CN106892971A - A kind of corn is bloomed and Grain Development GAP-associated protein GAP, encoding gene and application - Google Patents

A kind of corn is bloomed and Grain Development GAP-associated protein GAP, encoding gene and application Download PDF

Info

Publication number
CN106892971A
CN106892971A CN201510953798.6A CN201510953798A CN106892971A CN 106892971 A CN106892971 A CN 106892971A CN 201510953798 A CN201510953798 A CN 201510953798A CN 106892971 A CN106892971 A CN 106892971A
Authority
CN
China
Prior art keywords
corn
gap
sequence
bloomed
grain development
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201510953798.6A
Other languages
Chinese (zh)
Other versions
CN106892971B (en
Inventor
卢运明
王磊
郑平
徐秒云
王维部
张兰
禹滨
范云六
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Nongke Group Co ltd
Biotechnology Research Institute of CAAS
Original Assignee
Shenzhen Nongke Group Co ltd
Biotechnology Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Nongke Group Co ltd, Biotechnology Research Institute of CAAS filed Critical Shenzhen Nongke Group Co ltd
Priority to CN201510953798.6A priority Critical patent/CN106892971B/en
Publication of CN106892971A publication Critical patent/CN106892971A/en
Application granted granted Critical
Publication of CN106892971B publication Critical patent/CN106892971B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physiology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Bloomed and Grain Development GAP-associated protein GAP, encoding gene and application the present invention relates to a kind of corn.It is following albumen a) or b) that the corn is bloomed with Grain Development GAP-associated protein GAP ZmNF-YA13：A) protein that the amino acid sequence shown in sequence in sequence table 2 is constituted；B) amino acid sequence of sequence 2 passes through substitution and/or missing and/or adds one or several amino acid and as a) derived from the protein related to blooming in sequence table.The corn is bloomed and cause corn flowering time to shift to an earlier date with the overexpression of Grain Development GAP-associated protein GAP ZmNF-YA13, encoding gene, seed increase, illustrates its regulation and control that take part in corn flowering time and Grain Development, has important application prospect in terms of plant breeding.

