clone
Number;H-HCT, L-LCT, the second H characterize high fluorescent, and M characterizes intermediate fluorescence intensity;Digital representation clone number), display is thin
The fluorescence intensity and CPS1 gene expression doses (Fig. 5 A) of born of the same parents and the ammonia Scavenging activity (Fig. 5 B) and urea metabolism ability of cell
(Fig. 5 C) is into positive correlation, while the higher cell albumin secretion capacity (Fig. 5 D) of fluorescence intensity and CYP3A4 are active (Fig. 5 E)
It is higher.This is also indicated that can be by red fluorescence intensity come indicator cells CPS1 expression and liver cell associated metabolic work(
Energy.
Present embodiment shows that the different clones in same cell line source have different metabolic function.It is thin in same clone
Born of the same parents are by unicellular amplification, and the liver cell purity with ammonia metabolism function that the display present invention is obtained is higher.
Embodiment 5, CPS1-tdtomato report HepG2 cells are applied to the high flux screening of small-molecule drug
The CPS1-tdtomato report HepG2 cells (HCT-M4) 2 × 10 obtained will be screened5/cm2Plant 96 orifice plate (bottoms
Saturating blackboard) in, 37 DEG C of overnight incubations (10-14 hours) are placed on, culture medium is replaced with without phenol red DMEM, 1 μM of difference is added small
Molecular medicine, including small point of phenylbutyrate sodium, resveratrol, mammal rapamycin target protein (mTOR) inhibitor series
Sub, dopamine receptor inhibitor or activator, MAPK (MAPK) pathway activation agent and inhibitor etc., 24 is small
Shi Hou, is scanned in PE ensightTM multi-function microplate readers to HCT cells, and quantification treatment is carried out to fluorescence intensity.It is logical
Cross the expression that red fluorescence expression quantity carrys out CPS1 in indicator cells.
CPS1-tdtomato report HepG2 cells (HCT) are in micromolecular compound (by taking phenylbutyrate sodium as an example) Screening Platform
Foundation as Fig. 6 A width (abscissa represents small-molecule drug quantity, and ordinate represents reporter cell fluorescence intensity change multiple)
Shown, display reporter cell fluorescence intensity changes with compound amount, and micromolecular compound is indicated with the change of fluorescence intensity
The influence of medicine and its consumption to liver cell.
A variety of micromolecular compounds are screened (accompanying drawing is not provided one by one), it can be seen that different small molecules are to cell
Fluorescence intensity plays the role of different.By taking phenylbutyrate sodium as an example, this small molecule can effectively strengthen the fluorescence intensity of cell.
HCT and LCT cells are pressed 2 × 105/cm2Plant in 12 orifice plates, be placed on 37 DEG C of overnight incubations (10-14 hours).Will
Culture medium is replaced with the phenylbutyrate sodium (0.5,1,2,4,8 μM) and 1mM NH that various concentrations are added without phenol red DMEM4Cl, is put into
Cell culture incubator, 37 DEG C, 5%CO2It is incubated 24 hours, supernatant is collected, with ammonia content quantification kit (Ammonia Assay
) and urea detection kit (Quantichrom KitTMUrea Assay Kit DIUR-048) detect that cell ammonia is removed and urinated
The ability that element is produced.And intracellular CPS1 gene expression doses and other hepatocyte functions are detected using the method in embodiment 4
Related gene includes antitrypsin (AAT), albumin (ALB), turns the iron factor (TF), Cytochrome P450 family 3A4
(CYP3A4)、1A2(CYP1A2)。
As a result as shown in Fig. 6 B-D width, phenylbutyrate sodium can strengthen the CPS1 expressions of cell and the ability of ammonia metabolism
(produced with urea and ammonia be cleared to index), and this enhancement method is presented in dose-dependent mode.Fig. 7 A-B width is shown
Influence (AAT of the phenylbutyrate sodium different dosing dosage to hepatocyte function:Antitrypsin;ALB:Albumin;TF:Turn the iron factor;
CYP1A2:Cytochrome p 450 family 1A2;CYP3A4:Cytochrome p 450 family 3A4).
The present embodiment result shows that reporter of the present invention may indicate that ability to function of the different small-molecule drugs to CPS1, uses
In drug screening.These results display that this report systems can be used for a certain small-molecule drug different dosing dosage to liver simultaneously
The influence of cell function, so that for the enhanced screening compound of hepatocyte function.
Embodiment 6CPS1-tdtomato reports application of the HepG2 cells in small molecule toxicity assessment
The CPS1-tdtomato report HepG2 cells (HCT) obtained will be screened by 2 × 105/cm2Planting 96 orifice plates, (bottom is saturating
Blackboard, Grenier, Germany) or 12 orifice plates in, be placed on 37 DEG C of overnight incubations (10-14 hours), add 5% and 20%
Glycerine, is put into cell culture incubator, 37 DEG C, 5%CO2It is incubated 24 hours, utilizes the high intension image system collection cell fluorescence letters of GE
Number.As a result as Fig. 8 shows, in 20% glycerine treatment group, dead cell (arrow is indicated to be located) fluorescent places are transferred to whole from endochylema
Individual cell, and in high aggregation state, show that the hepatotoxicity of 20% glycerine is big.This also indicates that CPS1-tdtomato is reported
HepG2 cells can effectively monitor the cytotoxicity of small molecule in real time.
