CN106884038A - A kind of gene chip kit for detecting gram-positive bacterium drug resistant gene - Google Patents
A kind of gene chip kit for detecting gram-positive bacterium drug resistant gene Download PDFInfo
- Publication number
- CN106884038A CN106884038A CN201510941151.1A CN201510941151A CN106884038A CN 106884038 A CN106884038 A CN 106884038A CN 201510941151 A CN201510941151 A CN 201510941151A CN 106884038 A CN106884038 A CN 106884038A
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer pair
- drug resistant
- hybridization
- gram
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of gene chip kit for detecting gram-positive bacterium drug resistant gene.Containing the primer pair group for detecting gram-positive bacterium drug resistant gene in kit provided by the present invention, it is made up of 3 primer pairs, its sequence is sequence 1-6 in sequence table;Also contain in the kit simultaneously and be fixed with 3 hybridization hybrid chips of ssDNA probe shown in sequence 7-9.The kit that the present invention is provided supports high flux, quickly and accurately detects multiple gram-positive bacterium drug resistant genes, examination is carried out to Chinese population, the effects such as Accurate Diagnosis, resistance are traced to the source, resistance is controlled can be effectively acted as, so that antibiotic usage amount, reduces resistance and produce.
Description
Technical field
The invention belongs to nucleic acid amplification technologies field, it is related to a kind of gene core for detecting gram-positive bacterium drug resistant gene
Piece kit.
Background technology
Bacterial resistance gene detection has important clinical significance.The consumption that there is antibiotic in clinical diagnosis is big, high starting point,
The more random defect of species, so as to cause generation and the prevalence of resistance strain.Currently used for drug resistant gene detection still compared with
It is tradition, PCR (PCR) is subject to after substantially having physiological and biochemical test, serological test, drug sensitive test etc.
The method for expanding corresponding gene, and above-mentioned detection method needs the time long, method operation is loaded down with trivial details, report result is slow, logical
Amount is low, and often first identifies strain, could accordingly carry out the follow-up tests such as susceptibility, thus be difficult in adapt to clinic to control
The need for treatment.Therefore the molecular diagnostic techniques detection of exploitation fast high-flux, can assist quick diagnosis, instruct timely
Accurate medication.
Biochip technology is to be developed rapidly in life science in recent years and a ripe new and high technology, mainly
It is the miniature biochemical analysis system by micro-processing technology and microelectric technique in solid phase chip surface construction, can be real
Now to accurate, quick, bulk information the detection of cell, protein, nucleic acid and other various biotic components.It is raw
Thing chip be mainly characterized by high flux, miniaturization and automate.
The content of the invention
First purpose of the invention is to provide a kind of primer pair group for detecting gram-positive bacterium drug resistant gene.
Primer pair group for detecting gram-positive bacterium drug resistant gene provided by the present invention, by following 3 primers
To composition:
1) primer pair shown in following (a1) or (a2), is designated as primer pair 1:
(a1) primer pair that two single strand dnas shown in sequence in sequence table 1 and sequence 2 are constituted;
(a2) by by sequence in sequence table 1 and sequence 2 by the substitution of one or several nucleotides and/or missing and/
Or addition after gained sequence shown in two single strand dnas composition, and with primer pair function described in (a1)
Identical primer pair;
2) primer pair shown in following (b1) or (b2), is designated as primer pair 2:
(b1) primer pair that two single strand dnas shown in sequence in sequence table 3 and sequence 4 are constituted;
(b2) by by sequence in sequence table 3 and sequence 4 by the substitution of one or several nucleotides and/or missing and/
Or addition after gained sequence shown in two single strand dnas composition, and with primer pair function described in (b1)
Identical primer pair;
3) primer pair shown in following (c1) or (c2), is designated as primer pair 3:
(c1) primer pair that two single strand dnas shown in sequence in sequence table 5 and sequence 6 are constituted;
(c2) by by sequence in sequence table 5 and sequence 6 by the substitution of one or several nucleotides and/or missing and/
Or addition after gained sequence shown in two single strand dnas composition, and with primer pair function described in (c1)
Identical primer pair.
Wherein, the primer pair 1 is used to expand mecA genes;The primer pair 2 is used to expand vanA genes;Institute
Primer pair 3 is stated for expanding vanB genes.
Second object of the present invention is to provide a kind of for detecting the complete single-stranded of gram-positive bacterium drug resistant gene
DNA。
Complete single stranded DNA for detection bacterium drug resistant gene provided by the present invention, specifically by probe groups and described draws
Thing is to a group composition;The probe groups are made up of following 3 ssDNA probes:List in sequence table shown in sequence 7
Ssdna probe 1;SsDNA probe 2 in sequence table shown in sequence 8;List in sequence table shown in sequence 9
Ssdna probe 3.