Description

A kind of corn is bloomed and Grain Development GAP-associated protein GAP, encoding gene and application
Technical field
The present invention relates to plant genetic engineering field, in particular, it is related to a kind of corn to bloom related to Grain Development Albumen ZmNF-YA13, encoding gene and application.
Background technology
Seed size high yield is always the main target of corn breeding.Grain yield be most important, most complicated proterties it One, it is by a series of final embodiment of physiological and biochemical procedures of the controlled by multiple genes that is mutually related.Maize grain yield is by unit Area strain number, single-strain grain number and 100-grain weight are determined.Under conditions of planting density is certain, single-strain grain number and grain weight directly determine seed Grain yield.Therefore, the relation of single plant yield and Yield And Yield Components (single-strain grain number and 100-grain weight) is understood from molecular level, to jade The genetic improvement of rice yield has great importance.In decades, single plant yield is always with the relation of single-strain grain number, 100-grain weight The emphasis of maize genetic research, improvement yield component proterties can effectively improve yield.Domestic and foreign scholars are on phenotypic level Relation to this 3 proterties is studied, and shows that single plant yield is significantly correlated with Yield And Yield Components (grain number and grain weight).
NF-Y is the transcription factor being widely present in a kind of eucaryote, can specific combination CCAAT-box, and CCAAT-box is present in about 1/4 eukaryotic gene promoter as a kind of cis element.NF-Y is a trimerization Body, it includes NF-YA (CBF-B or HAP2), NF-YB (CBF-A or HAP3), NF-YC (CBF-C or HAP5).NF-Y is used as guarantor The transcription factor kept plant grow and to environment stress respond in play important role.There is research to have been found that Induction that NF-YA in arabidopsis participates in being bloomed under adverse circumstance (Xu et al., 2013).NF-YA is mostly important as tripolymer Composing factor, in structure it have the nitrogen end rich in glutamine and tryptophan or threonine, there is NF-YB/NF-YC to tie Domain, also one DNA binding domain are closed, and the two binding domain are the conservative domains of NF-YA.It is various that research shows that NFYA can be responded Abiotic stress and up-regulated expression, NFYA overexpression strain can become short and small, but this plant pair ABA environment stress signals become It is extremely sensitive, so that the ability of tolerance abiotic stress improves (Li et al., 2008).
The content of the invention
The present invention has separated a NF-YA class transcription factor ZmNF-YA13 from corn, and its function is ground Study carefully, show that the gene take part in the developmental regulation of corn kernel size, the gene overexpression can significantly increase seed and raising Mass of 1000 kernel；The gene can promote corn to bloom simultaneously, therefore it has important application in corn yield, Mature breeding is improved Value.
Albumen provided by the present invention, entitled ZmNF-YA13, from corn B73, belongs to NF-YA class transcription factors.
The present invention obtains the coding (coding of ZmNF-YA13 genes using the method for cDNA library PCR amplifications Sequence, CDS) sequence.The full length cDNA sequence of ZmNF-YA13 genes include 1273bp, CDS sequences 828bp (sequence 1), 275 amino acid (sequence 2) of coding.
The ZmNF-YA13 gene outcomes that the present invention is cloned express (Fig. 1) in nucleus.
Expression (Fig. 2) of the ZmNF-YA13 genes that the present invention is cloned under adverse environmental factor.
The present invention is gene constructed onto plant expression vector ZmNF-YA13, and promoter is Ubiqutin, obtains overexpression Plasmid pUBI:NF-YA13 (Fig. 3), is transformed into Agrobacterium EHA105, with Agrobacterium-mediated Transformation corn and obtains transgenosis Plant.Transgenosis pure lines plant is compared with the WT lines of non-transgenosis under normal growing conditions, is as a result shown, The overexpression of ZmNF-YA13 causes corn flowering time to shift to an earlier date, seed increase (Fig. 4), illustrates that ZmNF-YA13 take part in corn and open The regulation and control taken time with Grain Development.
Brief description of the drawings
Technical scheme in order to illustrate more clearly the embodiments of the present invention, below will be to that will make needed for embodiment description Accompanying drawing is briefly described.In accompanying drawing：
Fig. 1 is the Subcellular Localization figure of ZmNF-YA13 albumen；Fig. 1 (A) is nucleus dyeing and green fluorescent protein Comparing result, Fig. 1 (B) is the comparing result of blank control group and mixed display；
Fig. 2 is expression of results figure of the ZmNF-YA13 albumen under adverse environmental factor；Fig. 2 (A), 2 (B), 2 (C) are respectively height Salt, arid, the expression of results figure of ABA treatment conditions；
Fig. 3 is pUBI:NF-YA13 expression vector collection of illustrative plates；
Fig. 4 is the phenotypic results figure of transgenic corns；Fig. 4 (A) is transgenic corns seed phenotype, 4 (B) are flowering time Statistics.
Specific embodiment
Below in conjunction with embodiment, the technical scheme in the embodiment of the present invention is clearly and completely described.
The clone of the corn ZmNF-YA13 gene cDNAs of embodiment 1
RT-PCR amplifications are carried out by template of the cDNA library of corn B73, PCR primer is as follows：
ZmNF-YA13F：5'-ATGCTTCTTCCCTCTTCGTC-3'；