Sequence table
Sequence table
<110>Feild Flood Transfusion Inst., Academy of Military Medicine Sciences, PLA
<120>CPS1 reporter gene human liver cell systems and its construction method and application
<130> CGCNB175034
<160> 4
<210> 1
<211> 9292
<212> DNA
<213>Carry the recombinant vector pX458-sgCPS1 of CPS1 sgRNA coded sequences
<400> 1
gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60
ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120
aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180
atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240
cgaaacacca gctgtgcaga aatctcgcat gttttagagc tagaaatagc aagttaaaat 300
aaggctagtc cgttatcaac ttgaaaaagt ggcaccgcgt cggtgctttt ttgttttaga 360
gctagaaata gcaagttaaa ataaggctag tccgttttta gcgcgtgcgc caattctgca 420
gacaaatggc tctagaggta cccgttacat aacttacggt aaatggcccg cctggctgac 480
cgcccaacga cccccgccca ttgacgtcaa tagtaacgcc aatagggact ttccattgac 540
gtcaatgggt ggagtattta cggtaaactg cccacttggc agtacatcaa gtgtatcata 600
tgccaagtac gccccctatt gacgtcaatg acggtaaatg gcccgcctgg cattgtgccc 660
agtacatgac cttatgggac tttcctactt ggcagtacat ctacgtatta gtcatcgcta 720
ttaccatggt cgaggtgagc cccacgttct gcttcactct ccccatctcc cccccctccc 780
cacccccaat tttgtattta tttatttttt aattattttg tgcagcgatg ggggcggggg 840
gggggggggg gcgcgcgcca ggcggggcgg ggcggggcga ggggcggggc ggggcgaggc 900
ggagaggtgc ggcggcagcc aatcagagcg gcgcgctccg aaagtttcct tttatggcga 960
ggcggcggcg gcggcggccc tataaaaagc gaagcgcgcg gcgggcggga gtcgctgcga 1020
cgctgccttc gccccgtgcc ccgctccgcc gccgcctcgc gccgcccgcc ccggctctga 1080
ctgaccgcgt tactcccaca ggtgagcggg cgggacggcc cttctcctcc gggctgtaat 1140
tagctgagca agaggtaagg gtttaaggga tggttggttg gtggggtatt aatgtttaat 1200
tacctggagc acctgcctga aatcactttt tttcaggttg gaccggtgcc accatggact 1260
ataaggacca cgacggagac tacaaggatc atgatattga ttacaaagac gatgacgata 1320
agatggcccc aaagaagaag cggaaggtcg gtatccacgg agtcccagca gccgacaaga 1380
agtacagcat cggcctggac atcggcacca actctgtggg ctgggccgtg atcaccgacg 1440
agtacaaggt gcccagcaag aaattcaagg tgctgggcaa caccgaccgg cacagcatca 1500
agaagaacct gatcggagcc ctgctgttcg acagcggcga aacagccgag gccacccggc 1560
tgaagagaac cgccagaaga agatacacca gacggaagaa ccggatctgc tatctgcaag 1620
agatcttcag caacgagatg gccaaggtgg acgacagctt cttccacaga ctggaagagt 1680
ccttcctggt ggaagaggat aagaagcacg agcggcaccc catcttcggc aacatcgtgg 1740
acgaggtggc ctaccacgag aagtacccca ccatctacca cctgagaaag aaactggtgg 1800
acagcaccga caaggccgac ctgcggctga tctatctggc cctggcccac atgatcaagt 1860
tccggggcca cttcctgatc gagggcgacc tgaaccccga caacagcgac gtggacaagc 1920
tgttcatcca gctggtgcag acctacaacc agctgttcga ggaaaacccc atcaacgcca 1980
gcggcgtgga cgccaaggcc atcctgtctg ccagactgag caagagcaga cggctggaaa 2040
atctgatcgc ccagctgccc ggcgagaaga agaatggcct gttcggaaac ctgattgccc 2100
tgagcctggg cctgaccccc aacttcaaga gcaacttcga cctggccgag gatgccaaac 2160
tgcagctgag caaggacacc tacgacgacg acctggacaa cctgctggcc cagatcggcg 2220
accagtacgc cgacctgttt ctggccgcca agaacctgtc cgacgccatc ctgctgagcg 2280
acatcctgag agtgaacacc gagatcacca aggcccccct gagcgcctct atgatcaaga 2340
gatacgacga gcaccaccag gacctgaccc tgctgaaagc tctcgtgcgg cagcagctgc 2400
ctgagaagta caaagagatt ttcttcgacc agagcaagaa cggctacgcc ggctacattg 2460
acggcggagc cagccaggaa gagttctaca agttcatcaa gcccatcctg gaaaagatgg 2520
acggcaccga ggaactgctc gtgaagctga acagagagga cctgctgcgg aagcagcgga 2580
ccttcgacaa cggcagcatc ccccaccaga tccacctggg agagctgcac gccattctgc 2640
ggcggcagga agatttttac ccattcctga aggacaaccg ggaaaagatc gagaagatcc 2700
tgaccttccg catcccctac tacgtgggcc ctctggccag gggaaacagc agattcgcct 2760
ggatgaccag aaagagcgag gaaaccatca ccccctggaa cttcgaggaa gtggtggaca 2820
agggcgcttc cgcccagagc ttcatcgagc ggatgaccaa cttcgataag aacctgccca 2880
acgagaaggt gctgcccaag cacagcctgc tgtacgagta cttcaccgtg tataacgagc 2940
tgaccaaagt gaaatacgtg accgagggaa tgagaaagcc cgccttcctg agcggcgagc 3000
agaaaaaggc catcgtggac ctgctgttca agaccaaccg gaaagtgacc gtgaagcagc 3060
tgaaagagga ctacttcaag aaaatcgagt gcttcgactc cgtggaaatc tccggcgtgg 3120
aagatcggtt caacgcctcc ctgggcacat accacgatct gctgaaaatt atcaaggaca 3180
aggacttcct ggacaatgag gaaaacgagg acattctgga agatatcgtg ctgaccctga 3240
cactgtttga ggacagagag atgatcgagg aacggctgaa aacctatgcc cacctgttcg 3300
acgacaaagt gatgaagcag ctgaagcggc ggagatacac cggctggggc aggctgagcc 3360
ggaagctgat caacggcatc cgggacaagc agtccggcaa gacaatcctg gatttcctga 3420
agtccgacgg cttcgccaac agaaacttca tgcagctgat ccacgacgac agcctgacct 3480
ttaaagagga catccagaaa gcccaggtgt ccggccaggg cgatagcctg cacgagcaca 3540
ttgccaatct ggccggcagc cccgccatta agaagggcat cctgcagaca gtgaaggtgg 3600
tggacgagct cgtgaaagtg atgggccggc acaagcccga gaacatcgtg atcgaaatgg 3660
ccagagagaa ccagaccacc cagaagggac agaagaacag ccgcgagaga atgaagcgga 3720
tcgaagaggg catcaaagag ctgggcagcc agatcctgaa agaacacccc gtggaaaaca 3780
cccagctgca gaacgagaag ctgtacctgt actacctgca gaatgggcgg gatatgtacg 3840
tggaccagga actggacatc aaccggctgt ccgactacga tgtggaccat atcgtgcctc 3900
agagctttct gaaggacgac tccatcgaca acaaggtgct gaccagaagc gacaagaacc 3960
ggggcaagag cgacaacgtg ccctccgaag aggtcgtgaa gaagatgaag aactactggc 4020
ggcagctgct gaacgccaag ctgattaccc agagaaagtt cgacaatctg accaaggccg 4080
agagaggcgg cctgagcgaa ctggataagg ccggcttcat caagagacag ctggtggaaa 4140
cccggcagat cacaaagcac gtggcacaga tcctggactc ccggatgaac actaagtacg 4200
acgagaatga caagctgatc cgggaagtga aagtgatcac cctgaagtcc aagctggtgt 4260
ccgatttccg gaaggatttc cagttttaca aagtgcgcga gatcaacaac taccaccacg 4320
cccacgacgc ctacctgaac gccgtcgtgg gaaccgccct gatcaaaaag taccctaagc 4380
tggaaagcga gttcgtgtac ggcgactaca aggtgtacga cgtgcggaag atgatcgcca 4440
agagcgagca ggaaatcggc aaggctaccg ccaagtactt cttctacagc aacatcatga 4500
actttttcaa gaccgagatt accctggcca acggcgagat ccggaagcgg cctctgatcg 4560
agacaaacgg cgaaaccggg gagatcgtgt gggataaggg ccgggatttt gccaccgtgc 4620
ggaaagtgct gagcatgccc caagtgaata tcgtgaaaaa gaccgaggtg cagacaggcg 4680
gcttcagcaa agagtctatc ctgcccaaga ggaacagcga taagctgatc gccagaaaga 4740
aggactggga ccctaagaag tacggcggct tcgacagccc caccgtggcc tattctgtgc 4800
tggtggtggc caaagtggaa aagggcaagt ccaagaaact gaagagtgtg aaagagctgc 4860
tggggatcac catcatggaa agaagcagct tcgagaagaa tcccatcgac tttctggaag 4920
ccaagggcta caaagaagtg aaaaaggacc tgatcatcaa gctgcctaag tactccctgt 4980
tcgagctgga aaacggccgg aagagaatgc tggcctctgc cggcgaactg cagaagggaa 5040
