CN106916223A - Anti-human PIAS3 high-titer antibodies and application are prepared using GST expression systems - Google Patents
Anti-human PIAS3 high-titer antibodies and application are prepared using GST expression systems Download PDFInfo
- Publication number
- CN106916223A CN106916223A CN201710315449.0A CN201710315449A CN106916223A CN 106916223 A CN106916223 A CN 106916223A CN 201710315449 A CN201710315449 A CN 201710315449A CN 106916223 A CN106916223 A CN 106916223A
- Authority
- CN
- China
- Prior art keywords
- pias3
- exon2
- antibody
- gst
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/06—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies from serum
- C07K16/065—Purification, fragmentation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/23—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a GST-tag
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention belongs to technical field of bioengineering, relate to the use of the 121aa high-titer antibodies of anti-PIAS3 87 and the application of GST expression systems preparation.Using technique for gene engineering, the 121aa of PIAS3 87 are cloned into prokaryotic expression carrier, after being identified through digestion, use recombinant plasmid transformed Escherichia coli, and IPTG inductions produce GST PIAS3 35aa fusion proteins.Prepare antiserum and purified with ProteinA/G with the fusion protein immunization new zealand rabbit for purifying.The potency and specificity of antibody are using ELISA and Western blot detections, and the method for application SABC, it is located in the cytoplasm of prostate epithelial cell using the PIAS3 albumen of the antibody test to 68KD total lengths and is expressed, and in cancerous tissue expression deletion, this for disclose PIAS3 albumen functional meaning it is great.
Description
Technical field
The invention belongs to the DNA recombinant techniques field in bioengineering, and in particular to prepared using GST prokaryotic expression systems
The polyclonal antibody of GST-PIAS3 87-121aa (amino acid) fusion protein and application.
Background technology
PIAS3 is the suppression albumen of signal transduction and activating transcription factor 3 (STAT3), can be special with activation
STAT3 is combined and then is prevented STAT3 from being combined with DNA.HPIAS3 total lengths are positioned on No. 1 chromosome 1q21 of the mankind, comprising 14
Individual extron.
PIAS3 has necessarily in human normal tissues' wide expression for the current result of study of expressing in cancerous tissue
Controversial.To from human body brain, mammary gland, kidney, lung, prostate, skin, liver, oesophagus, stomach and Colon and rectum 10 positions
103 researchs discoveries of malignant tumour sample, compared with normal structure, in 100 wherein, PIAS3 albumen (about 97%) all
There is the expression high that degree is different.And the research of other experimental group shows PIAS3 in stomach cancer, lung cancer, melanoma, oophoroma
Expression is reduced or lacked with the cancer such as carcinoma of endometrium.Whether this controversial is due to different montage type PIAS3 albumen
The result of detection, is worth further investigation.Antibody is most one of the powerful in protein detection and functional study, and we prepare
The high-titer antibody for PIAS3 Exon2 specifically expressing peptide fragments for system research 68KD PIAS3 full-length proteins various
Expression and mechanism of action in tissue and cell have very great meaning.In addition, research shows that PIAS3 albumen can be induced
Prostate cancer apoptosis, is prostate cancer cancer suppressor protein, and the antibody that we prepare is established for the research of the potential molecular mechanisms of PIAS3
Basis.
The content of the invention
The purpose of the present invention is to set up a kind of mould of the detection that can be used in and express the PIAS3 special peptide fragment albumen of Exon2
Type, to provide necessary experimental tool from protein level further investigation PIAS3 functions and relevant disease.
Using technique for gene engineering, by PIAS3 Exon2 specifically expressing peptide fragment 87-121 amino acids (35aa) corresponding DNA
Fragment is cloned into prokaryotic expression carrier pGEX-4T-1.After through digestion and sequence analysis, recombinant plasmid transformed Escherichia coli are used
BL21, and produce GST-PIAS3 Exon2 35aa fusion proteins through isopropyl-β-D-thiogalactoside (IPTG) induction.With
The fusion protein immunization new zealand rabbit of purifying prepares antiserum, and is purified using ProteinA/G, obtains polyclonal antibody.