ZmNF-YA13R：5'-TCATCTCATAACTGGAACCC-3'.
Amplification condition is as follows：
Amplify DNA fragmentation to be reclaimed from agarose gel, be cloned into pEASY-T1 carriers.Digestion and sequencing identification, name It is pTNFYA13.Sequencing result shows：It is the gene shown in sequence 1 to obtain CDS, is ZmNF-YA13, total length by the unnamed gene 828bp, particular sequence is as follows：ATGCTTCTTCCCTCTTCGTCTTCCGCTTCCGCTTCCGCTTCCGCTTCCGCTTCCAAAG GTAACTCCTTTGGGAAAACCGTTAACGATCATCTGAGGTCAACTTTGAGTTTTGATAACAAGCAACCTCCATTTGCA AGTCAAAACTTTGACTACGGTCAAACAATAGCTTGCATTTCATACCCGTACAATCGTTCTAGATCAGGAGATGTTTG GGCAGCCTATGAGTCACGCACCAGCACTGCCACTGTGTTCCGTTCCCAAATTGCTGGTGGGGGTTCATCCACAAGAA TTCCCTTGCCTTTGGAATTAGCAGAGAATGAACCCATATATGTTAATCCCAAACAATAT CACGGGATACTTCGCAGAAGACAGTTACGTGCCAAGTTAGAGGCTCAGAACAAGCTAGTCAGAGCCCGAAAGCCTTA CCTTCATGAGTCTAGGCATCTTCATGCAATGAAGAGGGCACGAGGTTCCGGTGGACGATTCCTCAACACTAAGCAGC TCCAGCAGTCTCACACTGCCCTCACCAGGTCCAACACCACAAGTGGCACAAGCTCCTCAGGCTCAACTCATCTGCGG CTTGGTGGTGGCGCAGCCGCAGCTGGAGATCGATCTGTGCTGGCACCCAAAACAATGGCCTCACAAGACAGTAGCAA GAAGGCTGTTTCTTCAGCTCTCGCCTTCACTGTGACTCCAATGCTGCGCAGAGATGACGGCTTCTTGCAGCACCCAA GCCATCTTTTCAGTTTTTCTGGTCATTTTGGGCAGGCAAGCGCGCAAGCTGGCGTCCATAATGGAAGTCAGCATAGG GTTCCAGTTATGAGATGA
The amino acid sequence of the albumen of its coding as shown in sequence 2, encode 275 amino acid (end terminator is not counted, * * * are not counted i.e. in sequence), the amino acid sequence of the albumen of its coding is as follows：
The corn ZmNF-YA13 Subcellular Localizations of embodiment 2
One of feature of transcription factor is positioned in nucleus, and its transcriptional control function is performed in nucleus.For This, the Subcellular Localization using the method for protoplast transformation to corn ZmNF-YA13 albumen in Corn Protoplast is carried out Research.
2.1 vector constructions：
Using primer：
pRTL2-NFYA13-F:
5'-CTCGAGGGATCCCCATGCTTCTTCCCTCTTCGTC-3'；
pAS2-NFYA13-R:
5'-TGCAGGTCGACGGATCCCCTCATCTCATAACTGGAACCC-3'；
Amplification ZmNF-YA13 coding domain segments, the ZmNF- of homology arm will be carried by the seamless clone technologies of GBclonart YA13 restructuring forms fusion protein to pRTL2 carriers with GFP, is driven by 35S promoter and expressed.
The preparation of 2.2 Protoplasts from Etiolated Maize Leaves：
When corn grows to 3 leaves, second leaf of complete fanout free region, the well-grown blade in clip middle part are selected 0.5mm leaf bars wide are cut into blade.The leaf bar that will be cut is put into pre-configured enzymolysis liquid (1.5%Cellulase R10,0.4%macerozyme R10,0.4M mannitol, 20mM KCl, 20mM MES, pH 5.7,10mM CaCl2,and (10-20 pieces leaf is about needed in 0.1%BSA) per 5-10ml enzymolysis liquids).And helped make leaf be completely immersed in enzymolysis with tweezers Liquid, digests 5~7h by 50 revs/min under the conditions of concussion.
The conversion of 2.3 protoplasts：
1) 100g centrifugations make protoplast pellet for 10 minutes in ttom of pipe, then with appropriate MMG solution (0.4M mannitol, 15mM MgCl2, and 4mM MES, pH 5.7) and resuspended protoplast, ultimate density is allowed in 2X105Individual/ml.
2) in every 100 μ l protoplasts, 10 μ l DNA of addition (DNA of 10 micrograms about 5-10kb) to 2ml centrifuge tubes, Soft mixing.
3) isometric 110 μ l PEG solution (40%PEG [v/v], 0.2M mannitol, and 0.1M CaCl are added2), Soft centrifuge tube of patting is thoroughly mixed.Induction Transformation mixture 10 minutes.
4) 100g centrifugation remove supernatant within 2 minutes after, with 1ml WI solution (0.5M mannitol, 20mM KCl4mMMES, PH5.7) soft resuspended protoplast.
5) (20-25 DEG C) induction protoplast more than 14 hours at room temperature.A part of original is taken when inducing 12 hours Raw plastid dyes 0.5~2h with 5mg/ml core dyestuffs Hoechst33342 (CalBiochem).All of above operation is at room temperature Carry out.
2.4 GFP expressions are observed：
GFP expression is observed under laser confocal microscope, is as a result shown, ZmNF-YA13 is positioned in nucleus, is shown The gene is transcription regulatory factor.Fig. 1 shows the Subcellular Localization situation of ZmNF-YA13 albumen；Fig. 1 (A) is nuclei dyeing Material dyeing and the comparing result of green fluorescent protein, Fig. 1 (B) is the comparing result of blank control group and mixed display, such as Fig. 1 (A) shown in, the display location of ZmNF-YA13-GFP (green fluorescent protein, top) and the dyeing knot of nucleus dyestuff Hochest Really (blue, bottom) overlaps, mutually confirmation.
Expression analysis of the ZmNF-YA13 of embodiment 3 under abiotic stress conditions
The treatment of 3.1 corn materials
Corn seed is taken, through 10%H2O2Surface sterilization, afterwards, imbibition 6h is subsequently placed in two metafiltration for sterile water wash 3 times Two days are sprouted on paper, in 28 DEG C of dark afterwards, the consistent seedling that will sprout is planted in flowerpot vermiculite, 28 DEG C of daytime, night 24 DEG C, the 14h/10h photoperiods are cultivated to two panels intact leaves are gone out, and are retransferred in putting 1/2Hoagland nutrient solutions, are transferred to after one day Full nutrition Hoagland continues to cultivate, and waits to grow the core of three leaf one, carries out the treatment of different condition.
1) PEG simulations drought treatment：Maize seedling is placed in the nutrient solution containing 16%PEG, 28 DEG C of daytime, 24 DEG C of night, The 14h/10h photoperiods cultivate, and respectively in 0h, 4h, 12h, 24h, 48h, and at 15 days, take root, with liquid nitrogen flash freezer, -80 DEG C of preservations It is standby.