Wherein, the ssDNA probe 1 is used to detect the amplification of the primer pair 1;The single stranded DNA
Probe 2 is used to detect the amplification of the primer pair 2;The ssDNA probe 3 is used to detect the primer
To 3 amplification.
Third object of the present invention is to provide a kind of kit for detecting gram-positive bacterium drug resistant gene.
Kit for detecting gram-positive bacterium drug resistant gene provided by the present invention, contains the primer pair
Group, and hybridization hybrid chip;The hybridization hybrid chip is prepared according to the method for comprising the following steps:It is by formula
“NH2-(T)n3 kinds of single-stranded detection probes of-hybridization probe sequence " are fixed to aldehyde by the reaction of amino and aldehyde radical respectively
On the solid phase carrier (such as slide) of base modificationization, the hybridization hybrid chip is obtained;(T) in the formulanRepresent n
Continuous T, n is the integer more than or equal to 5, and less than or equal to 30;It is single-stranded corresponding to described 3 kinds in the formula
3 kinds of hybridization probe sequences of detection probe are respectively as shown in sequence 7-9 in sequence table.
As needed, can also contain through the random primer of fluorescence labeling in the kit;The sequence of the random primer
It is 5 '-NX- 3 ', N represents that any one in A, G, C and T, 6≤X≤15, and X are integer (such as X=9),
NXRepresent X continuous deoxyribonucleotide.
The above is for the amplified production to the primer pair in the primer pair group through the random primer of fluorescence labeling
Carry out fluorescence labeling.As needed, it is also possible to do not use the random primer through fluorescence labeling to enter amplified production
Row fluorescence labeling, but use other method.As will be described in primer pair group a primer of each primer pair 5 ' end
End carries out fluorescence labeling (such as TAMRA), and the primer being fluorescently labeled is that be present in amplified production can be by correspondent probe
Primer on the single stranded DNA of hybridization.
Hybridization solution can also be contained in the kit;Contain the unrelated single stranded DNA through fluorescence labeling in the hybridization solution
Molecule;The unrelated single strand dna is the non-single strand dna from the bacterial resistance gene.
The preparation method of the hybridization hybrid chip is also included surface chemistry Quality Control probe QC, and/or hybridization Quality Control probe
PC, and/or negative control probe BC is fixed to the solid phase carrier of aldehyde group modifiedization by amino with the reaction of aldehyde radical
Step on (such as slide);
The surface chemistry Quality Control probe QC, the hybridization Quality Control probe PC and the negative control probe are single-stranded
Probe;Through amido modified, the other end has fluorescence labeling (such as Hex) for one end of the surface chemistry Quality Control probe QC;
One end of the hybridization Quality Control probe PC, and can be with the described unrelated single stranded DNA in the hybridization solution through amido modified
Molecule hybridizes;One end of the negative control probe BC is through amido modified and thin with from the Gram-positive
Any single strand dna of bacterium drug resistant gene can not hybridize.
Further, in the present invention, structure compositions of the surface chemistry Quality Control probe QC from 5 ' ends to 3 ' ends is
“NH2-TCACTTGCTTCCGTTGAGG-Hex”;Knots of the hybridization Quality Control probe PC from 5 ' ends to 3 ' ends
Structure composition is " NH2-TTTTTTTTTTTTCCTCAACGGAAGCAAGTGAT”;The negative control is visited
Pin BC is held to the 3 ' structure compositions held from 5 '
“NH2-TTTTTTTTTTTTGTTGCTTCTGGAATGAGTTTGCT”。
The application of the primer pair group or the complete single stranded DNA or the kit in following (a) or (b)
Fall within protection scope of the present invention:
A () is detected or auxiliary detection gram-positive bacterium drug resistant gene (non-diagnostic purpose), or prepare for detecting
Or the product of auxiliary detection gram-positive bacterium drug resistant gene;
B () is detected or auxiliary bacterium (non-diagnostic purpose) of the detection containing gram-positive bacterium drug resistant gene, or system
It is ready for use on the product of detection or auxiliary bacterium of the detection containing gram-positive bacterium drug resistant gene.
In the present invention, at least one during the gram-positive bacterium drug resistant gene is concretely following:mecA
Gene, vanA genes, vanB genes.
The GenBank accession number of the mecA genes is AB221119.1 (update:2006-5-19);The vanA
The GenBank accession number of gene is M97297.1 (update:2002-6-20);The GenBank of the vanB genes
Accession number is AY655711.1 (update:2005-11-7).
Accordingly, bacterium containing the mecA genes concretely staphylococcus aureus;Contain the vanA bases
The bacterium of cause concretely enterococcus faecalis or VREF;Bacterium containing the vanB genes concretely enterococcus faecalis
Or VREF.