The potency and specificity of antibody have detected using ELISA and Western blot detections using Western blotting and SABC
Expression of the PIAS3 albumen in prostate gland cancer cell and prostate cancer tissue and positioning.
GST-PIAS3 Exon2 35aa fusion proteins of the invention are by using special sequence, (PIAS3 Exon2 are special
Expression peptide fragment 87-121 amino acids corresponding DNAs fragment) build GST-PIAS3 Exon2 35aa fusion protein prokaryotic expressions load
Body, the specific GST-PIAS3 Exon2 35aa fusion proteins of high efficient expression that conversion BL21 is obtained, this section of 87-121 ammonia
Base acid sequence is：
Its correspondence nucleotides sequence is classified as：
This GST-PIAS3 Exon2 35aa fusion proteins and its polyclonal antibody are prepared and comprised the following steps：
The first step, the structure of cloning vector
With people PIAS3 cDNA as template, using round pcr, the purpose fragment that amplification is obtained is connected with pMD18-T carriers,
After the steps such as inverted, extraction obtain recombinant plasmid, digestion is identified and is sequenced.
Second step, the structure of prokaryotic expression carrier pGEX-4T-1
After by cloned plasmids and plasmid pGEX-4T-1 double digestions, using QIAquick Gel Extraction Kit acquisition PIAS3 genes area's fragment
Connected with carrier.The steps such as inverted, extraction obtain the expression vector of restructuring.Recombinant is identified in digestion, and is sequenced further
It is determined that.
3rd step, the expression and purity of GST-PIAS3 Exon2 35aa fusion proteins
Recombinant plasmid PGEX-4T-1/PIAS3 Exon2 35aa convert e. coli bl21, are induced using IPTG, GST-
The expression of PIAS3 Exon2 35aa fusion proteins.Identified with SDS-PAGE, and Optimal Expression condition, largely expanded
Induction.Ultrasonic degradation bacterium is used, the purifying of albumen Glutathione-Sepharose 4B posts, SDS-PAGE purification Identifications is obtained
Product.
4th step, the rabbit-anti sero-fast preparations of PIAS3 Exon2 35aa and purifying
With the PIAS3 Exon2 35aa fusion protein immunization Male New Zealand White Rabbits for purifying, initial immunity is with 300 μ g
Fusion protein, the emulsification subcutaneous multi-point injection of back part is fully mixed with isometric complete Freund's adjuvant.Ear vein is taken before immune
Blood system from serum, as the serum control before immune.The 1st booster immunization, the GST-PIAS3 of 300 μ g purifying are carried out after 2 weeks
Exon2 35aa fusion proteins are mixed in equal volume with incomplete Freund's adjuvant, front and rear four soles intramuscular injection.Added every 2 weeks afterwards
It is strong immune 1 time.Ear blood was taken in 1 week after final immunization, the potency of antibody is determined with ELISA method, when antibody titer reaches 1:
When 100000, serum is collected in arteria carotis bloodletting.Purify anti-PIAS3 Exon2 35aa serum with ProteinA/G, prepare albumin A
Sepharose CL-4B affinity columns, affinity chromatography makes antibody combine on pillar, after being washed through 2 times, antibody elution reaches
Purifying purpose, SDS-PAGE purification Identification products obtain the polyclonal antibody of the invention.It is detected using panimmunity method
Potency and specificity, as a result show that the antibody can specific and PIAS3 protein bindings.
GST-PIAS3 Exon2 are successfully built using PIAS3 Exon2 specifically expressing peptide fragments albumen correspondence gene order
35aa fusion protein prokaryotic expression carriers, can the specific GST-PIAS3 Exon2 35aa fusions of high efficient expression after conversion BL21
Albumen.The high-titer antibody of anti-GST-PIAS3 Exon2 35aa fusion proteins is obtained through various with the fusion protein immunization rabbit
Immunological method detection antibody potency and specificity, as a result show that antibody titer is up to 1: 1 000 000, and specificity is good.
Antibody can be applied to the detection of PIAS3 albumen, for system research 68KD PIAS3 full-length proteins in various tissues and cell
Expression and mechanism of action have very great meaning.In addition, PIAS3 albumen can induce prostate cancer apoptosis, it is prostatitis
Gland cancer cancer suppressor protein, the antibody that we prepare is laid a good foundation for the research of potential mechanism.