2) ABA treatment：Maize seedling is placed in the ABA solution of 50uM, CMC model same as above, respectively in 0h, 4h, 12h, 24h, 48h and at 15 days, take root, and with liquid nitrogen flash freezer, -80 DEG C save backup.
3) salt treatment：Maize seedling is placed in the NaCl solution of 125mM respectively, CMC model same as above exists respectively 0h, 4h, 12h, 24h, 48h and at 15 days, take root, and with liquid nitrogen flash freezer, -80 DEG C save backup.
4) treatment of control：Directly take -80 DEG C of the seedling without any treatment to freeze, as control.
The extraction of 3.2RNA and the removal of DNA：
1) corn material of about 200mg treatment is taken, liquid nitrogen grinding extracts RNA with Trizol reagents (Invitrogen).
2) RNA is dissolved in 85 μ l water, adds the μ l and 5 μ lRQ1RNA Free DNase (1U/ μ l) of 10X buffer 10, 37 DEG C, 15min, to remove the pollution of DNA.
3) add the phenol chloroform of 100 μ l once, supernatant is taken, with isometric isopropanol precipitating RNA, 70% ethanol Wash once, be dissolved in the water of 50 μ l.
4) concentration of quantitative RNA is 1 μ g/ μ l.
3.3RT-qPCR：
According to the GoScript of Promega companiesTMReverse Transcription System(Promega A5000), RT-qPCR is carried out, response procedures are as follows：
1) following reagent is sequentially added to be reacted：
2) after the completion of above-mentioned reaction, following reagent is continuously added in reaction system：
3) it is further continued for adding the μ l of M-MLV 1 (200u/ μ L)；42 DEG C, 50min；70 DEG C, 15min inactivations are standby.
CDNA is diluted into 3 times of templates as quantitative fluorescent PCR.Corn Tubulin5 genes (GRMZM2G099167_ T01) as internal reference.Design of primers is as follows：
ZmTub5FW：
5'-CTCACGCATCGACCACAAG-3'；
ZmTub5RV：
5'-CTTCCATACCCTCACCGACA-3'。
Fluorescent quantitation promega companiesQPCR Master Mix use two-step method on ABI 7500 Carry out.
1) qPCR reaction systems：
2) PCR conditions：
Using 2-ΔΔCtMethod calculates the expression quantity of ZmNF-YA13 under the conditions of different disposal.Fig. 2 shows ZmNF-YA7 albumen Expression of results under adverse environmental factor；Fig. 2 (A), 2 (B), 2 (C) are respectively high salt, arid, the expression of results of ABA treatment conditions Figure, as a result shows that ZmNF-YA13 genes are lowered expression in a short time by Salt treatment high, for a long time then up-regulated expression (Fig. 2A)；By dry Drought induction, ZmNF-YA13 gene expressions are lowered in a short time in treatment plant root, and 48h is quickly raised, and then lower expression again for a long time (Fig. 2 B)；Induced by ABA, expression rises to highest in 48h roots, and initial level (Fig. 2 C) is down to afterwards
The pUBI of embodiment 4:The structure of NF-YA13 expression vectors
1) primer of design amplification ZmNF-YA13CDS total lengths, 20nt carrier homologous sequences are respectively added at primer two ends, are drawn Thing sequence is as follows：
ZmNF-YA13F：
5'-GCGTGGATCCGAGCTCACATGCTTCTTCCCTCTTCGTC-3'；
ZmNF-YA13R：
5'-GTCACCTGTAATTCACACTCATCTCATAACTGGAACCC-3'。
With pTNFYA13 plasmids as template, enter performing PCR amplification；
2) amplified production is reclaimed, and recombining reaction is carried out to the product after recovery and the pCAMBIA3301m for transforming, Agents useful for same is GBclonart Seamless Cloning Kit,
Reaction system is as follows：
3) digestion identification positive colony, positive colony is pUBI:NF-YA13 carriers.Fig. 3 shows pUBI:NF-YA13 Expression vector collection of illustrative plates, sequence verification is carried out by positive colony, obtains positive plasmid as shown in figure 3, being used for subsequent experimental.
The pUBI of embodiment 5:The acquisition of NF-YA13 transgenic corns
5.1 Agrobacterium-mediated Transformations and corn transformation：
The plant expression vector pUBI that will be obtained in embodiment 4:NF-YA13 is transformed into Agrobacterium EHA105.Corn turns Change method is carried out with reference to Frame et al..
5.2 transgenic corns PCR are detected：
Forward primer：ZmNF-YA13FW:5’-CAAGACAGTAGCAAGAAGGCTG-3’
Reverse primer：NOS 70:5’-CCGGCAACAGGATTCAATCTTA-3’
Reaction system ()：
The μ l (20ng~50ng) of transfer-gen plant DNA 1；
Reaction condition：
72 DEG C of extension 5min, filter out PCR positive plants.
The acquisition that 5.3 transgenic corns Basta foliage spray are detected and are sheerly：
When the PCR positive plants piece leaf to 5-6 long, sprayed with the Basta of 1000 times of dilutions, once in a week, continuously spray 3 Plant survival condition is observed after week, the continuous selfing of positive seedling of survival screened for two generations, obtain T2 generation pure lines, plantation observation phenotype.
The pUBI of embodiment 6:NF-YA13 transgenic corns phenotypic analyses
The transgenic corns that empty vector control and overexpression NF-YA13 genes will be turned respectively choose three pure lines plantations, and Fig. 4 shows The phenotype and seed and flowering time statistics of transgenic corns are gone out；Fig. 4 (A) is transgenic corns seed phenotype, Fig. 4 (B) for flowering time is counted.It was found that the plant blossom time advance of transgenic corns overexpression ZmNF-YA13 compared with the control, Seed is relatively compareed and significantly increased, and shows that overexpression ZmNF-YA13 participates in corn flowering time and Grain Development regulation and control.
Obviously, embodiment described above is only a part of embodiment of the invention, rather than whole embodiments.It is based on Embodiment in the present invention, those of ordinary skill in the art obtained on the premise of creative work is not made it is all its His embodiment, belongs to the scope of protection of the invention.