The application of the primer pair group or the complete single stranded DNA in the kit is prepared falls within of the invention
Protection domain.
The present invention is studied the gram-positive bacterium drug resistant gene of very big sample size.The kit that the present invention is provided
High flux is supported, multiple gram-positive bacterium drug resistant genes are quickly and accurately detected, examination is carried out to Chinese population,
The effects such as Accurate Diagnosis, resistance are traced to the source, resistance is controlled can be effectively acted as, so that antibiotic usage amount, reduces resistance
Produce.
Brief description of the drawings
Fig. 1 is the dot matrix arrangement schematic diagram (i.e. chip probe schematic layout pattern) of hybridization hybrid chip.- represent and appoint without fixed
What probe.
Fig. 2 is the specific analysis result for detecting the kit of gram-positive bacterium drug resistant gene.Figure correspondence
Chip probe schematic layout pattern it is as shown in Figure 1.Wherein, the corresponding reference material DNA of chip detection result shown in A
Plasmid is ZL-vanA (correspondence vanA gene);The corresponding reference material DNA plasmid of chip detection result shown in B is
ZL-vanB (correspondence vanB genes);The corresponding reference material DNA plasmid of chip detection result shown in C is ZL-mecA
(correspondence mecA genes).
Fig. 3 is the clinical sample testing result for detecting the kit of gram-positive bacterium drug resistant gene.The figure pair
The chip probe schematic layout pattern answered is as shown in Figure 1.Wherein, No. 1 clinical sample of the correspondence of chip detection result shown in A;
No. 2 clinical samples of correspondence of chip detection result shown in B;No. 3 clinical samples of correspondence of chip detection result shown in C.
Specific embodiment
Experimental technique used in following embodiments is conventional method unless otherwise specified.
Material used, reagent etc. in following embodiments, unless otherwise specified, commercially obtain.
Embodiment 1, the preparation of kit for detecting gram-positive bacterium drug resistant gene and its use
First, for detecting the assembling of the kit of gram-positive bacterium drug resistant gene and preparing
1st, for 3 primers and hybridization probe of the design of gram-positive bacterium drug resistant gene
The primer designed for 3 bacterial resistance genes and single-stranded hybridization probe particular sequence are as shown in Table 1 and Table 2.
Table 1 is for 3 primers of gram-positive bacterium drug resistant gene design
Table 2 is for 3 single-stranded hybridization probes of gram-positive bacterium drug resistant gene design
Numbering | Detection gene | GenBank | Probe title | Sequence (5 ' -3 ') |
1 | mecA | AB221119.1 | mecA-1427 | GTAGCACTCGAATTAGGCAG (sequence 7) |
2 | vanA | M97297.1 | vanA-379 | TGTAGGCTGCGATATTCAAA (sequence 8) |
3 | vanB | AY655711.1 | vanB-793 | GTCGAGGAACGAAATCGGGT (sequence 9) |
2nd, hybridization probe is fixed on hybridization hybrid chip
Hybridization hybrid chip is to be respectively fixed with 3 kinds of substrates of single-stranded detection probe.Every kind of detection probe is all that one section of amino is repaiied
The oligonucleotide probe of decorations, 3 kinds of formulas of single-stranded detection probe are " NH2- TTTTTTTTTTTTTTT- hybridization probes
Sequence ", wherein " hybridization probe sequence " is 3 kinds of single-stranded hybridization probes shown in sequence 7-9 in table 2 ".Each inspection
Probing pin is respectively with gene sampling liquid (Capitalbio Corporation Co., Ltd.'s product, its catalog number is CP.440010)
Dissolving, final concentration of 10 μM, slide (Capitalbio Corporation Co., Ltd. that point system is modified to aldehyde radicalization in triplicate
Product, its catalog number is CP.420022) on, so as to 3 kinds of probes be fixed with the reaction of aldehyde radical by amino
Onto hybridization hybrid chip.In addition, again by the reaction of amino and aldehyde radical by surface chemistry Quality Control probe QC, hybridization matter
Control probe PC and negative control probe BC is again secured on hybridization hybrid chip.QC is that one end marks with Hex, another
End has amido modified single strand oligonucleotide probes, for observing chip point sample and fixed efficiency, its from 5 ' ends to
The structure composition at 3 ' ends is NH2-TCACTTGCTTCCGTTGAGG-Hex.PC is one section amido modified single-stranded
Oligonucleotide probe, can be miscellaneous with the unrelated single strand dna (C-PC) through fluorescence labeling added in hybridization solution
Hand over, for the Quality Control of crossover process, its structure composition from 5 ' ends to 3 ' ends is
NH2-TTTTTTTTTTTTCCTCAACGGAAGCAAGTGAT.BC is one section of amido modified few nucleosides
Sequence all to be detected in acid probe, with hybridization system will not hybridize, for observing whether there is Non-specific hybridization, its
It is to the 3 ' structure compositions held from 5 ' ends
NH2-TTTTTTTTTTTTGTTGCTTCTGGAATGAGTTTGCT.Fig. 1 is arranged for the dot matrix of hybridization hybrid chip
Cloth schematic diagram.
3rd, for detecting the composition of the kit of gram-positive bacterium drug resistant gene
It is provided by the present invention for detecting gram-positive bacterium drug resistant gene (3 kinds for being related in Tables 1 and 2
Gram-positive bacterium drug resistant gene) kit contain:
(1) 3 primer pairs in step 1 shown in table 1;
(2) 3 kinds of detection probes and surface chemistry Quality Control probe QC, hybridization Quality Control probe PC are fixed with step 2
With the hybridization hybrid chip of negative control probe BC;
(3) through the random primer of fluorescence labeling;The sequence of the random primer is 5 '-N9- 3 ', N represent A, G,
Any one in C and T, N9Represent 9 continuous deoxyribonucleotides.
(4) hybridization solution;Containing the unrelated single strand dna (C-PC) through fluorescence labeling in the hybridization solution, its
Nucleotides sequence is classified as 5 '-ATCACTTGCTTCCGTTGAGG-3 '.
2nd, for detecting the application method of the kit of gram-positive bacterium drug resistant gene
1st, sample PCR (PCR) amplification
1 μ L DNA sample solution to be measured is taken, with it as template, shown in table 13 primer pairs is respectively adopted and is entered
Performing PCR is expanded.20 μ LPCR amplification systems are as follows:10 × PCR buffer (contain Mg2+)2μL;2.5mM dNTP
1.6μL;10 μM of μ L of sense primer 0.5;10 μM of μ L of anti-sense primer 0.5;The μ L of template 1;5U/μL rTaq 0.2μL;
Moisturizing is to 20 μ L.PCR amplification programs are as follows:94℃ 5min;(94℃ 30s;55℃ 30s;72℃ 1min)
30 circulations;72℃ 10min.PCR reactions are obtained 3 parts of pcr amplification products after terminating.
2nd, the fluorescence labeling of pcr amplification product
Every kind of pcr amplification product takes 5 μ L, is added in different sample cells, and 3 μ L concentration are added in each sample cell
For 100 μM through TAMRA fluorescence labelings 9N random primers (nucleotides sequence is classified as 5 '-N9-3 ', N represent A,
Any one in G, C and T, N9 represents 9 continuous deoxyribonucleotides, work of specifically making a living bioengineering (on
Sea) limited company's product), moisturizing to 19 μ L, concussion is mixed, brief centrifugation;It is placed on ice after 95 DEG C of denaturation,
Add 6 μ L fluorescence labeling reaction systems mix (compositions:10×Klenow Buffer 2.5μL;5U/μL Klenow
The μ L of enzyme 1;2.5mM dNTP 2.5μL).Follow procedure carries out fluorescence labeling, and program is as follows:37℃ 90min;70℃
10min.3 parts of TAMRA fluorescent mark products are obtained.
3rd, the purifying of TAMRA fluorescent mark products
The Nucleo Spin Gel and PCR Clean-up kit (products produced using Macherey-Nagel companies
Article No.:REF740609*250), the TAMRA fluorescent mark products that step 2 is obtained are purified, concrete operations
Carried out according to kit specification.
4th, hybridize
The unrelated single strand dna through TAMRA fluorescence labelings will be contained
(5 '-ATCACTTGCTTCCGTTGAGG-3 ') hybridization buffer (Capitalbio Corporation Co., Ltd.'s product,
Its catalog number is CP.440030) in 50 DEG C of thawings, (wherein step 3 is after purification to prepare 3 parts of hybrid mixed liquid
The μ L of TAMRA fluorescent mark products solution 15, hybridization buffer 5 μ L), the 3 parts of hybrid mixed liquid that will be prepared
It is added on the hybridization hybrid chip in step one 2, every part of hybrid mixed liquid one intact hybridization chip of correspondence, 95 DEG C of denaturation
3min, places on ice immediately, and 50 DEG C of water-bath hybridization 2h.
5th, clean
With two kinds of different washing lotion (washing lotion I:2 × SSC, 0.2%SDS, are preheated to 50 DEG C;Washing lotion II:0.2 × SSC,
Be preheated to 50 DEG C) be respectively washed 4min according to the order of washing lotion II after first washing lotion I after, chip is placed on
In SlideWasher_8 chip cleaning devices, centrifuging process is selected, (or centrifuge 1000rpm centrifugations 2min) is centrifuged,
Dry.