acgaactggc cctgccctcc aaatatgtga acttcctgta cctggccagc cactatgaga 5100
agctgaaggg ctcccccgag gataatgagc agaaacagct gtttgtggaa cagcacaagc 5160
actacctgga cgagatcatc gagcagatca gcgagttctc caagagagtg atcctggccg 5220
acgctaatct ggacaaagtg ctgtccgcct acaacaagca ccgggataag cccatcagag 5280
agcaggccga gaatatcatc cacctgttta ccctgaccaa tctgggagcc cctgccgcct 5340
tcaagtactt tgacaccacc atcgaccgga agaggtacac cagcaccaaa gaggtgctgg 5400
acgccaccct gatccaccag agcatcaccg gcctgtacga gacacggatc gacctgtctc 5460
agctgggagg cgacaaaagg ccggcggcca cgaaaaaggc cggccaggca aaaaagaaaa 5520
aggaattcgg cagtggagag ggcagaggaa gtctgctaac atgcggtgac gtcgaggaga 5580
atcctggccc agtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc atcctggtcg 5640
agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc gagggcgatg 5700
ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg cccgtgccct 5760
ggcccaccct cgtgaccacc ctgacctacg gcgtgcagtg cttcagccgc taccccgacc 5820
acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc caggagcgca 5880
ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag ttcgagggcg 5940
acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac ggcaacatcc 6000
tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg gccgacaagc 6060
agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac ggcagcgtgc 6120
agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg ctgctgcccg 6180
acaaccacta cctgagcacc cagtccgccc tgagcaaaga ccccaacgag aagcgcgatc 6240
acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg gacgagctgt 6300
acaaggaatt ctaactagag ctcgctgatc agcctcgact gtgccttcta gttgccagcc 6360
atctgttgtt tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt 6420
cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattct 6480
ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagagaata gcaggcatgc 6540
tggggagcgg ccgcaggaac ccctagtgat ggagttggcc actccctctc tgcgcgctcg 6600
ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc ccgggctttg cccgggcggc 6660
ctcagtgagc gagcgagcgc gcagctgcct gcaggggcgc ctgatgcggt attttctcct 6720
tacgcatctg tgcggtattt cacaccgcat acgtcaaagc aaccatagta cgcgccctgt 6780
agcggcgcat taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc tacacttgcc 6840
agcgccctag cgcccgctcc tttcgctttc ttcccttcct ttctcgccac gttcgccggc 6900
tttccccgtc aagctctaaa tcgggggctc cctttagggt tccgatttag tgctttacgg 6960
cacctcgacc ccaaaaaact tgatttgggt gatggttcac gtagtgggcc atcgccctga 7020
tagacggttt ttcgcccttt gacgttggag tccacgttct ttaatagtgg actcttgttc 7080
caaactggaa caacactcaa ccctatctcg ggctattctt ttgatttata agggattttg 7140
ccgatttcgg cctattggtt aaaaaatgag ctgatttaac aaaaatttaa cgcgaatttt 7200
aacaaaatat taacgtttac aattttatgg tgcactctca gtacaatctg ctctgatgcc 7260
gcatagttaa gccagccccg acacccgcca acacccgctg acgcgccctg acgggcttgt 7320
ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag 7380
aggttttcac cgtcatcacc gaaacgcgcg agacgaaagg gcctcgtgat acgcctattt 7440
ttataggtta atgtcatgat aataatggtt tcttagacgt caggtggcac ttttcgggga 7500
aatgtgcgcg gaacccctat ttgtttattt ttctaaatac attcaaatat gtatccgctc 7560
atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt 7620
caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct 7680
cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt 7740
tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt 7800
tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtattgac 7860
gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac 7920
tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct 7980
gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg 8040
aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg 8100
gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca 8160
atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa 8220
caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt 8280
ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtggaag ccgcggtatc 8340
attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg 8400
agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt 8460
aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga tttaaaactt 8520
catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc 8580
ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct 8640
tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta 8700
ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc 8760
ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac 8820
ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct 8880
gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat 8940
aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg 9000
acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa 9060
gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg 9120
gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga 9180
cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc 9240
aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat gt 9292
<210> 2
<211> 2022
<212> DNA
<213>Left arm Insert Fragment(CPSL)
<400> 2
tttgtggatg attgtcaagt ttcactctcc atcactatgg aatacataac gtcatgtgta 60
catggtgata tgaaacgtgt ttcaaaatac ttcttagtaa ggatactttc cttgacggaa 120
acaagtgaga gcatgaagaa tgtaatgcag cactttatat ttcatgtcaa acttatattg 180
tgtatagata agtacatcga gtataagatg accagctata tttcactaag gttgtgcata 240
ataaatcaat ttgttgagca cttactacat acaggaacct atgttgagta ctatgatgat 300
gtcatccatt ggattaccta attggtcatt ccttgaccag gttttcatgc cttagaccat 360
gtcatcatta gattttgtac gacattttat ttcagcagat tgtgtgaatc ttcaggaata 420
ccattgcatc aacccttaaa gatctatgtg gcataagtac ataggagata attctctgct 480
gttttaagat agtgcagcct acagaatggc tgtgccattc tatgcaatat gttatttgtt 540
agcgttcttg agaaaccaac acataaatta ttatcacttt aataaaataa tggcattgtg 600
ttcaaacctt agcaggcctc caaggatgta atagctccgt gtttggggca ttgtaaaaca 660
ataattagca ctactaagga ggcaatagag ttaatgtggg agtgggaaca tgggggtgaa 720
agggcattca atggtggagg gatcacctct ttttaaaaaa taagtatcta tcaaattacc 780
aattcttaat gagtgaacag atagcatttt aaagagaaaa caaacatctg cattccatta 840
gacttgcact agaattcctt caagaacaca atataatccc tatataagtg taatttaaac 900
atctacttag caatagagga gggcagatgg cagtcaactc agcatggcat tgacttgaat 960
ggctaagaga gcaatttatg ttagtatttt ataaactaac tataaaatat gccttgttgt 1020
ctataagttt ttgtttattt ttccagattg attagagatg gcagcattga cctagtgatt 1080
aaccttccca acaacaacac taaatttgtc catgataatt atgtgattcg gaggacagct 1140
gttgatagtg gaatccctct cctcactaat tttcaggtat agtcttttcc ttggatatag 1200
actggatggg agttttattt ctgtgcctcc cttaagagtg taatcagtag atgcacatct 1260
ctcttttccc ctctttgtaa ctttcagaat agagaggaat ttttaataat ctaaaataat 1320
gatgctaaca tggtaggtca tggcttaaat gggacagttg gtgatcaagc aattgagata 1380
atcaaaggcc atgaatggcc atggctctct ccttacaatt atcctttgaa taaaaagtga 1440
cagcatgaca tggaataaag atacaaactt ttatttcatt gtttctaaat gaaagccacc 1500
atataaaagc aacaggttaa tgatggtcca gatgtagcac aagtgcttgt tcaattcaca 1560
gaaaatgatt gcatgaggca tgttcagttt cacttggaca tgacccatcg aatttatcac 1620
agggagaaac agagtggaga ctcattaact ttctgcctat catatttatt ttttatgcag 1680
aatcagtttt aatccctatg ggaggagaaa taagcgtatt cacagtgaca tctgagatat 1740
aaaagaaagt ccccatggtg aggtctgaga catgggagaa agtctccatt acataaaaaa 1800
cttttatgcc ttttatccca tacccctttg aaaactgggg acagacactt gtgacttttg 1860
tcttcattca ttaaaaattc acttttatct catggagggt gctgattcct accattatat 1920
tttcaggtga ccaaactttt tgctgaagct gtgcagaaat ctcgcaaggt ggactccaag 1980
agtcttttcc actacaggca gtacagtgct ggaaaagcag ca 2022
<210> 3
<211> 2295
<212> DNA
<213>Right arm Insert Fragment(CPSR)
<400> 3
agatgcagac accccagccc cattattaaa tcaacctgag ccacatgtta tctaaaggaa 60
ctgattcaca actttctcag agatgaatat tgataactaa acttcatttc agtttacttt 120
gttatgcctt aatattctgt gtcttttgca attaaattgt cagtcacttc ttcaaaacct 180
tacagtcctt cctaagttac tcttcatgag atttcatcca tttactaata ctgtattttt 240
ggtggactag gcttgcctat gtgcttatgt gtagcttttt actttttatg gtgctgatta 300
atggtgatca aggtaggaaa agttgctgtt ctattttctg aactctttct atactttaag 360
atactctatt tttaaaacac tatctgcaaa ctcaggacac tttaacaggg cagaatactc 420
taaaaacttg ataaaattaa atatagattt aatttatgaa ccttccatca tgatgtttgt 480
gtattgcttc tttttggatc ctcattctca cccatttggc taatccagga atattgttat 540
cccttcccat tatattgaag ttgagaaatg tgacagaggc atttagagta tggacttttc 600
ttttcttttt ctttttcttt ttttcttttt gagatggagt cacactctcc aggctggagt 660
gcagtggcac aatctcggct cactgcaatt tccgtctccc aagttcaagc gattctcctg 720
ctttagacta tggatttctt taaggaatac tggtttgcag ttttgttttc tggactatat 780
cagcagatgg tagacagtgt ttatgtagat gtgttgttgt ttttatcatt ggattttaac 840
ttggcccgag tgaaataatc agatttttgt cattcacact ctcccccagt tttggaataa 900
cttggaagta aggttcattc ccttaagacg atggattctg ttgaactatg gggtcccaca 960
ctgcactatt aattccaccc actgtaaggg caaggacacc attccttcta catataagaa 1020
aaaagtctct ccccaagggc agcctttgtt acttttaaat attttctgtt attacaagtg 1080
ctctaattgt gaacttttaa ataaaatact attaagaggt aatgcagttg aatctggttt 1140
tattttatgt tgctgtacaa aaatcagttt acttctatga taaaataggg ttttgggcca 1200
ggattgcatt gcttatttat tttttccatg caaacccata tagggatgag aaaattaatg 1260
ttaaaaataa gttttagctg tcacattttt cattttttct tgtccctccc ttgcttttaa 1320
gtctcatcat aacattatgt ggttatatgg ctataaacca tctttgatct ggatcctttc 1380
taatgtataa ctacaaccac aaactgatta aagattgcca caaatatata gtaaactttc 1440
aaacaaatgt cttgcataac tcagaaaagt aacttaaccc aatcagaggc tgaccagcat 1500
tgtctgatgg aaatagtgcc aatgagcaca ctgatgccat atccccaatt taccaccgaa 1560
actatggctt tgtgaaggtc ctaagataat tatgctataa cagcttttat ttcttccttg 1620
ttacctcaca gtcaattgat taccactttg tatagctcta gacgaatgct taaagtaatt 1680
catcttctct ccccctcact tccttgttct tcctgtggtc aagactttca ttacttcttc 1740
cctgtaatct tttttttttt tttttttttt ttttgagacg gagttttgct cttgtcaccc 1800
aggctggagt gcagtggcgc gatctcagct cactgcaacc tccatctcct gggttccagc 1860
gattctcctg cctcagcctc ctgagtagct gagattacag gtgcccgcca acaagcctgg 1920
ctaatatttt gtatttttag tagagacggg gtttcgccat gttgggcagg ctggtcccct 1980
ataatcatat aattatgtaa tccctgatca ctttgattca ttcacctgaa aatatttaat 2040
gagtttcttc catgtttcat gtagaatata tcacaatctc tcctactatt attctagcat 2100
gtttctgtta catatcacca gcaccacaac caccatcacc ataataatta acattatgga 2160
gtccatacta tttttcaggc atttgtaagt actttacatg agttaaccta gttaatccac 2220
aaaatatccc tgtgagtagg tgctgttatc tccatactat aaataagaaa acttaggcat 2280
accaaagtta agtaa 2295
<210> 4
<211> 14920
<212> DNA
<213>Carry left arm Insert Fragment(CPSL)With right arm Insert Fragment(CPSR)Recombinant vector pET32-CPSLR-2A-
tdTomato
<400> 4
tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60
cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120
ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180
gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240
acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300
ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360
ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420
acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480
tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540
tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600
gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660
ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720
agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780
agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840
tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900
tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960
cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020
aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080
tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140
tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200
ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1260
ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320
cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1380
gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1440
actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1500
aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1560
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1620
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1800
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1860
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1920
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980
gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100
cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280
ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400
gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg 2460
tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat 2520
cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580
gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640
gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700
catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760
tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820
ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880
tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940
ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa 3000
aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta 3060
gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120
tttccagact ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag 3180
acgttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240
cagtaaggca accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300
cccgtggggc cgccatgccg gcgataatgg cctgcttctc gccgaaacgt ttggtggcgg 3360
gaccagtgac gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggc 3420
cgatcatcgt cgcgctccag cgaaagcggt cctcgccgaa aatgacccag agcgctgccg 3480
gcacctgtcc tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca 3540
tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 3600
atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660
tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720
gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780
tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840
cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900
tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960
atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020
atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080
tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140
cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200
aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 4260
ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct 4320
tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt 4380
tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440
gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc 4500
gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560
gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620
ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccacgcggga aacggtctga 4680
taagagacac cggcatactc tgcgacatcg tataacgtta ctggtttcac attcaccacc 4740
ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800
atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860
tagtaggttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920
gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980
gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040
aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100
cgatctcgat cccgcgaaat taatacgact cactataggg gaattgtgag cggataacaa 5160
ttcccctcta gaaataattt tgtttaactt taagaaggag atatacatat gagcgataaa 5220
attattcacc tgactgacga cagttttgac acggatgtac tcaaagcgga cggggcgatc 5280
ctcgtcgatt tctgggcaga gtggtgcggt ccgtgcaaaa tgatcgcccc gattctggat 5340
gaaatcgctg acgaatatca gggcaaactg accgttgcaa aactgaacat cgatcaaaac 5400
cctggcactg cgccgaaata tggcatccgt ggtatcccga ctctgctgct gttcaaaaac 5460
ggtgaagtgg cggcaaccaa agtgggtgca ctgtctaaag gtcagttgaa agagttcctc 5520
gacgctaacc tggccggttc tggttctggc catatgcacc atcatcatca tcattcttct 5580
ggtctggtgc cacgcggttc tggtatgaaa gaaaccgctg ctgctaaatt cgaacgccag 5640
cacatggaca gcccagatct gggtaccttt gtggatgatt gtcaagtttc actctccatc 5700
actatggaat acataacgtc atgtgtacat ggtgatatga aacgtgtttc aaaatacttc 5760
ttagtaagga tactttcctt gacggaaaca agtgagagca tgaagaatgt aatgcagcac 5820
tttatatttc atgtcaaact tatattgtgt atagataagt acatcgagta taagatgacc 5880
agctatattt cactaaggtt gtgcataata aatcaatttg ttgagcactt actacataca 5940
ggaacctatg ttgagtacta tgatgatgtc atccattgga ttacctaatt ggtcattcct 6000
tgaccaggtt ttcatgcctt agaccatgtc atcattagat tttgtacgac attttatttc 6060
agcagattgt gtgaatcttc aggaatacca ttgcatcaac ccttaaagat ctatgtggca 6120
taagtacata ggagataatt ctctgctgtt ttaagatagt gcagcctaca gaatggctgt 6180
gccattctat gcaatatgtt atttgttagc gttcttgaga aaccaacaca taaattatta 6240
tcactttaat aaaataatgg cattgtgttc aaaccttagc aggcctccaa ggatgtaata 6300
gctccgtgtt tggggcattg taaaacaata attagcacta ctaaggaggc aatagagtta 6360
atgtgggagt gggaacatgg gggtgaaagg gcattcaatg gtggagggat cacctctttt 6420
taaaaaataa gtatctatca aattaccaat tcttaatgag tgaacagata gcattttaaa 6480
gagaaaacaa acatctgcat tccattagac ttgcactaga attccttcaa gaacacaata 6540
taatccctat ataagtgtaa tttaaacatc tacttagcaa tagaggaggg cagatggcag 6600
tcaactcagc atggcattga cttgaatggc taagagagca atttatgtta gtattttata 6660
aactaactat aaaatatgcc ttgttgtcta taagtttttg tttatttttc cagattgatt 6720
agagatggca gcattgacct agtgattaac cttcccaaca acaacactaa atttgtccat 6780
gataattatg tgattcggag gacagctgtt gatagtggaa tccctctcct cactaatttt 6840
caggtatagt cttttccttg gatatagact ggatgggagt tttatttctg tgcctccctt 6900
aagagtgtaa tcagtagatg cacatctctc ttttcccctc tttgtaactt tcagaataga 6960
gaggaatttt taataatcta aaataatgat gctaacatgg taggtcatgg cttaaatggg 7020
acagttggtg atcaagcaat tgagataatc aaaggccatg aatggccatg gctctctcct 7080
tacaattatc ctttgaataa aaagtgacag catgacatgg aataaagata caaactttta 7140
tttcattgtt tctaaatgaa agccaccata taaaagcaac aggttaatga tggtccagat 7200
gtagcacaag tgcttgttca attcacagaa aatgattgca tgaggcatgt tcagtttcac 7260
ttggacatga cccatcgaat ttatcacagg gagaaacaga gtggagactc attaactttc 7320
tgcctatcat atttattttt tatgcagaat cagttttaat ccctatggga ggagaaataa 7380
gcgtattcac agtgacatct gagatataaa agaaagtccc catggtgagg tctgagacat 7440
gggagaaagt ctccattaca taaaaaactt ttatgccttt tatcccatac ccctttgaaa 7500
actggggaca gacacttgtg acttttgtct tcattcatta aaaattcact tttatctcat 7560
ggagggtgct gattcctacc attatatttt caggtgacca aactttttgc tgaagctgtg 7620
cagaaatctc gcaaggtgga ctccaagagt cttttccact acaggcagta cagtgctgga 7680
aaagcagcag atatcaaaat tgtcgctcct gtcaaacaaa ctcttaactt tgatttactc 7740
aaactggctg gggatgtaga aagcaatcca ggtccaggat ccgccaccat ggtgagcaag 7800
ggcgaggagg tcatcaaaga gttcatgcgc ttcaaggtgc gcatggaggg ctccatgaac 7860
ggccacgagt tcgagatcga gggcgagggc gagggccgcc cctacgaggg cacccagacc 7920
gccaagctga aggtgaccaa gggcggcccc ctgcccttcg cctgggacat cctgtccccc 7980
cagttcatgt acggctccaa ggcgtacgtg aagcaccccg ccgacatccc cgattacaag 8040
aagctgtcct tccccgaggg cttcaagtgg gagcgcgtga tgaacttcga ggacggcggt 8100
ctggtgaccg tgacccagga ctcctccctg caggacggca cgctgatcta caaggtgaag 8160
atgcgcggca ccaacttccc ccccgacggc cccgtaatgc agaagaagac catgggctgg 8220
gaggcctcca ccgagcgcct gtacccccgc gacggcgtgc tgaagggcga gatccaccag 8280
gccctgaagc tgaaggacgg cggccactac ctggtggagt tcaagaccat ctacatggcc 8340
aagaagcccg tgcaactgcc cggctactac tacgtggaca ccaagctgga catcacctcc 8400
cacaacgagg actacaccat cgtggaacag tacgagcgct ccgagggccg ccaccacctg 8460
ttcctggggc atggcaccgg cagcaccggc agcggcagct ccggcaccgc ctcctccgag 8520
gacaacaaca tggccgtcat caaagagttc atgcgcttca aggtgcgcat ggagggctcc 8580
atgaacggcc acgagttcga gatcgagggc gagggcgagg gccgccccta cgagggcacc 8640
cagaccgcca agctgaaggt gaccaagggc ggccccctgc ccttcgcctg ggacatcctg 8700
tccccccagt tcatgtacgg ctccaaggcg tacgtgaagc accccgccga catccccgat 8760
tacaagaagc tgtccttccc cgagggcttc aagtgggagc gcgtgatgaa cttcgaggac 8820
ggcggtctgg tgaccgtgac ccaggactcc tccctgcagg acggcacgct gatctacaag 8880
gtgaagatgc gcggcaccaa cttccccccc gacggccccg taatgcagaa gaagaccatg 8940
ggctgggagg cctccaccga gcgcctgtac ccccgcgacg gcgtgctgaa gggcgagatc 9000
caccaggccc tgaagctgaa ggacggcggc cactacctgg tggagttcaa gaccatctac 9060
atggccaaga agcccgtgca actgcccggc tactactacg tggacaccaa gctggacatc 9120
acctcccaca acgaggacta caccatcgtg gaacagtacg agcgctccga gggccgccac 9180
cacctgttcc tgtacggcat ggacgagctg tacaagtgaa gcggccgcga ctctagatca 9240
taatcagcca taccacattt gtagaggttt tacttgcttt aaaaaacctc ccacacctcc 9300
ccctgaacct gaaacataaa atgaatgcaa ttgttgttgt taacttgttt attgcagctt 9360
ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac 9420
tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttaaaattcc tgcagcccaa 9480
ttccgatcat attcaataac ccttaatata acttcgtata atgtatgcta tacgaagtta 9540
ttaggtctga agaggagttt acgtccagcc aagctagcct cgacattgat tattgactag 9600
ttattaatag taatcaatta cggggtcatt agttcatagc ccatatatgg agttccgcgt 9660
tacataactt acggtaaatg gcccgcctgg ctgaccgccc aacgaccccc gcccattgac 9720
gtcaataatg acgtatgttc ccatagtaac gccaataggg actttccatt gacgtcaatg 9780
ggtggagtat ttacggtaaa ctgcccactt ggcagtacat caagtgtatc atatgccaag 9840
tacgccccct attgacgtca atgacggtaa atggcccgcc tggcattatg cccagtacat 9900
gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg ctattaccat 9960
ggtcgaggtg agccccacgt tctgcttcac tctccccatc tcccccccct ccccaccccc 10020
aattttgtat ttatttattt tttaattatt ttgtgcagcg atgggggcgg gggggggggg 10080
ggggcgcgcg ccaggcgggg cggggcgggg cgaggggcgg ggcggggcga ggcggagagg 10140
tgcggcggca gccaatcaga gcggcgcgct ccgaaagttt ccttttatgg cgaggcggcg 10200
gcggcggcgg ccctataaaa agcgaagcgc gcggcgggcg ggagtcgctg cgcgctgcct 10260
tcgccccgtg ccccgctccg ccgccgcctc gcgccgcccg ccccggctct gactgaccgc 10320
gttactccca caggtgagcg ggcgggacgg cccttctcct ccgggctgta attagcgctt 10380
ggtttaatga cggcttgttt cttttctgtg gctgcgtgaa agccttgagg ggctccggga 10440
gggccctttg tgcgggggga gcggctcggg gggtgcgtgc gtgtgtgtgt gcgtggggag 10500
cgccgcgtgc ggctccgcgc tgcccggcgg ctgtgagcgc tgcgggcgcg gcgcggggct 10560
ttgtgcgctc cgcagtgtgc gcgaggggag cgcggccggg ggcggtgccc cgcggtgcgg 10620
ggggggctgc gaggggaaca aaggctgcgt gcggggtgtg tgcgtggggg ggtgagcagg 10680
gggtgtgggc gcgtcggtcg ggctgcaacc ccccctgcac ccccctcccc gagttgctga 10740
gcacggcccg gcttcgggtg cggggctccg tacggggcgt ggcgcggggc tcgccgtgcc 10800
gggcgggggg tggcggcagg tgggggtgcc gggcggggcg gggccgcctc gggccgggga 10860
gggctcgggg gaggggcgcg gcggcccccg gagcgccggc ggctgtcgag gcgcggcgag 10920
ccgcagccat tgccttttat ggtaatcgtg cgagagggcg cagggacttc ctttgtccca 10980
aatctgtgcg gagccgaaat ctgggaggcg ccgccgcacc ccctctagcg ggcgcggggc 11040
gaagcggtgc ggcgccggca ggaaggaaat gggcggggag ggccttcgtg cgtcgccgcg 11100
ccgccgtccc cttctccctc tccagcctcg gggctgtccg cggggggacg gctgccttcg 11160
ggggggacgg ggcagggcgg ggttcggctt ctggcgtgtg accggcggct ctaggctgtt 11220
gacaattaat catcggcata gtatatcggc atagtataat acgacaaggt gaggaactaa 11280
accatgggat cggccattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg 11340
gagaggctat tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg 11400
ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc 11460
ctgaatgaac tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct 11520
tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa 11580
gtgccggggc aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg 11640
gctgatgcaa tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa 11700
gcgaaacatc gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat 11760
gatctggacg aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg 11820
cgcatgcccg acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc 11880
atggtggaaa atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac 11940
cgctatcagg acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg 12000
gctgaccgct tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc 12060
tatcgccttc ttgacgagtt cttctgaggg gatcaattct ctagagctcg ctgatcagcc 12120
tcgactgtgc cttctagttg ccagccatct gttgtttgcc cctcccccgt gccttccttg 12180
accctggaag gtgccactcc cactgtcctt tcctaataaa atgaggaaat tgcatcgcat 12240
tgtctgagta ggtgtcattc tattctgggg ggtggggtgg ggcaggacag caagggggag 12300
gattgggaag acaatagcag gcatgctggg gatgcggtgg gctctatggc ttctgaggcg 12360
gaaagaacca gctggggctc gactagagct tgcggaaccc ttaatataac ttcgtataat 12420
gtatgctata cgaagttatg aattcgagct ccgtcgacag atgcagacac cccagcccca 12480
ttattaaatc aacctgagcc acatgttatc taaaggaact gattcacaac tttctcagag 12540
atgaatattg ataactaaac ttcatttcag tttactttgt tatgccttaa tattctgtgt 12600
cttttgcaat taaattgtca gtcacttctt caaaacctta cagtccttcc taagttactc 12660
ttcatgagat ttcatccatt tactaatact gtatttttgg tggactaggc ttgcctatgt 12720
gcttatgtgt agctttttac tttttatggt gctgattaat ggtgatcaag gtaggaaaag 12780
ttgctgttct attttctgaa ctctttctat actttaagat actctatttt taaaacacta 12840
tctgcaaact caggacactt taacagggca gaatactcta aaaacttgat aaaattaaat 12900
atagatttaa tttatgaacc ttccatcatg atgtttgtgt attgcttctt tttggatcct 12960
cattctcacc catttggcta atccaggaat attgttatcc cttcccatta tattgaagtt 13020
gagaaatgtg acagaggcat ttagagtatg gacttttctt ttctttttct ttttcttttt 13080
ttctttttga gatggagtca cactctccag gctggagtgc agtggcacaa tctcggctca 13140
ctgcaatttc cgtctcccaa gttcaagcga ttctcctgct ttagactatg gatttcttta 13200
aggaatactg gtttgcagtt ttgttttctg gactatatca gcagatggta gacagtgttt 13260
atgtagatgt gttgttgttt ttatcattgg attttaactt ggcccgagtg aaataatcag 13320
atttttgtca ttcacactct cccccagttt tggaataact tggaagtaag gttcattccc 13380
ttaagacgat ggattctgtt gaactatggg gtcccacact gcactattaa ttccacccac 13440
tgtaagggca aggacaccat tccttctaca tataagaaaa aagtctctcc ccaagggcag 13500
cctttgttac ttttaaatat tttctgttat tacaagtgct ctaattgtga acttttaaat 13560
aaaatactat taagaggtaa tgcagttgaa tctggtttta ttttatgttg ctgtacaaaa 13620
atcagtttac ttctatgata aaatagggtt ttgggccagg attgcattgc ttatttattt 13680
tttccatgca aacccatata gggatgagaa aattaatgtt aaaaataagt tttagctgtc 13740
acatttttca ttttttcttg tccctccctt gcttttaagt ctcatcataa cattatgtgg 13800
ttatatggct ataaaccatc tttgatctgg atcctttcta atgtataact acaaccacaa 13860
actgattaaa gattgccaca aatatatagt aaactttcaa acaaatgtct tgcataactc 13920
agaaaagtaa cttaacccaa tcagaggctg accagcattg tctgatggaa atagtgccaa 13980
tgagcacact gatgccatat ccccaattta ccaccgaaac tatggctttg tgaaggtcct 14040
aagataatta tgctataaca gcttttattt cttccttgtt acctcacagt caattgatta 14100
ccactttgta tagctctaga cgaatgctta aagtaattca tcttctctcc ccctcacttc 14160
cttgttcttc ctgtggtcaa gactttcatt acttcttccc tgtaatcttt tttttttttt 14220
tttttttttt ttgagacgga gttttgctct tgtcacccag gctggagtgc agtggcgcga 14280
tctcagctca ctgcaacctc catctcctgg gttccagcga ttctcctgcc tcagcctcct 14340
gagtagctga gattacaggt gcccgccaac aagcctggct aatattttgt atttttagta 14400
gagacggggt ttcgccatgt tgggcaggct ggtcccctat aatcatataa ttatgtaatc 14460
cctgatcact ttgattcatt cacctgaaaa tatttaatga gtttcttcca tgtttcatgt 14520
agaatatatc acaatctctc ctactattat tctagcatgt ttctgttaca tatcaccagc 14580
accacaacca ccatcaccat aataattaac attatggagt ccatactatt tttcaggcat 14640
ttgtaagtac tttacatgag ttaacctagt taatccacaa aatatccctg tgagtaggtg 14700
ctgttatctc catactataa ataagaaaac ttaggcatac caaagttaag taaaagcttc 14760
gagcaccacc accaccacca ctgagatccg gctgctaaca aagcccgaaa ggaagctgag 14820
ttggctgctg ccaccgctga gcaataacta gcataacccc ttggggcctc taaacgggtc 14880
ttgaggggtt ttttgctgaa aggaggaact atatccggat 14920
Claims (10)
- The construction method of 1.CPS1 reporter gene human liver cells system, comprises the following steps:1) the skeleton carrier sgCPS1 for single-stranded guide RNA (sgRNA) coded sequence for carrying targeting CPS1 genes is built;2) the targeting vector CPSLR-2A-tdTomato of CPS1 genes is built;3) skeleton carrier sgCPS1 and targeting vector CPSLR-2A-tdTomato are transfected into human liver cell system, obtained through screening The tdTomato that must stablize marks CPS1 CPS1-tdTomato speaker's hepatic cell line.
- 2. the construction method of CPS1 reporter genes human liver cell system according to claim 1, it is characterised in that:The step 1) being used to build skeleton carrier sgCPS1 tool carrier in includes px458, px330, px461 and px333, preferably pX458.
- 3. construction method according to claim 2, it is characterised in that:Taken by the vector construction that sets out of tool carrier pX458 The skeleton carrier of single-stranded guide RNA (sgRNA) with CPS1 genes, comprises the following steps:1.1) design targeting CPS1 genes (No. GenBank:1373) sgRNA, CPS1 bases are obtained according to CPS1 sgRNA sequences The target sequence AGCTGTGCAGAAATCTCGCA (being located at CPS1 genes from 5 ' end 4759-4778 bit bases) of cause, according to The target sequence of CPS1 genes obtains CPS1 sgRNA coded sequences, and Bbs I enzymes are added at CPS1 sgRNA coded sequences two ends Sequence is cut, final oligonucleotide sequence of the acquisition comprising CPS1 sgRNA coded sequences is as follows:oligo1:5’-CACCAGCTGTGCAGAAATCTCGCA-3 ' (band underscore base is Bbs I cleavage sequences),oligo2:5’-TTTGACGCTCTAAAGACGTGTCGA-3 ' (band underscore base is Bbs I cleavage sequences);1.2) the oligonucleotides oligo1 and oligo2 comprising CPS1 sgRNA coded sequences of synthesis anneal and phosphoric acid Change;1.3) tool carrier pX458 is subjected to digestion with BbsI, reclaims, purifies digestion tool carrier pX458;1.4) by anneal and phosphorylation the oligonucleotides oligo1 and oligo2 comprising CPS1 sgRNA coded sequences be connected into through In the tool carrier pX458 of digestion;1.5) connection product is converted into DH5 α competence bacteriums, is coated on Amp+Culture plate, (16-20 is small for 37 DEG C of overnight incubations When);1.6) recombinant plasmid is extracted from the monoclonal bacterium grown, obtains carrying the restructuring bone of CPS1 sgRNA coded sequences Frame carrier, is named as pX458-sgCPS1, and its nucleotide sequence is as shown in sequence 1 in sequence table.
- 4. the construction method of the CPS1 reporter gene human liver cells system according to claim 1 or 2 or 3, it is characterised in that:Institute State step 2) in be used for the carrier that sets out for building CPS1 gene targeting carriers for the prokaryotic expression carrier comprising tdTomato, including But it is not limited to pET-tdTomato, pQE-tdTomato, pUC-tdTomato etc., preferably pET32-tdTomato.
- 5. construction method according to claim 4, it is characterised in that:Using pET32-tdTomato as the vector construction that sets out CPS1 gene targeting carriers, comprise the following steps:2.1) the left arm Insert Fragment (CPSL) and right arm Insert Fragment (CPSR) of CPS1 genes, left arm Insert Fragment are obtained (CPSL) nucleotide sequence is as shown in sequence 2 in sequence table, the nucleotide sequence such as sequence table of right arm Insert Fragment (CPSR) Shown in middle sequence 3;2.2) double digestion is carried out to left arm Insert Fragment (CPSL) and pET32-tdTomato carriers with Kpn I and EcoR V, will Two kinds of double digestion products are attached, and connection product is converted into DH5 α competence bacteriums, Amp is coated on+LB culture plates, 37 DEG C It is incubated overnight (16-20 hours), selects monoclonal growth bacterium and extract recombinant plasmid, obtain carrying left arm Insert Fragment (CPSL) Recombinant vector, be named as pET32-CPSL-tdTomato;2.3) right arm Insert Fragment (CPSR) and pET32-CPSL-tdTomato carriers are carried out with Hind III and Sal I double Digestion, two kinds of double digestion products are attached, and connection product is converted into DH5 α competence bacteriums, Amp is coated on+LB cultures are flat Plate, 37 DEG C are incubated overnight (16-20 hours), select monoclonal growth bacterium and extract recombinant plasmid, obtain carrying left arm insertion piece The recombinant vector of section (CPSL) and right arm Insert Fragment (CPSR), is named as pET32-CPSLR-tdTomato, its nucleotides sequence Row are as shown in sequence 4 in sequence table.
- 6. the construction method of the CPS1 reporter gene human liver cells system according to any one of claim 1 to 53, its feature exists In:The step 3) in the human liver cell system of transfection be for immortal human normal liver cell system or human liver tumor cell, wherein, institute State immortal human normal liver cell system and may be selected from following any cell lines:CRL-11233、OUMS-29/TK、HepLL、cBAL、 LO2;Preferably HepG2 cell lines or LO2 cell lines.
- 7. according to the construction method of any described CPS1 reporter gene human liver cells systems of claim 1-6, it is characterised in that:Institute State step 3) in cell transfecting and screening technique be:By skeleton carrier sgCPS1 plasmids and targeting vector CPSLR-2A- TdTomato plasmids press 1:3 ratios (mass ratio) are mixed, and every 106Human liver cell system cell is mixed with 2 μ g mixing plasmids, 1050V 30 pulse shock by electricity twice, cell are resuspended in DMEM in high glucose culture mediums of the 2mL comprising 10% (V/V) hyclone, 24 is small When after add 200 μ g/mL G418 (Geneticin, Geneticin) and screened, after 15 days, obtain G418 resistance clones, carry Its genomic DNA is taken, with tdtomato primer (sequences:5 '-GAAGATCTTTGTGTGAATCTTCAGGAATA-3 ' and 5 '- CCATGTTGTTGTCCTCGGAGGA-3 ') enter performing PCR amplification and pcr amplification product is sequenced, obtain CPS1- Tdtomato human liver cells system reporter cell.
- 8. the CPS1-tdTomato human liver cells system reporter cell obtained with claim 7 methods described.
- 9. CPS1-tdTomato human liver cells system reporter cell, is that deposit number is CGMCC according to claim 8 No.13810, the CPS1-tdtomato report HepG2 cells of entitled HepG2-CPS-tdTomato (HCT), or deposit number For CGMCC No.13811, the CPS1-tdtomato report LO2 cells of entitled LO2-CPS-tdTomato (LCT).
- 10. the CPS1 reporter gene human liver cells described in claim 8 or 9 tie up to drug metabolism study, drug toxicity evaluation or Application in drug screening.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710157350.2A CN106947740A (en) | 2017-03-16 | 2017-03-16 | CPS1 reporter gene human liver cell systems and its construction method and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710157350.2A CN106947740A (en) | 2017-03-16 | 2017-03-16 | CPS1 reporter gene human liver cell systems and its construction method and application |
Publications (1)
Publication Number | Publication Date |
---|---|
CN106947740A true CN106947740A (en) | 2017-07-14 |
Family
ID=59473409
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710157350.2A Pending CN106947740A (en) | 2017-03-16 | 2017-03-16 | CPS1 reporter gene human liver cell systems and its construction method and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106947740A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111850015A (en) * | 2020-06-03 | 2020-10-30 | 武汉仝干医疗科技股份有限公司 | Cell stress resistance gene fragment and modified HepG2 cell |
-
2017
- 2017-03-16 CN CN201710157350.2A patent/CN106947740A/en active Pending
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111850015A (en) * | 2020-06-03 | 2020-10-30 | 武汉仝干医疗科技股份有限公司 | Cell stress resistance gene fragment and modified HepG2 cell |
CN111850015B (en) * | 2020-06-03 | 2022-07-05 | 武汉仝干医疗科技股份有限公司 | Cell stress resistance gene fragment and modified HepG2 cell |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106636198A (en) | Site-directed knock-in plasmid vector for porcine mammary gland-specific high-expression lactoferrin gene and application thereof | |
CN102719471B (en) | Integrative plasmid pOPHI and resistance screening marker-free self-luminescent mycobacterium | |
CN111041038B (en) | Synechocystis 6803 genetic engineering bacterium for efficiently biologically synthesizing astaxanthin and construction method and application thereof | |
CN106947740A (en) | CPS1 reporter gene human liver cell systems and its construction method and application | |
CN108660156A (en) | CPS1 reporter genes stem cell and its construction method and application | |
CN112501139B (en) | Recombinant Newcastle disease virus strain and preparation method and application thereof | |
CN115247173A (en) | Gene editing system for constructing TMPRSS6 gene mutant iron deficiency anemia pig nuclear transplantation donor cells and application thereof | |
CN104328136B (en) | The preparation of Newcastle disease poison strain rClone30 fliC and its application in Newcastle disease prevention | |
CN108949690B (en) | A method of prepare can real-time detection mescenchymal stem cell bone differentiation cell model | |
CN115161335B (en) | Gene editing system for constructing ALS model pig nuclear transfer donor cells with TARDBP gene mutation and application of gene editing system | |
CN109628487A (en) | A method of growth factor of human nerve is prepared using transgene pig salivary gland | |
CN104357409A (en) | Recombinant Newcastle disease virus for expressing chicken IL2 and application of virus in vaccines | |
CN111748034A (en) | Preparation method of mycoplasma synoviae monoclonal antibody | |
CN103352042B (en) | The cDNA of coding recombinant Newcastle disease virus, the virus of being saved by this cDNA and the application in treatment malignant tumour thereof | |
CN115247153A (en) | Gene editing system for constructing diabetes model pig nuclear transplantation donor cells with HNF1A gene mutation and application thereof | |
CN115247164A (en) | Gene editing system for constructing adenomatous polyposis model pig and colorectal cancer model pig and application thereof | |
CN113234746B (en) | Method for pesticide induced protein interaction and induced gene expression | |
CN115232812A (en) | Method for constructing nuclear transplantation donor cells of MRAP2 gene mutation severe early obesity model pigs | |
CN115247175A (en) | Gene editing system for constructing epigenetic dysregulation model pig nuclear transplantation donor cell of SETDB1 gene mutation and application thereof | |
KR100902634B1 (en) | Nucleic acid delivery complex comprising recombinant hmgb-1 peptide | |
CN115232818A (en) | Gene editing system for constructing congenital myasthenia model pig nuclear transplantation donor cells with DOK7 gene mutation and application thereof | |
CN115232817A (en) | Gene editing system for constructing three-gene combined mutant miniature pig nuclear transplantation donor cells and application thereof | |
CN115232811A (en) | Method for constructing HBB gene mutant sickle cell anemia model pig nuclear transplantation donor cell and application | |
CN115247163A (en) | Gene editing system for constructing stomach cancer model pig nuclear transplantation donor cell with GP130 gene mutation and application thereof | |
CN115247191A (en) | Gene editing system and application thereof in construction of double-gene-mutation nevus basal cell carcinoma syndrome pig nuclear transplantation donor cell |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170714 |