Claims (5)

1. a kind of corn is bloomed and Grain Development GAP-associated protein GAP, is following albumen a) or b)：
A) protein that the amino acid sequence shown in sequence in sequence table 2 is constituted；
B) in sequence table sequence 2 amino acid sequence by substitution and/or missing and/or add one or several amino acid and Bloomed as a) derived from the protein related to Grain Development to corn.
2. corn described in claim 1 is bloomed the encoding gene with Grain Development GAP-associated protein GAP.
3. encoding gene according to claim 2, it is characterised in that：The encoding gene is following base 1) or 2) or 3) Cause：
1) its nucleotide sequence is sequence 1 in sequence table；
2) DNA fragmentation for being limited with sequence 1 under strict conditions hybridizes and coding is bloomed and Grain Development GAP-associated protein GAP with corn DNA molecular；
3) there is more than 90% homology with gene 1) or 2), and coding is bloomed and Grain Development GAP-associated protein GAP with corn DNA molecular.
4. the recombinant expression carrier of encoding gene described in Claims 2 or 3 is contained.
5. corn described in claim 1 is bloomed and is wanted with encoding gene, right described in Grain Development GAP-associated protein GAP, Claims 2 or 3 Ask application of the recombinant expression carrier described in 4 in genetically modified plants.
CN201510953798.6A 2015-12-18 2015-12-18 Corn flowering and grain development related protein, coding gene and application Active CN106892971B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510953798.6A CN106892971B (en) 2015-12-18 2015-12-18 Corn flowering and grain development related protein, coding gene and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510953798.6A CN106892971B (en) 2015-12-18 2015-12-18 Corn flowering and grain development related protein, coding gene and application