6th, scanner uni result judgement
Scanning (selection green channel, setting are completed using rich Austria crystalline substance core LuxScan 10K micro-array chip scanners
The parameter area of " Power " is 50-90 and the parameter area of " PMT " is 500-900), and pressed according to scanning result
Determine whether contain 3 kinds of gram-positive bacterium resistance bases being related in table 1 in DNA sample to be measured according to following method
Cause, and specifically containing 3 kinds of gram-positive bacterium drug resistant genes in it is any or which plant:For detecting that certain is removed from office
If fixed position of the probe of gram-positive bacteria drug resistant gene on chip detects fluorescence signal, judge right
Contain corresponding gram-positive bacterium drug resistant gene in the DNA sample to be measured answered;Corresponding leather is not contained then otherwise
Gram-positive bacteria drug resistant gene.In addition, software can be assigned not according to the fluorescence signal intensity for detecting in scanning process
Same color, color is gradually strengthened by blueness to white, signal, and then can tentatively judge target in DNA sample to be measured
The height of gram-positive bacterium drug resistant gene content.
Embodiment 2, the specificity of kit for detecting gram-positive bacterium drug resistant gene and sensitivity determination
First, the preparation of reference material DNA plasmid
The structure of the plasmid the 1st, containing mecA gene target fragments
By mecA genes (GenBank:AB221119.1, update:1001-1926 institute 2006-5-19)
Show that DNA fragmentation is connected on pGEM-T Easy Vector carriers (promega Products), obtain recombinating matter
Grain ZL-mecA.And it is correct through sequence verification.
The structure of the plasmid the 2nd, containing vanA gene target fragments
By vanA genes (GenBank:M97297.1, update:Shown in 7000-7988 2002-6-20)
DNA fragmentation is connected on pGEM-T Easy Vector carriers, obtains recombinant plasmid ZL-vanA.And through sequence verification
Correctly.
The structure of the plasmid the 3rd, containing vanB gene target fragments
By vanB genes (GenBank:AY655711.1, update:Shown in 14-1029 2005-11-7)
DNA fragmentation is connected on pGEM-T Easy Vector carriers, obtains recombinant plasmid ZL-vanB.And through sequence verification
Correctly.
2nd, analyzed for detecting the specificity of the kit of gram-positive bacterium drug resistant gene
It is 10 that 3 kinds of reference material DNA plasmids that step one builds are diluted into concentration4Copy/μ L, respectively with dilution
3 kinds of reference material DNA plasmids afterwards are DNA sample to be measured, are then operated according to the step 2 of embodiment 1, are examined
Survey whether containing purposeful gram-positive bacterium drug resistant gene in DNA sample to be measured, specific decision method is referring to implementation
The step 26 of example 1.
Result is as shown in Fig. 2 be only to secure phase as seen from the figure for each reference material DNA plasmid
The point of detection probe is answered to be able to detect that obvious fluorescence signal, other points do not detect fluorescence signal.The result table
The bright kit for detecting gram-positive bacterium drug resistant gene provided by the present invention has stronger specificity.
3rd, for detecting the sensitivity analysis of the kit of gram-positive bacterium drug resistant gene
3 kinds of reference material DNA plasmids that above-mentioned steps one build are carried out into gradient dilution respectively, concentration is obtained and is followed successively by
104Copy/μ L, 103Copy/μ L, 102Copy/μ L, 101The dilution of copy/μ L.Respectively with the 3 of different dilution factors
It is DNA sample to be measured to plant reference material DNA plasmid, is then operated according to the step 2 of embodiment 1, is detected to be measured
Whether contain purposeful gram-positive bacterium drug resistant gene in DNA sample, specific decision method is referring to the step of embodiment 1
26.
Result shows:For each reference material DNA plasmid, concentration is 104Copy/μ L, 103Copy/μ L,
102The point of corresponding detection probe can detect obvious fluorescence signal during copy/μ L;Only concentration is 101Copy/μ L's
Reference material DNA plasmid does not detect fluorescence signal.The result shows provided by the present invention for detecting gram
The kit of positive bacteria drug resistant gene has sensitivity higher.
The detection of embodiment 3, actual clinical sample
First, clinical sample type
The present embodiment using clinical sample come from The People's Hospital of Peking University collection the sticky fester in people wound (this
The voluntary principle of this picker), totally three parts.
2nd, in clinical sample DNA sample extraction
1st, the clinical sample 1-3mL of step one is taken;
2nd, 4 times of NaOH of volume 4% (4g/100mL) are added, is shaken up, room temperature places 30min liquefaction;
3rd, the NaOH of fester and 0.5mL 4% (4g/100mL) after 0.5ml liquefies, room temperature, 10min are taken;
4th, 12 000rpm centrifugations 15min;
5th, supernatant, plus SPSS 1mL are abandoned, is mixed, 12 000rpm centrifugations 5min;
6th, supernatant is abandoned, is precipitated and is extracted for DNA;
7th, (Capitalbio Corporation Co., Ltd.'s product, its catalog number is to add 50 μ L nucleic acid extractions liquid
CP.360090), fully shaking is mixed, and precipitation is suspended completely;
8th, suspension is transferred in nucleic acid extraction pipe, screws lid, be put into instrument for extracting nucleic acid or vortex concussion instrument most
Big rotating speed concussion 5min;
9th, 95 DEG C of metal bath heating 5min;
10th, 5000rpm centrifugations 1min, supernatant is transferred in 1.5mL centrifuge tubes, and -20 DEG C save backup.
3rd, the detection of actual clinical sample
Three parts of clinical sample DNA that step 2 is obtained are DNA sample to be measured, then according to the step 2 of embodiment 1
Operated, whether purposeful gram-positive bacterium drug resistant gene is contained in detection DNA sample to be measured, it is specific to judge
Method is referring to the step 26 of embodiment 1.
Result is as shown in figure 3, three parts of sample hybridization signals are clear and single as seen from the figure.Compared through with probe location,
Detection obtains signal for gene mecA in No. 1 clinical sample, and detection obtains signal for resistance in No. 2 clinical samples
Gene mecA and drug resistant gene vanA, detection obtains signal for drug resistant gene vanB in No. 3 clinical samples.
In order to further determine that the accuracy of above testing result of the present invention, the present inventor is by three parts of clinical samples
Pcr amplification product carried out agarose gel electrophoresis and sequence verification, as a result confirm:No. 1 clinical sample only with
The amplified production of primer pair mecA-F/mecA-R has obvious electrophoretic band, and the amplified production of other primer pairs is equal
Obvious electrophoretic band is not detected, the further amplified production sequencing to primer pair mecA-F/mecA-R finds it
Sequence is just being mecA genes (GenBank:AB221119.1, update:2006-5-19) 1001-1926;
No. 2 clinical samples have obvious only with the amplified production of primer pair mecA-F/mecA-R and vanA-F/vanA-R
Electrophoretic band, and the amplified production of other primer pairs does not detect obvious electrophoretic band, further to primer pair
The amplified production sequencing of mecA-F/mecA-R and vanA-F/vanA-R finds that its sequence is just being mecA genes
(GenBank:AB221119.1, update:1001-1926 2006-5-19) and vanA genes (GenBank:
M97297.1, update:2002-6-20) 7000-7988;No. 3 clinical samples are only with primer pair
The amplified production of vanB-F/vanB-R has obvious electrophoretic band, and the amplified production of other primer pairs is not examined
Obvious electrophoretic band is measured, the further amplified production sequencing to primer pair vanB-F/vanB-R is finding its sequence just
It is vanB genes (GenBank:AY655711.1, update:2005-11-7) 14-1029.The result
Proof utilizes the testing result of kit of the present invention accurately and reliably.
Claims (10)
1. it is used to detect the primer pair group of gram-positive bacterium drug resistant gene, is made up of following 3 primer pairs:
1) primer pair shown in following (a1) or (a2), is designated as primer pair 1:
(a1) primer pair that two single strand dnas shown in sequence in sequence table 1 and sequence 2 are constituted;
(a2) by by sequence in sequence table 1 and sequence 2 by the substitution of one or several nucleotides and/or missing and/
Or addition after gained sequence shown in two single strand dnas composition, and with primer pair function described in (a1)
Identical primer pair;
2) primer pair shown in following (b1) or (b2), is designated as primer pair 2:
(b1) primer pair that two single strand dnas shown in sequence in sequence table 3 and sequence 4 are constituted;
(b2) by by sequence in sequence table 3 and sequence 4 by the substitution of one or several nucleotides and/or missing and/
Or addition after gained sequence shown in two single strand dnas composition, and with primer pair function described in (b1)
Identical primer pair;
3) primer pair shown in following (c1) or (c2), is designated as primer pair 3:
(c1) primer pair that two single strand dnas shown in sequence in sequence table 5 and sequence 6 are constituted;
(c2) by by sequence in sequence table 5 and sequence 6 by the substitution of one or several nucleotides and/or missing and/
Or addition after gained sequence shown in two single strand dnas composition, and with primer pair function described in (c1)
Identical primer pair.
2. it is used to detect the complete single stranded DNA of gram-positive bacterium drug resistant gene, by probe groups and claim 1
Described primer pair group composition;
The probe groups are made up of following 3 ssDNA probes:Single stranded DNA in sequence table shown in sequence 7 is visited
Pin 1;SsDNA probe 2 in sequence table shown in sequence 8;Single stranded DNA in sequence table shown in sequence 9 is visited
Pin 3.
3. it is used to detect the kit of gram-positive bacterium drug resistant gene, contains the primer pair described in claim 1
Group, and hybridization hybrid chip;
The hybridization hybrid chip is prepared according to the method for comprising the following steps:It is " NH by formula2-(T)n- hybridization
3 kinds of single-stranded detection probes of probe sequence " are fixed to the solid phase of aldehyde group modifiedization by amino with the reaction of aldehyde radical respectively
On carrier, the hybridization hybrid chip is obtained;(T) in the formulanRepresent the continuous T of n, n be more than or equal to 5,
And the integer less than or equal to 30;Corresponding to 3 kinds of hybridization probe sequences of 3 kinds of single-stranded detection probes in the formula
Respectively as shown in sequence 7-9 in sequence table.
4. kit according to claim 3, it is characterised in that:Also contain through fluorescence mark in the kit
The random primer of note;The sequence of the random primer is 5 '-NX- 3 ', N represents any one in A, G, C and T,
6≤X≤15, and X is integer, NXRepresent X continuous deoxyribonucleotide.
5. the kit according to claim 3 or 4, it is characterised in that:Also contain hybridization in the kit
Liquid;Contain the unrelated single strand dna through fluorescence labeling in the hybridization solution;The unrelated single strand dna is
The non-single strand dna from the gram-positive bacterium drug resistant gene.
6. kit according to claim 5, it is characterised in that:The preparation method of the hybridization hybrid chip is also wrapped
Include and surface chemistry Quality Control probe QC, and/or hybridization Quality Control probe PC, and/or negative control probe BC are passed through into amino
The step on the solid phase carrier of aldehyde group modifiedization is fixed to the reaction of aldehyde radical;
The surface chemistry Quality Control probe QC, the hybridization Quality Control probe PC and the negative control probe are single-stranded
Probe;
Through amido modified, the other end has fluorescence labeling for one end of the surface chemistry Quality Control probe QC;
One end of the hybridization Quality Control probe PC through amido modified, and can with it is described unrelated single-stranded in the hybridization solution
DNA molecular hybridizes;
One end of the negative control probe BC through amido modified, and with from any of the bacterial resistance gene
Single strand dna can not hybridize.
7. kit according to claim 6, it is characterised in that:The surface chemistry Quality Control probe QC is from 5 '
The structure composition held to 3 ' ends is " NH2-TCACTTGCTTCCGTTGAGG-Hex”;
The hybridization Quality Control probe PC is held to the 3 ' structure compositions held from 5 '
“NH2-TTTTTTTTTTTTCCTCAACGGAAGCAAGTGAT”;
The negative control probe BC is held to the 3 ' structure compositions held from 5 '
“NH2-TTTTTTTTTTTTGTTGCTTCTGGAATGAGTTTGCT”。
8. the complete single stranded DNA or claim 3-7 described in the primer pair group or claim 2 described in claim 1
In application of any described kit in following (a) or (b):
A () is detected or auxiliary detection gram-positive bacterium drug resistant gene, or prepare for detecting or aiding in detection leather blue
The product of family name's positive bacteria drug resistant gene;
(b) detect or auxiliary detection the bacterium containing gram-positive bacterium drug resistant gene, or prepare for detect or
The product of auxiliary bacterium of the detection containing gram-positive bacterium drug resistant gene.
9. according to any primer pair group in claim 1-8 or complete single stranded DNA or kit or application, its
It is characterised by:The gram-positive bacterium drug resistant gene be it is following at least one:MecA genes, vanA bases
Cause, vanB genes.
10. the complete single stranded DNA described in the primer pair group or claim 2 described in claim 1 is preparing right
It is required that the application in 3-7 in any described kit.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510941151.1A CN106884038A (en) | 2015-12-16 | 2015-12-16 | A kind of gene chip kit for detecting gram-positive bacterium drug resistant gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510941151.1A CN106884038A (en) | 2015-12-16 | 2015-12-16 | A kind of gene chip kit for detecting gram-positive bacterium drug resistant gene |
Publications (1)
Publication Number | Publication Date |
---|---|
CN106884038A true CN106884038A (en) | 2017-06-23 |
Family
ID=59174629
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510941151.1A Pending CN106884038A (en) | 2015-12-16 | 2015-12-16 | A kind of gene chip kit for detecting gram-positive bacterium drug resistant gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106884038A (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999001571A2 (en) * | 1997-07-03 | 1999-01-14 | Id Biomedical Corporation | Compositions and methods for detecting vancomycin resistant enterococci by cycling probe reactions |
WO2001012803A2 (en) * | 1999-08-17 | 2001-02-22 | Beth Israel Deaconess Medical Center, Inc. | Methods and compositions for restoring antibiotic susceptibility in glycopeptide-resistant enterococcus |
CN1687459A (en) * | 2005-04-15 | 2005-10-26 | 北京博奥生物芯片有限责任公司 | Authenticating gram positive bacteria species and method for testing drug resistant gene and dedicating kit |
US20140256582A1 (en) * | 2013-03-05 | 2014-09-11 | Intelligent Medical Devices, Inc. | Optimized probes and primers and methods of using same for the detection, screening, isolation and sequencing of mrsa, mssa, staphylococcus markers, and the antibiotic resistance gene mec a |
-
2015
- 2015-12-16 CN CN201510941151.1A patent/CN106884038A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999001571A2 (en) * | 1997-07-03 | 1999-01-14 | Id Biomedical Corporation | Compositions and methods for detecting vancomycin resistant enterococci by cycling probe reactions |
WO2001012803A2 (en) * | 1999-08-17 | 2001-02-22 | Beth Israel Deaconess Medical Center, Inc. | Methods and compositions for restoring antibiotic susceptibility in glycopeptide-resistant enterococcus |
CN1687459A (en) * | 2005-04-15 | 2005-10-26 | 北京博奥生物芯片有限责任公司 | Authenticating gram positive bacteria species and method for testing drug resistant gene and dedicating kit |
US20140256582A1 (en) * | 2013-03-05 | 2014-09-11 | Intelligent Medical Devices, Inc. | Optimized probes and primers and methods of using same for the detection, screening, isolation and sequencing of mrsa, mssa, staphylococcus markers, and the antibiotic resistance gene mec a |
Non-Patent Citations (2)
Title |
---|
BALLARD,S.A.ET AL.: "AY655711.1", 《GENBANK》 * |
TANEIKE,I.ET AL.: "AB221119.1", 《GENBANK》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106884037A (en) | A kind of gene chip kit of detection bacterium drug resistant gene | |
CN104328167B (en) | Can the genetic chip of ten kinds of Main Pathogenic Bacterias of parallel detection mastitis for milk cows and detection method | |
RU2270254C2 (en) | Identification of transgenic dna sequences in plant material and products made of the same, oligonucleotide kit and bioarray therefor | |
CN109517925A (en) | Flax SSR molecular marker and its application | |
CN106498036A (en) | A kind of construction method in the Drug Discovery SNP variations library for high-flux sequence detection and its application | |
CN108642208A (en) | A kind of Cinnamomum and its general SSR molecular marker of relative genus plant and its development approach and application | |
CN106884039B (en) | A kind of gene chip kit for detecting gramnegative bacterium drug resistant gene | |
CN101724691B (en) | Method for quantitatively detecting methylation level of CD11a and CD70 genes | |
CN106987623A (en) | A kind of primer of pyrosequencing joint PCR sequencing PCR detection alcohol metabolism gene and its application | |
CN105063237B (en) | The genetic chip and its detection method identified for six kinds of swine disease cause of diseases | |
CN105297141A (en) | Micro-array chip detection method for 10 on-melon diseases and used chip probe | |
CN101591713A (en) | Gosling plague virus LAMP detection kit and detection method thereof | |
CN106884038A (en) | A kind of gene chip kit for detecting gram-positive bacterium drug resistant gene | |
CN104830848A (en) | Reverse dot blot hybridization kit for detection of mycobacterium tuberculosis and usage method thereof | |
CN109097488A (en) | For synchronizing nucleic acid, method and the kit of five kinds of dog diarrhea virus of detection and identification | |
WO2021039777A1 (en) | Method for examining rheumatoid arthritis | |
CN202595152U (en) | Glass gene chip for detecting fur carried virus | |
CN105256041A (en) | Specific nucleotide for aeromonas hydrophila O44, O24, O25 and O28 and application thereof | |
RU2583924C1 (en) | METHOD FOR MULTIPLEX PCR DETECTION OF Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens AND Eggerthella spp. IN CLINICAL MATERIAL | |
CN110484640A (en) | The ARMS-PCR primer and its molecular detecting method of sulfanilamide (SN) drug resistance Eimeria Tenella | |
CN110317891A (en) | For detecting primer sets, reagent, kit, application and the detection method of Lactobacillus rhamnosus LV108 | |
CN110343743A (en) | For identifying primer sets, reagent, kit, application and the identification method of tip of a root dental papilla stem cell | |
CN109161614B (en) | Visual chip for avian influenza typing | |
US20050048524A1 (en) | Molecular biological identification techniques for microorganisms | |
KR102147327B1 (en) | A composition for detecting Ganoderma microorganism and diagnosing basal stem rot and a method using the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170623 |
|
RJ01 | Rejection of invention patent application after publication |