Brief description of the drawings：
Fig. 1：The PIAS3 gene 87-121 amino acid tablet segment DNA agarose gel electrophoresis figures that PCR is amplified；
Fig. 2：Double digestion plasmid pGEX-4T-1；
Fig. 3：PGEX-4T-1/PIAS3 Exon2 35aa recombinant digestion qualification results；
Fig. 4：GST and GST-PIAS3 Exon2 35aa fusion protein Ss DS-PAGE figures after purification；
Fig. 5：ProteinA/G PIAS3 Exon2 35aa antibody after purification and anti-PIAS3 Exon2 before purification
35aa serum SDS-PAGE schemes；
Fig. 6：Indirect elisa method determines the potency of antibody；
Fig. 7：The Western blot analyses of PIAS3 Exon2 35aa antibody specificities；
Fig. 8：SABC detects expression of the PIAS3 in prostate and prostate cancer tissue；
Specific embodiment：
Embodiment 1：Anti- GST-PIAS3 Exon2 35aa serum prepare
The structure of 1.PCR-pMD18-T/PIAS3 Exon2 35aa recombinant plasmids
PIAS3 mRNA total lengths are obtained from Genebank, and gene order number is GenBank:NM_006099.PIAS3 mRNA
Sequence is obtained from Genebank, and gene order number is NM_006099.With cDNA as template, sense primer is 5 '-
GAATTCGTAGGCTCCCCTGGTCCTCTAGCTCCCATTCCCCCAACGCTGTTGGCCCC TGGCACCCTGC (enzymes containing EcoRI
Enzyme site)；Downstream：5 '-CTCGAGTCACTGGGGCAGAGGGGG (restriction enzyme site containing XhoI), go out using PCR Successful amplifications
PIAS3 Exon2 87-121 amino acid corresponding DNA sequence lengths 105bp【Fig. 1】.The fragment that amplification is obtained and pMD18-T carriers
Connection, connection product is transferred in competence bacillus coli DH 5 alpha, containing Amp+Selected clone on agar plate, with alkaline lysis
It is small carry recombinant plasmid after, with EcoRI and SalI single endonuclease digestions identify.
2. the structure of prokaryotic expression carrier pGEX-4T-1
Will containing the pMD18-T plasmids of PIAS3 Exon2 specifically expressing peptide fragments albumen correspondence gene order through EcoRI and
After XhoI double digestions (fragment 105bp), PIAS3 genes area's fragments is obtained using QIAquick Gel Extraction Kit, while with identical enzyme
Reason plasmid pGEX-4T-1 (about 5kbp)【Fig. 2】.Then the PIAS3 Exon2 specifically expressing peptide fragments albumen correspondence gene that will be reclaimed
Sequence fragment and through digestion vector pGEX -4T-1 T4DNA connection enzyme effect under in 16 DEG C connection overnight.Digestion identification restructuring
Body, as a result shows that PIAS3 Exon2 specifically expressing peptide fragments albumen correspondence gene order is correct【Fig. 3】.
The expression and purity of 3.GST-PIAS3 Exon2 35aa fusion proteins
Recombinant plasmid PGEX-4T-1/PIAS3 Exon2 35aa convert e. coli bl21, and picking single bacterium colony accesses LB/
Amp+In culture medium, 37 DEG C of shaking overnight incubations.Next day, culture is transferred in containing Amp in 1: 50 ratio+LB culture mediums
In, continue in 37 DEG C of shaking table cultures to mid log phase.When the A600 of nutrient solution is 0.5~0.6, add IPTG dense to end
It is 0.08mmol/L to spend, and is added without IPTG person for negative control, puts 25 DEG C and continues to cultivate 4~5h.Thalline is collected by centrifugation, with SDS-
PAGE identify the expression of GST-PIAS3 Exon2 35aa fusion proteins, and Optimal Expression condition, carries out a large amount of amplifications and lures
Lead.5mins, collects thalline, with the precipitation of the NETN suspension 1L bacterium solutions of 60mL ice precoolings are centrifuged in 4 DEG C with 5000r/min.With super
Sound cracks bacterium, then with 9600rpm, 15min is centrifuged in 4 DEG C, takes supernatant, crosses Glutathione-Sepharose4B posts, first with
Isometric elution buffer 1 (glutathione containing 20mM, 50mM Tris-Cl, pH=8.0) wash-out, collection eluent, then with etc.
Volume elution buffer 2 (glutathione containing 100mM) is washed twice, collects eluent, SDS-PAGE purification Identification products【Fig. 4】.
4. the sero-fast preparations of rabbit-anti PIAS3 Exon2 35aa
With the GST-PIAS3 Exon2 35aa fusion protein immunization Male New Zealand White Rabbits for purifying, initial immunity is used
300 μ g fusion proteins, the emulsification subcutaneous multi-point injection of back part is fully mixed with isometric complete Freund's adjuvant.Ear is taken before immune
Venous blood separates serum, used as the serum control before being immunized.The 1st booster immunization, the GST- of 300 μ g purifying are carried out after 2wk
PIAS3 Exon2 35aa fusion proteins are mixed in equal volume with incomplete Freund's adjuvant, front and rear four soles intramuscular injection.It is every afterwards
Every 2wk booster immunizations 1 time.Ear blood is taken in 1wk after final immunization, the potency of antibody is determined with ELISA method, when antibody titer reaches
When 1: 1 000 000, serum is collected in arteria carotis bloodletting.
5.ProteinA/G purifies anti-PIAS3 Exon2 35aa serum
ProteinA/G sepharose CL-4B fillers are slowly filled into post, the anti-blood by dilution is added after balance pillar
Clearly, coutroi velocity ensures that the combination of antiserum and filler, i.e. affinity chromatography make antibody combine on pillar, after being washed through 2 times, plus
Antibody elution is collected eluent and determines the 280nm optical density of each collecting pipe by pH2.7 elution buffers solution, will contain antibody
Collecting pipe mixes, and antibody after purification is identified with antiserum before purification with SDS-PAGE and coomassie brilliant blue staining.Dyeing knot
Substantially, sample after purification has clearly light and heavy chain band to fruit display purification effect【Fig. 5】.
Embodiment 2:The analysis and application of GST-PIAS3 Exon2 35aa antibody
The measure of 1.GST-PIAS3 Exon2 35aa antibody titers
With the new zealand white rabbit serum before GST-PIAS3 Exon2 35aa fusion protein immunizations as control, will purify
GST-PIAS3 Exon2 35aa antibody afterwards first dilutes 10 times again after doubling dilution, and the potency of antibody is determined with indirect ELISA.
Result shows that the rabbit anteserum before being immunized does not measure the antibody of anti-fusion protein GST-PIAS3 Exon2 35aa, GST-PIAS3
The titre of Exon2 35aa antibody is up to 1: 1 000 more than 000【Fig. 6】.
2.GST-PIAS3 Exon2 35aa antibody is applied to the detection of PIAS3 Exon2 35aa albumen in tissue
LNCaP and DU145 cells are collected, protein quantification is carried out to it with BCA protein quantifications kit after cracking ultrasound, it
Sample is carried out on SDS-PAGE, then electrotransfer to nitrocellulose filter by differential protein amount afterwards.Closed with 5% skimmed milk power
1h, rabbit-anti PIAS3 Exon2 35aa antibody (room temperature 2h, PBS wash 3 times) and goat anti-rabbit igg 2HRP are added dropwise successively, and (room temperature is anti-
1h, PBS is answered to wash 3 times), finally add substrate DAB colour developings, and take pictures.Result shows【Fig. 7】, the PIAS3 Deta that we prepare
Antibody there occurs antigen-antibody reaction and occurs at the 68KD that Marker is indicated with the PIAS3 albumen expressed by LNCaP cells
One special protein band, it was demonstrated that PIAS3 Exon2 35aa antibody specificities are good.
3. prostata tissue PIAS3 albumen positioning analysis
After human prostata cancer puncturing tissue is cut into slices through pH8.0 EDTA hot repairs again, PBS is washed three times, each 5mins, is added dropwise
PBS (control group) or rabbit-anti PIAS3 Exon2 35aa antibody at room temperature 1h, PBS are washed 3 times；Secondary antibody is added dropwise, 30mins is incubated at room temperature,
PBS is washed three times, each 5mins；DAB is dyeed, and room temperature dyeing 3mins, running water terminates dyeing；Haematoxylin redyeing, dehydration, mounting
And take pictures.Result shows【Fig. 8】, PIAS3 is specific to be expressed in prostate epithelial cell, and in expression in prostate cancer
Missing.
<110>Northeast Normal University
<120>Anti-human PIAS3 high-titer antibodies and application are prepared using GST expression systems
<160>2
<210>1
<211>105
<212>DNA
<213>People（Homo sapiens）
<400>1
1 gtaggctccc ctggtcctct agctcccatt cccccaacgc tgttggcccc tggcaccctg
61 ctgggcccca agcgtgaggt ggacatgcac ccccctctgc cccag
<210>2
<211>35
<212>PRT
<213>People（Homo sapiens）
<400>2
Val Gly Ser Pro Gly Pro Leu Ala Pro Ile Pro Pro Thr Leu Leu
1 6 11
Ala Pro Gly Thr Leu Leu Gly Pro Lys Arg Glu Val Asp Met His
16 21 26
Pro Pro Leu Pro Gln
31
Claims (2)
1. the anti-human PIAS3 Exon2 35aa high-titer antibodies for being prepared using GST expression systems, it is characterised in that utilize GST tables
Up to system using people's PIAS3 87-121 amino acids corresponding DNA fragments as distinguished sequence, the GST-PIAS3 Exon2 of preparation
35aa fusion proteins produce antiserum and obtain, anti-GST-PIAS3 in the antiserum as antigen immune new zealand rabbit
The titre of Exon2 35aa antibody is up to 1: 1000000, and identifies the anti-PIAS3 Exon2 35aa by Western blot
Antibody has preferably specificity, wherein, 87-121 amino acids sequences are：
Its correspondence nucleotides sequence is classified as：
1 gtaggctccc ctggtcctct agctcccatt cccccaacgc tgttggcccc tggcaccctg
61 ctgggcccca agcgtgaggt ggacatgcac ccccctctgc cccag。
2. the preparation of the polyclonal antibody of prokaryotic expression GST-PIAS3 Exon2 35aa fusion proteins as claimed in claim 1
Method, it is characterised in that obtain GST-PIAS3 Exon2 35aa fusion proteins using GST expression systems, then through immune New Zealand
Rabbit obtains anti-GST-PIAS3 Exon2 35aa antiserums, specifically includes five steps：
The first step, the structure of PCR-pMD18-T/PIAS3 Exon2 35aa recombinant plasmids
PIAS3mRNA sequences are obtained from Genebank, and gene order number is NM_006099.With cDNA as template, sense primer：
5 '-GAATTCGTAGGCTCCCCTGGTCCTCTAGCTCCCATTCCCCCAACGCTGTTGGCCCC TGGCACCCTGC (contain
EcoRI restriction enzyme sites)；Downstream：5 '-CTCGAGTCACTGGGGCAGAGGGGG (restriction enzyme site containing XhoI), the piece that amplification is obtained
Section is connected with pMD18-T carriers, connection product is transferred in competence bacillus coli DH 5 alpha, containing Amp+Selected on agar plate
Clone, after carrying recombinant plasmid so that alkaline lysis is small, is identified with EcoRI and SalI single endonuclease digestions；
Second step, the structure of prokaryotic expression carrier pGEX-4T-1
By containing the exon 87-121 amino acid of PIAS3 genes 2 to cDNA fragments pMD18-T plasmids through EcoRI and
After XhoI double digestions, PIAS3 genes area's fragments is obtained using QIAquick Gel Extraction Kit, while with identical ferment treatment plasmid pGEX-
4T-1, then by the corresponding nucleotide fragments of the exon 87-121 amino acid of PIAS3 genes 2 for reclaiming and the carrier through digestion
PGEX-4T-1 is connected overnight under the effect of T4 DNA ligases in 16 DEG C, digestion identification recombinant, and sequencing is further really
It is fixed；
3rd step, the expression and purity of GST-PIAS3 Exon2 35aa fusion proteins
Recombinant plasmid PGEX-4T-1/PIAS3 Exon2 35aa convert e. coli bl21, and picking single bacterium colony accesses LB/Amp+Training
Support in base, 37 DEG C shake overnight incubations.Next day, culture is transferred in containing Amp in 1: 50 ratio+LB culture mediums in, after
Continue in 37 DEG C of shaking table cultures to mid log phase.When the A600 of nutrient solution is 0.5~0.6, IPTG is added to final concentration of
0.08mmol/L, is added without IPTG person for negative control, puts 25 DEG C and continues to cultivate 4~5h.Thalline is collected by centrifugation, with SDS-PAGE
Identify the expression of GST-PIAS3 Exon2 35aa fusion proteins, and Optimal Expression condition, carry out a large amount of amplification inductions.With
5000r/min is centrifuged 5min, collects thalline, with the precipitation of the NETN suspension 1L bacterium solutions of 60mL ice precoolings in 4 DEG C.Use ultrasonic degradation
Bacterium, then with 9600rpm, 15min are centrifuged in 4 DEG C, supernatant, excessively Glutathione-Sepharose 4B posts are taken, it is first with grade body
Product elution buffer 1 (glutathione containing 20mM, 50mM Tris-Cl, pH=8.0) wash-out, collects eluent, then with isometric
Elution buffer 2 (glutathione containing 100mM) is washed twice, collects eluent, SDS-PAGE purification Identification products；
4th step, the rabbit-anti sero-fast preparations of PIAS3 Exon2 35aa and purifying
With the PIAS3 Exon2 35aa fusion protein immunization Male New Zealand White Rabbits for purifying, initial immunity is merged with 300 μ g
Albumen, the emulsification subcutaneous multi-point injection of back part is fully mixed with isometric complete Freund's adjuvant, and ear vein blood system is taken before being immunized
From serum, as the serum control before being immunized, the 1st booster immunization, the PIAS3 Exon2 of 300 μ g purifying are carried out after 2 weeks
35aa fusion proteins are mixed in equal volume with incomplete Freund's adjuvant, front and rear four soles intramuscular injection, afterwards every 2 weeks booster immunizations
1 time, in ear blood is taken behind after final immunization 1 week, the potency of antibody is determined with ELISA method, when antibody titer reaches 1: 1000000
When, serum is collected in arteria carotis bloodletting, and ProteinA/G sepharose CL-4B fillers are slowly filled into post, is added after balance pillar
Enter the antiserum by diluting, coutroi velocity ensures that the combination of antiserum and filler, i.e. affinity chromatography make antibody combine in pillar
On, after being washed through 2 times, plus pH2.7 elution buffers solution is by antibody elution, collects eluent and determines the 280nm of each collecting pipe
Optical density, the collecting pipe containing antibody is mixed, and antibody after purification is bright with SDS-PAGE and coomassie with antiserum before purification
Indigo plant dyeing identification；
5th step, the immunology detection of PIAS3 Exon2 35aa antibody
With the new zealand white rabbit serum before GST-PIAS3 Exon2 35aa fusion protein immunizations as control, by after purification
GST-PIAS3 Exon2 35aa antibody first dilutes 10 times of effects for determining antibody after doubling dilution using indirect ELISA method again
Valency, and using Western blot methods analysis PIAS3 Exon2 35aa antibody specificities, the fusion protein GST- that will be purified
PIAS3 Exon2 35aa samples, after being separated through SDS-PAGE again on electrotransfer to nitrocellulose filter, are sealed with 5% skimmed milk power
1h is closed, rabbit-anti PIAS3 Exon2 35aa antibody is added dropwise successively, room temperature 2h, PBS is washed 3 times, and goat anti-rabbit igg 2HRP, room temperature is anti-
Answer 1h, PBS to wash 3 times, finally add substrate DAB colour developings, and take pictures.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710315449.0A CN106916223A (en) | 2017-05-08 | 2017-05-08 | Anti-human PIAS3 high-titer antibodies and application are prepared using GST expression systems |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710315449.0A CN106916223A (en) | 2017-05-08 | 2017-05-08 | Anti-human PIAS3 high-titer antibodies and application are prepared using GST expression systems |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106916223A true CN106916223A (en) | 2017-07-04 |
Family
ID=59568048
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710315449.0A Pending CN106916223A (en) | 2017-05-08 | 2017-05-08 | Anti-human PIAS3 high-titer antibodies and application are prepared using GST expression systems |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106916223A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103114104A (en) * | 2013-02-05 | 2013-05-22 | 东北师范大学 | Anticancer peptide gene recombination and anticancer application thereof |
| CN103333244A (en) * | 2013-07-08 | 2013-10-02 | 东北师范大学 | hZimp10 N-terminal high titer antibody prepared by using GST expression system and applications thereof |
| CN105061595A (en) * | 2015-07-30 | 2015-11-18 | 东北师范大学 | MZF1-N terminal antibody prepared through GST expression system and applications thereof |
-
2017
- 2017-05-08 CN CN201710315449.0A patent/CN106916223A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103114104A (en) * | 2013-02-05 | 2013-05-22 | 东北师范大学 | Anticancer peptide gene recombination and anticancer application thereof |
| CN103333244A (en) * | 2013-07-08 | 2013-10-02 | 东北师范大学 | hZimp10 N-terminal high titer antibody prepared by using GST expression system and applications thereof |
| CN105061595A (en) * | 2015-07-30 | 2015-11-18 | 东北师范大学 | MZF1-N terminal antibody prepared through GST expression system and applications thereof |
Non-Patent Citations (2)
| Title |
|---|
| KO JH ET AL.: "NM_006099.3", 《GENBANK》 * |
| 何旺等: "PIAS3敲低对体外前列腺癌细胞增殖和凋亡的影响", 《基础医学与临床》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| BG60444B2 (en) | Method for the preparation of selected protein | |
| JPH0380081A (en) | Gene group of tumer-associated antigen | |
| CN102634486A (en) | GPC3 (glypican-3) monoclonal antibody hybridoma cell strain 7D11 and preparation method and application thereof | |
| CN111763256A (en) | Cloning of chicken CR2 gene, expression and purification of protein and preparation of polyclonal antibody thereof | |
| JPH04507044A (en) | Compositions for inhibition of protein hormone formation and methods of use thereof | |
| CN103333244B (en) | hZimp10 N-terminal high titer antibody prepared by using GST expression system and applications thereof | |
| CN102634487B (en) | GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof | |
| CN103146709A (en) | Yunnan red pear PybHLH gene as well as prokaryotic expression vector and application thereof | |
| CN105061595A (en) | MZF1-N terminal antibody prepared through GST expression system and applications thereof | |
| CN111705066B (en) | Genetically modified TIGIT protein, monoclonal antibody and application thereof | |
| CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
| CN106916223A (en) | Anti-human PIAS3 high-titer antibodies and application are prepared using GST expression systems | |
| CN114213543B (en) | Anti-canine pancreatic lipase specific single-chain antibody, plasmid vector and method | |
| CN102221615A (en) | Double-antibody sandwich ELISA method based on Angiogenin detection | |
| EP0042428A1 (en) | Purified human prostate antigen | |
| CN101275147B (en) | Expression vector and fused protein of human differential initiator 3 and preparation thereof | |
| CN103864939A (en) | mGM-CSF/beta hCG fusion protein, and preparation method and application thereof | |
| CN1994465B (en) | CCR5 autogenous polypeptide vaccine and preparation method thereof | |
| KR100206061B1 (en) | Ctaa 28a32 the antigen recognized by mca 28a32 | |
| JPH03504438A (en) | DNA-binding proteins including androgen receptors | |
| JP2698337B2 (en) | Anti-villin monoclonal antibody that can be used for in vitro detection of malignant cells of gastrointestinal origin | |
| CN112094853A (en) | White spot syndrome virus VP28 gene, recombinant protein, polyclonal antibody, preparation method and application | |
| CN104530211B (en) | A kind of tumor associated antigen MAGE-D4 restructuring truncated proteins and preparation method and applications | |
| CN104892758A (en) | AQP7 extracellular domain antibody prepared by using GST expression system, and application thereof | |
| CN111909949B (en) | Preparation method and application of recombinant protein HSP70_5 of Sporothrix globosum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170704 |
|
| RJ01 | Rejection of invention patent application after publication |