Publications (2)

Publication Number Publication Date
CN106892971A true CN106892971A (en) 2017-06-27
CN106892971B CN106892971B (en) 2020-09-08

Family

ID=59188647

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510953798.6A Active CN106892971B (en) 2015-12-18 2015-12-18 Corn flowering and grain development related protein, coding gene and application

Country Status (1)

Country Link
CN (1) CN106892971B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107090462A (en) * 2017-05-18 2017-08-25 大连理工大学 A kind of NF Y classes nuclear transcription factor-2 gene ZmNF YA13, the albumen of its coding and its application
CN110407921A (en) * 2018-04-27 2019-11-05 中国农业科学院作物科学研究所 From the plant seed development associated protein SGDW1 and its encoding gene of millet and application
CN113527455A (en) * 2021-08-30 2021-10-22 山东大学 Grain development related protein TaGSR1 and application thereof in wheat plant type breeding

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102234322A (en) * 2010-04-27 2011-11-09 中国农业科学院作物科学研究所 Protein GmNF-YA1 related with stress tolerance of plants, and coding gene and application thereof
WO2015051342A2 (en) * 2013-10-04 2015-04-09 Synthetic Genomics, Inc. Compositions and methods for modulating biomass productivity

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102234322A (en) * 2010-04-27 2011-11-09 中国农业科学院作物科学研究所 Protein GmNF-YA1 related with stress tolerance of plants, and coding gene and application thereof
WO2015051342A2 (en) * 2013-10-04 2015-04-09 Synthetic Genomics, Inc. Compositions and methods for modulating biomass productivity

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LUAN,M.ET AL.: "GenBank:KM655751.1", 《NCBI》 *
MINGDA LUAN ET AL.: "Expression of zma-miR169 miRNAs and their target ZmNF-YA genes in response to abiotic stress in maize leaves", 《GENE》 *
栾明达: "玉米miR169及其靶基因NF-YA转录因子功能的初步研究", 《中国优秀硕士学位论文全文数据库 农业科技辑》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107090462A (en) * 2017-05-18 2017-08-25 大连理工大学 A kind of NF Y classes nuclear transcription factor-2 gene ZmNF YA13, the albumen of its coding and its application
CN107090462B (en) * 2017-05-18 2020-02-18 大连理工大学 NF-Y nuclear transcription factor gene ZmNF-YA13, protein encoded by same and application thereof
CN110407921A (en) * 2018-04-27 2019-11-05 中国农业科学院作物科学研究所 From the plant seed development associated protein SGDW1 and its encoding gene of millet and application
CN110407921B (en) * 2018-04-27 2021-04-06 中国农业科学院作物科学研究所 Plant grain development related protein SGDW1 derived from foxtail millet and encoding gene and application thereof
CN113527455A (en) * 2021-08-30 2021-10-22 山东大学 Grain development related protein TaGSR1 and application thereof in wheat plant type breeding
CN113527455B (en) * 2021-08-30 2023-10-13 山东大学 Seed development related protein TaGSR1 and application thereof in wheat strain type breeding

Also Published As

Publication number Publication date
CN106892971B (en) 2020-09-08

Similar Documents

Publication Publication Date Title
CN104829700A (en) Corn CCCH-type zinc finger protein, and encoding gene ZmC3H54 and application thereof
CN106892971A (en) A kind of corn is bloomed and Grain Development GAP-associated protein GAP, encoding gene and application
CN104388433B (en) A kind of Plant Osmotic Stress inducible promoter and application thereof
CN107881172A (en) A kind of adverse circumstance inducible promoter, adverse circumstance inducible promoter plant expression vector and induction target gene expression
CN103951740B (en) Bermuda grass CCAAT transcription factor CdtNF-YC1 as well as coding gene and application thereof
CN102250903A (en) Application of rice miR166 in enhancing plant drought stress tolerance
CN106317213A (en) Plant stress resistance related protein, coding gene and application thereof
CN101984059A (en) Gossypium barbadense DREB transcription factor gene and application thereof
CN104388432A (en) Separation and application of specific promoter CsBFTP of citrus sinensis tree root
CN104046639A (en) Wheat methionine sulfoxide reductase gene TaMsrB3.1 and application thereof
CN106892970A (en) A kind of Maize Kernel Development GAP-associated protein GAP, encoding gene and application
CN105237631B (en) One kind is from sheep's hay albumen relevant to cold-resistant and its encoding gene and application
CN110904106B (en) Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity
CN110951771B (en) Chinese cymbidiummiR390aApplication in controlling plant root system development
CN102718853B (en) Upland cotton GhLFY protein and coding gene and application thereof
CN106892972A (en) A kind of corn Stress response and bloom modulin, encoding gene and application
CN104630237B (en) A kind of appropriateness delays plant senescence and the fusion for improving stress resistance and its application
CN111560382B (en) Gene BnGF14a for regulating vernalization process of rape and application thereof
CN110699362B (en) AFP5 gene and application thereof
CN103834624B (en) The cold-resistant associated protein GST of plant and encoding gene thereof are applied with it
CN102154320A (en) Chrysanthemum anti-retroelement DgZFP1, plant expression vector thereof, construction method thereof and application thereof
CN106967727B (en) Rape photosynthetic efficiency related gene perg, preparation method and application
Zheng et al. Genome-wide analysis of TCP gene family in Osmanthus fragrans reveals a class I gene OfTCP13 modulate leaf morphology
CN110964724A (en) Application of cymbidium goeringii miR390c in enhancing cold resistance of plants
CN104774846B (en) The method that Transgenic Rice escape risk is reduced using paddy gene OsSI

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant