CN106868184A - Detect method, kit, oligonucleotides and its application of PKLR gene mutations - Google Patents
Detect method, kit, oligonucleotides and its application of PKLR gene mutations Download PDFInfo
- Publication number
- CN106868184A CN106868184A CN201710218899.8A CN201710218899A CN106868184A CN 106868184 A CN106868184 A CN 106868184A CN 201710218899 A CN201710218899 A CN 201710218899A CN 106868184 A CN106868184 A CN 106868184A
- Authority
- CN
- China
- Prior art keywords
- pklr
- sequencing
- pair
- oligonucleotides
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer and method for detecting autosomal recessive hereditary diseases pyruvate kinase deficiency patient's PKLR gene mutations, it includes that (i) expands the primer of the full exon sequence of PKLR genes；Using Sanger sequencing technologies and sequencing primer.The present invention can rapidly by the abrupt climatic change of the full extron of PKLR genes in pyruvate kinase deficiency patient's body out.The testing result completed using the present invention is accurate, can have important reference significance to early intervention, early treatment and pre-natal diagnosis with auxiliary diagnosis pyruvate kinase deficiency.
Description
Background technology
Red blood cell pyruvate kinase is one of three crucial rate-limiting enzymes of glycolytic pathway.It act as catalytic phosphatase ketenes
Formula conversion of pyruvate is pyruvic acid, while producing ATP for red blood cell provides energy.Pyruvate kinase (pyruvate kinase,
PK) there are four kinds of isodynamic enzymes：L, R, M1, M2, wherein R types are present in the red blood cell of maturation, by PKLR gene codes.In red blood cell
Pyruvate kinase heredity lack can cause energy metabolism of erythrocyte exception, aspheric cellularity hemolytic anemia, its molecule
Then there is the mutation of PKLR genes in level.
PKLR genes are located at No. 1 band of 2nd area of chromosome long arm 1, comprising 11 extrons, 574 amino acid are encoded altogether.PKLR
Gene mutation is the major reason of pyruvate kinase deficiency.From after prime report in 1961, find altogether both at home and abroad so far
More than 200 example PKLR are mutated.The mutation species of PKLR almost spreads over whole gene, and most common of which sports missense mutation, bag
Include the hot spot mutation 1529G of US and European>A, the hot spot mutation 1456C in southern Europe>The T and 1468C in Asia>T.
Up to the present the mutation of PKLR genes is how to cause enzymoprivic mechanism to be not yet fully apparent from, its possible cause
Have：Fractional mutations are located at Pyruvate kinase activity center, change the adhesion of substrate PEP；Fractional mutations
Hydrophobicity near possible mutagenesis point declines, and influences K+It is in connection, cause Km to raise；Mutation meeting of the minority positioned at C areas
Make structural change, connected between weakening subunit, influence tripolymer is formed, so as to reduce the activity of pyruvate kinase.
There is the blood transfusion throughout one's life of severe anemia, needs in neonatal period when the patient of pyruvate kinase deficiency is serious.Mesh
Preceding clinic diagnoses pyruvate kinase deficiency to detect the method for Pyruvate kinase activity, but this is subject to the shadow of many factors
Ring, so no matter to being patient or for pre-natal diagnosis, full extron sequencing is carried out to PKLR genes all have to weigh very much
The meaning wanted.
The content of the invention
It is an object of the invention to provide the oligonucleotides of detection PKLR gene mutations, using round pcr, can be used for quick
PKLR gene extron catastrophes in detection pyruvate kinase deficiency patient's body.The oligonucleotides includes at least one pair of
The primer of PKLR gene extrons is expanded, described at least one pair of amplimer is selected from PKLR-1F/PKLR-1R, PKLR-2F/
PKLR-2R、PKLR-3-4-5F/PKLR-3-4-5R、PKLR-6-7F/PKLR-6-7R、PKLR-8-9F/PKLR-8-9R、PKLR-
10F/PKLR-10R, or PKLR-11F/PKLR-11R, its base sequence is：
PKLR-1F：TGTAAAACGACGGCCAGTAGAGGAAATGCCAGGAGATGA；
PKLR-1R：AACAGCTATGACCATGTTCACCCTCATTTTCCTCCTAT；
PKLR-2F：TGTAAAACGACGGCCAGTAGAGGGTATGCTGAGAGACGAA；
PKLR-2R：AACAGCTATGACCATGAAGAAGCACCTCAAGAAATACCA；
PKLR-3-4-5F：TGTAAAACGACGGCCAGTGGGTTGCATCAGGGAATAAA；
PKLR-3-4-5R：AACAGCTATGACCATGGCCAAGGAGAAGGGAATGTG；
PKLR-6-7F：TGTAAAACGACGGCCAGTGACTATGGGTGGGTCGTTTCT；
PKLR-6-7R：AACAGCTATGACCATGCACCCACAGGTGTCCCTAAAA；
PKLR-8-9F：TGTAAAACGACGGCCAGTGTGTGGGTGTCAGAGAAGTAGC；
PKLR-8-9R：AACAGCTATGACCATGTGGCATTCTGTCTCTCCTGG；
PKLR-10F：TGTAAAACGACGGCCAGTGTGACACCTGGAACTGGAACA；
PKLR-10R：AACAGCTATGACCATGGACCACAGGAGAGAGGCAAG；
PKLR-11F：TGTAAAACGACGGCCAGTGCCAGGCTGGTCTCAAACT；
PKLR-11R：AACAGCTATGACCATGATGAGAATGGGAGACTGTGGA.
Further, the oligonucleotides also includes a pair of sequencing primers M13F and M13R, and its base sequence is：
M13F：TGTAAAACGACGGCCAGT；
M13R：AACAGCTATGACCATG.
Further, PKLR-1F：PKLR-1R、PKLR-2F：PKLR-2R、PKLR-3-4-5F：PKLR-3-4-5R、
PKLR-6-7F：PKLR-6-7R、PKLR-8-9F：PKLR-8-9R、PKLR-10F：PKLR-10R, or PKLR-11F：PKLR-11R
Ratio be 1.
Further, M13F：The ratio of M13R is 1.
Further, application of the oligonucleotides in auxiliary detection pyruvate kinase deficiency.
The present invention also aims to provide a kind of method of detection PKLR gene mutations, comprise the following steps：
(1) genomic DNA in extracting sample；
(2) DNA in (1) is expanded using at least one pair of amplimer, obtains amplified production；
(3) amplified production in (2) is sequenced using a pair of sequencing primer M13F and M13R, obtains the amplification and produce
The base sequence of thing；
(4) base sequence in (3) is compared with PKLR gene wild-type reference sequences, whether determines mutational site
In the presence of, wherein, described at least one pair of amplimer is selected from PKLR-1F/PKLR-1R, PKLR-2F/PKLR-2R, PKLR-3-4-
5F/PKLR-3-4-5R, PKLR-6-7F/PKLR-6-7R, PKLR-8-9F/PKLR-8-9R, PKLR-10F/PKLR-10R, or
PKLR-11F/PKLR-11R, its base sequence is：
PKLR-1F：TGTAAAACGACGGCCAGTAGAGGAAATGCCAGGAGATGA；
PKLR-1R：AACAGCTATGACCATGTTCACCCTCATTTTCCTCCTAT；
PKLR-2F：TGTAAAACGACGGCCAGTAGAGGGTATGCTGAGAGACGAA；
PKLR-2R：AACAGCTATGACCATGAAGAAGCACCTCAAGAAATACCA；
PKLR-3-4-5F：TGTAAAACGACGGCCAGTGGGTTGCATCAGGGAATAAA；
PKLR-3-4-5R：AACAGCTATGACCATGGCCAAGGAGAAGGGAATGTG；
PKLR-6-7F：TGTAAAACGACGGCCAGTGACTATGGGTGGGTCGTTTCT；
PKLR-6-7R：AACAGCTATGACCATGCACCCACAGGTGTCCCTAAAA；
PKLR-8-9F：TGTAAAACGACGGCCAGTGTGTGGGTGTCAGAGAAGTAGC；
PKLR-8-9R：AACAGCTATGACCATGTGGCATTCTGTCTCTCCTGG；
PKLR-10F：TGTAAAACGACGGCCAGTGTGACACCTGGAACTGGAACA；
PKLR-10R：AACAGCTATGACCATGGACCACAGGAGAGAGGCAAG；
PKLR-11F：TGTAAAACGACGGCCAGTGCCAGGCTGGTCTCAAACT；
PKLR-11R：AACAGCTATGACCATGATGAGAATGGGAGACTGTGGA；
M13F：TGTAAAACGACGGCCAGT；
M13R：AACAGCTATGACCATG.
Further, PKLR-1F：PKLR-1R、PKLR-2F：PKLR-2R、PKLR-3-4-5F：PKLR-3-4-5R、
PKLR-6-7F：PKLR-6-7R、PKLR-8-9F：PKLR-8-9R、PKLR-10F：PKLR-10R, or PKLR-11F：PKLR-11R
Ratio be 1.
Further, M13F：The ratio of M13R is 1.
Further, application of the methods described in auxiliary detection pyruvate kinase deficiency.
The present invention also aims to provide a kind of kit of detection PKLR gene mutations, the kit includes detection
System pcr amplification reaction liquid, sequencing system reaction solution, wherein, detection architecture pcr amplification reaction liquid draws including at least one pair of amplification
Thing, the sequencing system reaction solution includes a pair of sequencing primers M13F and M13R, and described at least one pair of amplimer is selected from PKLR-
1F/PKLR-1R、PKLR-2F/PKLR-2R、PKLR-3-4-5F/PKLR-3-4-5R、PKLR-6-7F/PKLR-6-7R、PKLR-
8-9F/PKLR-8-9R, PKLR-10F/PKLR-10R, or PKLR-11F/PKLR-11R, its base sequence is：
PKLR-1F：TGTAAAACGACGGCCAGTAGAGGAAATGCCAGGAGATGA；
PKLR-1R：AACAGCTATGACCATGTTCACCCTCATTTTCCTCCTAT；
PKLR-2F：TGTAAAACGACGGCCAGTAGAGGGTATGCTGAGAGACGAA；
PKLR-2R：AACAGCTATGACCATGAAGAAGCACCTCAAGAAATACCA；
PKLR-3-4-5F：TGTAAAACGACGGCCAGTGGGTTGCATCAGGGAATAAA；
PKLR-3-4-5R：AACAGCTATGACCATGGCCAAGGAGAAGGGAATGTG；
PKLR-6-7F：TGTAAAACGACGGCCAGTGACTATGGGTGGGTCGTTTCT；
PKLR-6-7R：AACAGCTATGACCATGCACCCACAGGTGTCCCTAAAA；
PKLR-8-9F：TGTAAAACGACGGCCAGTGTGTGGGTGTCAGAGAAGTAGC；
PKLR-8-9R：AACAGCTATGACCATGTGGCATTCTGTCTCTCCTGG；
PKLR-10F：TGTAAAACGACGGCCAGTGTGACACCTGGAACTGGAACA；
PKLR-10R：AACAGCTATGACCATGGACCACAGGAGAGAGGCAAG；
PKLR-11F：TGTAAAACGACGGCCAGTGCCAGGCTGGTCTCAAACT；
PKLR-11R：AACAGCTATGACCATGATGAGAATGGGAGACTGTGGA；
M13F：TGTAAAACGACGGCCAGT；
M13R：AACAGCTATGACCATG.
Further, PKLR-1F：PKLR-1R、PKLR-2F：PKLR-2R、PKLR-3-4-5F：PKLR-3-4-5R、
PKLR-6-7F：PKLR-6-7R、PKLR-8-9F：PKLR-8-9R、PKLR-10F：PKLR-10R, or PKLR-11F：PKLR-11R
Ratio be 1.
Further, M13F：The ratio of M13R is 1.
Further, the detection architecture pcr amplification reaction liquid also includes 2 × PCR Buffer, dNTPs and KOD FX
DNA Polymerase。
Further, the sequencing system reaction solution also includes sequencing refined solution, calf intestinal alkaline phosphatase, EDTA, nothing
Water-ethanol, 75% ethanol, HIDI and Bigdye Terminator V3.1.
Further, the sequencing refined solution includes exonuclease I, calf intestinal alkaline phosphatase.
Further, the kit also includes positive reference substance, negative controls and blank product.
Further, application of the kit in auxiliary detection pyruvate kinase deficiency.
Further, primer sequence PKLR-1F and PKLR-1R are the primers for expanding the exon sequence of PKLR genes the 1st,
Primer sequence PKLR-2F and PKLR-2R are the primer for expanding the exon sequence of PKLR genes the 2nd, primer sequence PKLR-3-4-
5F and PKLR-3-4-5R are the primers for expanding PKLR genes the 3rd, 4 and 5 exon sequences, primer sequence PKLR-6-7F and
PKLR-6-7R is amplification PKLR genes the 6th, the primer of 7 exon sequences, and primer sequence PKLR-8-9F and PKLR-8-9R are
Amplification PKLR genes the 8th, the primer of 9 exon sequences, primer sequence PKLR-10F and PKLR-10R are amplification PKLR genes
The primer of the 10th exon sequence, primer sequence PKLR-11F and PKLR-11R are amplification PKLR gene o.11 extron sequences
The primer of row.
Beneficial effect：(1) present invention devises amplification PKLR genes all 11 primers of exon sequence, by adjunction
Head, making the PCR primer of all 7 pairs of primers can be sequenced with a pair of sequencing primers, and existing sequencing technologies will be to every
Plant amplified production and design specific sequencing primer, this is accomplished by 7 sequencing primers of design (unidirectional sequencing) or 14 sequencings are drawn
Thing (two-way sequencing), therefore, primer of the present invention all can amplify the full exon sequences of the PKLR to come, and also ensure nothing
Undergone mutation by the where position of these extrons, all without there is the situation of missing inspection；(2) when primer is designed, by allowing
The exon of 3rd, 4 and 5 of PKLR genes shares pair of primers, allows the 6th and 7 exons of PKLR genes to share a pair and draws
Thing, allows the 8th and 9 exons of PKLR genes to share pair of primers, significantly reduces the quantity of amplimer, and this can also reduce expansion
Increase production the quantity of thing, so as to reduce the quantity of sequencing primer, thus greatly reduce testing cost；(3) present invention uses PCR skills
Art, by adjusting the reaction conditions such as primer concentration, annealing temperature, can be such that amplification efficiency reaches most preferably；(4) conventional fluorescent quantitation
PCR methods will be directed to the PKLR genes multiple probes of numerous mutational sites design that all 11 extrons may undergo mutation, therefore,
In 11 extrons, it is assumed that each extron has 3 mutational sites, then to design 33 probes, and testing cost significantly increases
Plus, and the present invention adds joint by the amplimer to design, it is only necessary to just can detect this 33 using a pair of sequencing primers and dash forward
Become site and also undiscovered other mutation types, so that testing cost is significantly reduced.
Brief description of the drawings
Fig. 1 is PKLR genes positioning figure on chromosome.
Fig. 2 is PKLR-1F/PKLR-1R, PKLR-2F/PKLR-2R, PKLR-3-4-5F/PKLR-3-4-5R, PKLR-6-
The electrophoretogram of 7F/PKLR-6-7R, PKLR-8-9F/PKLR-8-9R, PKLR-10F/PKLR-10R, PKLR-11F/PKLR-11R.
Fig. 3,4,5,6,7,8,9 are respectively the PKLR genes the 1st, 2,3/4/5,6/7,8/9,10,11 exons of sample 1
Wild type is sequenced sectional drawing.
Specific embodiment
With reference to specific embodiments and the drawings, the present invention is expanded on further.It should be noted that not specified in embodiment
Normal condition and method, generally according to art experimenter routinely use method：For example, Ao Sibai and James Kingston are edited
's《Fine works molecular biology experiment guide》Fourth edition, or according to the step and condition proposed by manufacturer.
Embodiment 1
A kind of oligonucleotides in detection PKLR gene polymorphics mutational site, the oligonucleotides is directed to PKLR genes at least
Designed by individual extron, including at least one pair of amplimer, described at least one pair of amplimer is selected from PKLR-1F/PKLR-
1R、PKLR-2F/PKLR-2R、PKLR-3-4-5F/PKLR-3-4-5R、PKLR-6-7F/PKLR-6-7R、PKLR-8-9F/
PKLR-8-9R, PKLR-10F/PKLR-10R, or PKLR-11F/PKLR-11R, its base sequence is：
PKLR-1F：TGTAAAACGACGGCCAGTAGAGGAAATGCCAGGAGATGA；
PKLR-1R：AACAGCTATGACCATGTTCACCCTCATTTTCCTCCTAT；
PKLR-2F：TGTAAAACGACGGCCAGTAGAGGGTATGCTGAGAGACGAA；
PKLR-2R：AACAGCTATGACCATGAAGAAGCACCTCAAGAAATACCA；
PKLR-3-4-5F：TGTAAAACGACGGCCAGTGGGTTGCATCAGGGAATAAA；
PKLR-3-4-5R：AACAGCTATGACCATGGCCAAGGAGAAGGGAATGTG；
PKLR-6-7F：TGTAAAACGACGGCCAGTGACTATGGGTGGGTCGTTTCT；
PKLR-6-7R：AACAGCTATGACCATGCACCCACAGGTGTCCCTAAAA；
PKLR-8-9F：TGTAAAACGACGGCCAGTGTGTGGGTGTCAGAGAAGTAGC；
PKLR-8-9R：AACAGCTATGACCATGTGGCATTCTGTCTCTCCTGG；
PKLR-10F：TGTAAAACGACGGCCAGTGTGACACCTGGAACTGGAACA；
PKLR-10R：AACAGCTATGACCATGGACCACAGGAGAGAGGCAAG；
PKLR-11F：TGTAAAACGACGGCCAGTGCCAGGCTGGTCTCAAACT；
PKLR-11R：AACAGCTATGACCATGATGAGAATGGGAGACTGTGGA.
The oligonucleotides also includes a pair of sequencing primers M13F and M13R, and its base sequence is：
M13F：TGTAAAACGACGGCCAGT；
M13R：AACAGCTATGACCATG.
A kind of kit of detection PKLR gene mutations, including detection architecture pcr amplification reaction liquid and sequencing system reaction
Liquid, wherein,
Detection architecture pcr amplification reaction liquid includes：2×PCR Buffer(10.0μL)；dNTPs(2mM)；KOD FX DNA
Polymerase(1U/μl)；Upstream and downstream primer PKLR-1F (10 μM) of PKLR gene 11 extrons, PKLR-1R (10 μM),
PKLR-2F(10μM)、PKLR-2R(10μM)、PKLR-3-4-5F(10μM)、PKLR-3-4-5R(10μM)、PKLR-6-7F(10μ
M)、PKLR-6-7R(10μM)、PKLR-8-9F(10μM)、PKLR-8-9R(10μM)、PKLR-10F(10μM)、PKLR-10R(10
μM)、PKLR-11F(10μM)、PKLR-11R(10μM)。
Sequencing system reaction solution includes：Sequencing refined solution (exonuclease I:0.6U, calf intestinal alkaline phosphatase:
1.2U)；EDTA(125mM)；Absolute ethyl alcohol；75% ethanol；HIDI (height deionized formamide)；A pair of sequencing primer M13F
(3.2μM)、M13R(3.2μM)；Bigdye Terminator V3.1 (are bought from Applied Biosystems companies of the U.S.).
Preferably, the kit also includes blood DNA extraction agent.
Preferably, the kit also includes positive reference substance, negative controls and blank product.Positive reference substance be containing
The solution of someone's PKLR gene extrons DNA, forbids multigelation.Negative controls are ddH2O.Blank product are given birth to for 2 μ l
Reason salt solution is not added with any material.
The blood sample DNA of embodiment 2 is extracted
Blood sample DNA is extracted (according to Tiangeng biological blood/cell/tissue gene DNA extracts kit specification)：Take out
Human blood sample DNA is carried, specific method for extracting is as follows：
(1) 300 μ l blood are extracted and adds 900 μ l erythrocyte cracked liquids, overturned and mix, room temperature is placed 5 minutes, and period runs again
Mix several times.12000rpm is centrifuged 1min, sucks supernatant, leaves leukocyte cell pellet, plus 200 μ l buffer solution GA, and vibration is to thorough
Bottom mixes；
(2) 20 μ l Proteinase K Solutions are added, is mixed；
(3) 200 μ l buffer solution GB are added, fully reverse to mix, 70 DEG C are placed 10 minutes, and solution strain is limpid, briefly from
The heart is removing the globule of cap wall；
(4) 200 μ l absolute ethyl alcohols are added, fully vibration is mixed 15 seconds, now it is possible that flocculent deposit, brief centrifugation
To remove the globule of cap wall；
(5) previous step resulting solution and flocculent deposit all add in an adsorption column CB3 (adsorption column is put into collecting pipe
In), 12000rpm is centrifuged 30 seconds, outwells waste liquid, and adsorption column CB3 is put back in collecting pipe；
(6) to adding 500 μ l buffer solutions GD (please first checked whether before and added absolute ethyl alcohol) in adsorption column CB3,
12000rpm is centrifuged 30 seconds, outwells waste liquid, and adsorption column CB3 is put into collecting pipe；
(7) to adding 700 μ l rinsing liquids PW (please first checked whether before and added absolute ethyl alcohol) in adsorption column CB3,
12000rpm is centrifuged 30 seconds, outwells waste liquid, and adsorption column CB3 is put into collecting pipe；
(8) to 500 μ l rinsing liquids PW, 12000rpm centrifugation 30 seconds is added in adsorption column CB3, waste liquid is outwelled；
(9) adsorption column CB3 is put back in collecting pipe, 12000rpm is centrifuged 2 minutes, outwells waste liquid, and adsorption column CB3 is placed in
Room temperature places several minutes, thoroughly to dry the rinsing liquid of remnants in sorbing material；
(10) adsorption column CB3 is transferred in a clean centrifuge tube, 100 μ l is vacantly added dropwise to the middle part of adsorbed film
Elution buffer TE, room temperature is placed 2~5 minutes, and 12000rpm is centrifuged 2 minutes, and solution is collected into centrifuge tube.
The sample DNA of embodiment 3 is expanded
According to the blood sample DNA that embodiment 2 is extracted, then using the amplimer amplification people's PKLR bases in embodiment 1
Because of extron, amplified production is obtained.Carried out on Standard PCR instrument during amplification, the ABI veriti (U.S. can be included with instrument
Applied Biosystems companies) etc..Note at foot：
I () presses sample number n (sample number=1+positive control of number of awaiting test sample+negative control, 1+blank 1)
Survey system pcr amplification reaction liquid is taken, often the μ L of pipe 19 are sub-packed in reaction tube；
(ii) the above-mentioned sample to be tested handled well and negative controls, positive reference substance are respectively taken into 1 μ L and is separately added into reaction
Guan Zhong, mixes, the low-speed centrifugal several seconds, enters performing PCR amplification, obtains amplified production.Survey system pcr amplification reaction liquid making method is such as
Shown in table 1.PCR amplification amplification reaction conditions are as shown in table 2.The details of each pair amplimer are as shown in table 3.
Table 1. is surveyed system pcr amplification reaction liquid and is prepared
Note：PrimerF and PrimerR in table are selected from PKLR-1F/PKLR-1R, PKLR-2F/PKLR-2R, PKLR-3-
4-5F/PKLR-3-4-5R, PKLR-6-7F/PKLR-6-7R, PKLR-8-9F/PKLR-8-9R, PKLR-10F/PKLR-10R, or
PKLR-11F/PKLR-11R。
Table 2.PCR amplification reaction conditions
The each pair amplimer information of table 3.
The Sanger of embodiment 4 is sequenced
The sequencing refined solution in the amplified production and 2 μ l embodiments 1 in 9 μ l embodiments 3 is taken according to the program described in table 4
Purified, so as to obtain purified product.
The purifying procedure of table 4
The purified product that 1 μ l are obtained respectively with embodiment 1 in sequencing primer M13F (3.2 μM), M13R (3.2 μM)
Mixed according to the system in table 5, be then sequenced according to the sequencing reaction program in table 6.
Table 5
The sequencing reaction program of table 6.
Precipitation link：
To the EDTA that 2 μ l 125mM are added in the product for completing sequencing reaction, 5min is stood；Add 15l absolute ethyl alcohols, whirlpool
Whirlpool mixes；3700rpm is centrifuged 30min；Centrifugation 15sec is inverted, adds the ethanol of 50l 70%, whirlpool to mix；3700rpm is centrifuged
15min；Centrifugation 15sec is inverted, is placed on 95 DEG C of metal baths；Denatured test is carried out after adding 10 μ l HIDI.Denatured test step
For：95 DEG C, 5min；Then in -30 DEG C of 2min, then in 4 DEG C of preservations.
After denaturation program terminates, upper sequenator (ABI3730) sequencing.
Result judges：
Respectively by sequencing result and PKLR wild-type reference sequences (Genbank accn：NC_000001.11) compared
It is right, result is reported according to actual catastrophe.
The clinical sample of embodiment 5 is detected
3 clinical blood samples (sample number is 1~3) are taken successively according to embodiment 1, embodiment 2, embodiment 3 and reality
Apply example 4, reagent preparation, extracting sample DNA, amplification (acquisition amplified production) and sequencing.Every part of sample reacts toward detection architecture PCR
1 μ l are added in liquid.
Utilize obtained amplified production, carry out DNA electrophoresis, deposition condition is 1.5% agarose gel electrophoresis, 110V,
25min, gel imaging system observation.Electrophoresis result is as shown in Figure 2.
Fig. 2 is this 3 blood samples with PKLR-1F/PKLR-1R, PKLR-2F/PKLR-2R, PKLR-3-4-5F/PKLR-
3-4-5R, PKLR-6-7F/PKLR-6-7R, PKLR-8-9F/PKLR-8-9R, PKLR-10F/PKLR-10R and PKLR-11F/
The electrophoresis pattern of gained amplified production after 7 pairs of amplimer amplifications such as PKLR-11R, M is Marker DL 2000,1~3 to send
The blood sample numbering of inspection 1~3.The fragment length of this 6 pairs of primers amplification be respectively 335bp, 322bp, 838bp, 766bp,
662bp, 373bp, 644bp, by the analysis shows of electrophoretogram, this 7 pairs of primers are expanded effectively, and band is single.
In this 3 samples, it is described in detail by taking sample 1 as an example.The sequencing result of sample 1 is as shown in figs. 3-9.
Fig. 3 show be sample 1 the exon wild type of PKLR genes the 1st sequencing sectional drawing, illustrate that 1 extra of sample 1 is aobvious
Son is not undergone mutation.
Fig. 4 show be sample 1 the exon wild type of PKLR genes the 2nd sequencing sectional drawing, illustrate that 2 extras of sample 1 are aobvious
Son is not undergone mutation.
Fig. 5 show be sample 1 the exon wild type of PKLR genes the 3rd, 4,5 sequencing sectional drawing, illustrate sample 13,4,
5 exons are not undergone mutation.
Fig. 6 show be sample 1 PKLR genes the 6th, 7 exon wild types sequencing sectional drawing, illustrate 6, No. 7 of sample 1
Extron is not undergone mutation.
Fig. 7 show be sample 1 PKLR genes the 8th, 9 exon wild types sequencing sectional drawing, illustrate 8, No. 9 of sample 1
Extron is not undergone mutation.
Fig. 8 show be sample 1 the exon wild type of PKLR genes the 10th sequencing sectional drawing, illustrate 10 extras of sample 1
Aobvious son is not undergone mutation.
Fig. 9 show be sample 1 PKLR gene o.11 extrons wild type sequencing sectional drawing, illustrate 11 extras of sample 1
Aobvious son is not undergone mutation.
From testing result as can be seen that primer of the present invention is PKLR genes, totally 11 exon sequences are included in
It is interior, PKLR genes all 11 extrons, and sequencing result entirely accurate can be expanded.From testing result, sample
This 1 11 extron is wild type.In addition, the detection to PKLR gene extrons mutation positive sample also indicates that the present invention
Oligonucleotides, method and kit be capable of detecting when the catastrophe of PKLR gene extrons mutation.
SEQUENCE LISTING
<110>ADICON Clinical Laboratories, Inc.
<120>Detect method, kit, oligonucleotides and its application of PKLR gene mutations
<130>
<160> 16
<170> PatentIn version 3.5
<210> 1
<211> 39
<212> DNA
<213>Artificial sequence
<400> 1
tgtaaaacga cggccagtag aggaaatgcc aggagatga 39
<210> 2
<211> 38
<212> DNA
<213>Artificial sequence
<400> 2
aacagctatg accatgttca ccctcatttt cctcctat 38
<210> 3
<211> 40
<212> DNA
<213>Artificial sequence
<400> 3
tgtaaaacga cggccagtag agggtatgct gagagacgaa 40
<210> 4
<211> 39
<212> DNA
<213>Artificial sequence
<400> 4
aacagctatg accatgaaga agcacctcaa gaaatacca 39
<210> 5
<211> 38
<212> DNA
<213>Artificial sequence
<400> 5
tgtaaaacga cggccagtgg gttgcatcag ggaataaa 38
<210> 6
<211> 36
<212> DNA
<213>Artificial sequence
<400> 6
aacagctatg accatggcca aggagaaggg aatgtg 36
<210> 7
<211> 39
<212> DNA
<213>Artificial sequence
<400> 7
tgtaaaacga cggccagtga ctatgggtgg gtcgtttct 39
<210> 8
<211> 37
<212> DNA
<213>Artificial sequence
<400> 8
aacagctatg accatgcacc cacaggtgtc cctaaaa 37
<210> 9
<211> 40
<212> DNA
<213>Artificial sequence
<400> 9
tgtaaaacga cggccagtgt gtgggtgtca gagaagtagc 40
<210> 10
<211> 36
<212> DNA
<213>Artificial sequence
<400> 10
aacagctatg accatgtggc attctgtctc tcctgg 36
<210> 11
<211> 39
<212> DNA
<213>Artificial sequence
<400> 11
tgtaaaacga cggccagtgt gacacctgga actggaaca 39
<210> 12
<211> 36
<212> DNA
<213>Artificial sequence
<400> 12
aacagctatg accatggacc acaggagaga ggcaag 36
<210> 13
<211> 37
<212> DNA
<213>Artificial sequence
<400> 13
tgtaaaacga cggccagtgc caggctggtc tcaaact 37
<210> 14
<211> 37
<212> DNA
<213>Artificial sequence
<400> 14
aacagctatg accatgatga gaatgggaga ctgtgga 37
<210> 15
<211> 18
<212> DNA
<213>Artificial sequence
<400> 15
tgtaaaacga cggccagt 18
<210> 16
<211> 16
<212> DNA
<213>Artificial sequence
<400> 16
aacagctatg accatg 16
Claims (10)
1. a kind of kit of detection PKLR gene mutations, the kit includes detection architecture pcr amplification reaction liquid, sequencing body
It is reaction solution, it is characterised in that the detection architecture pcr amplification reaction liquid includes at least one pair of amplimer, the sequencing body
Be reaction solution include a pair of sequencing primers M13F and M13R, described at least one pair of amplimer be selected from PKLR-1F/PKLR-1R,
PKLR-2F/PKLR-2R、PKLR-3-4-5F/PKLR-3-4-5R、PKLR-6-7F/PKLR-6-7R、PKLR-8-9F/PKLR-8-
9R, PKLR-10F/PKLR-10R, or PKLR-11F/PKLR-11R, its base sequence is：
PKLR-1F：TGTAAAACGACGGCCAGTAGAGGAAATGCCAGGAGATGA；
PKLR-1R：AACAGCTATGACCATGTTCACCCTCATTTTCCTCCTAT；
PKLR-2F：TGTAAAACGACGGCCAGTAGAGGGTATGCTGAGAGACGAA；
PKLR-2R：AACAGCTATGACCATGAAGAAGCACCTCAAGAAATACCA；
PKLR-3-4-5F：TGTAAAACGACGGCCAGTGGGTTGCATCAGGGAATAAA；
PKLR-3-4-5R：AACAGCTATGACCATGGCCAAGGAGAAGGGAATGTG；
PKLR-6-7F：TGTAAAACGACGGCCAGTGACTATGGGTGGGTCGTTTCT；
PKLR-6-7R：AACAGCTATGACCATGCACCCACAGGTGTCCCTAAAA；
PKLR-8-9F：TGTAAAACGACGGCCAGTGTGTGGGTGTCAGAGAAGTAGC；
PKLR-8-9R：AACAGCTATGACCATGTGGCATTCTGTCTCTCCTGG；
PKLR-10F：TGTAAAACGACGGCCAGTGTGACACCTGGAACTGGAACA；
PKLR-10R：AACAGCTATGACCATGGACCACAGGAGAGAGGCAAG；
PKLR-11F：TGTAAAACGACGGCCAGTGCCAGGCTGGTCTCAAACT；
PKLR-11R：AACAGCTATGACCATGATGAGAATGGGAGACTGTGGA；
M13F：TGTAAAACGACGGCCAGT；
M13R：AACAGCTATGACCATG.
2. kit as claimed in claim 1, it is characterised in that the detection architecture pcr amplification reaction liquid also includes 2 ×
PCR Buffer, dNTPs and KOD FX DNA Polymerase.
3. kit as claimed in claim 1, it is characterised in that the sequencing system reaction solution also include sequencing refined solution,
Calf intestinal alkaline phosphatase, EDTA, absolute ethyl alcohol, 75% ethanol, HIDI and Bigdye Terminator V3.1.
4. kit as claimed in claim 3, it is characterised in that the sequencing refined solution includes exonuclease I, calf intestinal
Alkaline phosphatase.
5. the oligonucleotides of PKLR gene mutations is detected, it is characterised in that including：At least one pair of amplification PKLR gene extron
Primer, described at least one pair of amplimer is selected from PKLR-1F/PKLR-1R, PKLR-2F/PKLR-2R, PKLR-3-4-5F/
PKLR-3-4-5R, PKLR-6-7F/PKLR-6-7R, PKLR-8-9F/PKLR-8-9R, PKLR-10F/PKLR-10R, or PKLR-
11F/PKLR-11R, its base sequence is：
PKLR-1F：TGTAAAACGACGGCCAGTAGAGGAAATGCCAGGAGATGA；
PKLR-1R：AACAGCTATGACCATGTTCACCCTCATTTTCCTCCTAT；
PKLR-2F：TGTAAAACGACGGCCAGTAGAGGGTATGCTGAGAGACGAA；
PKLR-2R：AACAGCTATGACCATGAAGAAGCACCTCAAGAAATACCA；
PKLR-3-4-5F：TGTAAAACGACGGCCAGTGGGTTGCATCAGGGAATAAA；
PKLR-3-4-5R：AACAGCTATGACCATGGCCAAGGAGAAGGGAATGTG；
PKLR-6-7F：TGTAAAACGACGGCCAGTGACTATGGGTGGGTCGTTTCT；
PKLR-6-7R：AACAGCTATGACCATGCACCCACAGGTGTCCCTAAAA；
PKLR-8-9F：TGTAAAACGACGGCCAGTGTGTGGGTGTCAGAGAAGTAGC；
PKLR-8-9R：AACAGCTATGACCATGTGGCATTCTGTCTCTCCTGG；
PKLR-10F：TGTAAAACGACGGCCAGTGTGACACCTGGAACTGGAACA；
PKLR-10R：AACAGCTATGACCATGGACCACAGGAGAGAGGCAAG；
PKLR-11F：TGTAAAACGACGGCCAGTGCCAGGCTGGTCTCAAACT；
PKLR-11R：AACAGCTATGACCATGATGAGAATGGGAGACTGTGGA.
6. oligonucleotides as claimed in claim 5, it is characterised in that also including a pair of sequencing primers, its base sequence is：
M13F：TGTAAAACGACGGCCAGT；
M13R：AACAGCTATGACCATG.
7. oligonucleotides as claimed in claim 5, it is characterised in that PKLR-1F：PKLR-1R、PKLR-2F：PKLR-2R、
PKLR-3-4-5F：PKLR-3-4-5R、PKLR-6-7F：PKLR-6-7R、PKLR-8-9F：PKLR-8-9R、PKLR-10F：
PKLR-10R, or PKLR-11F：The ratio of PKLR-11R is 1.
8. oligonucleotides as claimed in claim 7, it is characterised in that M13F：The ratio of M13R is 1.
9. application of the oligonucleotides as described in one of claim 5~8 in auxiliary detection pyruvate kinase deficiency.
10. a kind of method of detection PKLR gene mutations, comprises the following steps：
(1) genomic DNA in extracting sample；
(2) DNA in (1) is expanded using at least one pair of amplimer, obtains amplified production；
(3) amplified production in (2) is sequenced using a pair of sequencing primer M13F and M13R, obtains the amplified production
Base sequence；
(4) base sequence in (3) is compared with PKLR gene wild-type reference sequences, determines whether mutational site deposits
, it is characterised in that described at least one pair of amplimer is selected from PKLR-1F/PKLR-1R, PKLR-2F/PKLR-2R, PKLR-3-
4-5F/PKLR-3-4-5R, PKLR-6-7F/PKLR-6-7R, PKLR-8-9F/PKLR-8-9R, PKLR-10F/PKLR-10R, or
PKLR-11F/PKLR-11R, its base sequence is：
PKLR-1F：TGTAAAACGACGGCCAGTAGAGGAAATGCCAGGAGATGA；
PKLR-1R：AACAGCTATGACCATGTTCACCCTCATTTTCCTCCTAT；
PKLR-2F：TGTAAAACGACGGCCAGTAGAGGGTATGCTGAGAGACGAA；
PKLR-2R：AACAGCTATGACCATGAAGAAGCACCTCAAGAAATACCA；
PKLR-3-4-5F：TGTAAAACGACGGCCAGTGGGTTGCATCAGGGAATAAA；
PKLR-3-4-5R：AACAGCTATGACCATGGCCAAGGAGAAGGGAATGTG；
PKLR-6-7F：TGTAAAACGACGGCCAGTGACTATGGGTGGGTCGTTTCT；
PKLR-6-7R：AACAGCTATGACCATGCACCCACAGGTGTCCCTAAAA；
PKLR-8-9F：TGTAAAACGACGGCCAGTGTGTGGGTGTCAGAGAAGTAGC；
PKLR-8-9R：AACAGCTATGACCATGTGGCATTCTGTCTCTCCTGG；
PKLR-10F：TGTAAAACGACGGCCAGTGTGACACCTGGAACTGGAACA；
PKLR-10R：AACAGCTATGACCATGGACCACAGGAGAGAGGCAAG；
PKLR-11F：TGTAAAACGACGGCCAGTGCCAGGCTGGTCTCAAACT；
PKLR-11R：AACAGCTATGACCATGATGAGAATGGGAGACTGTGGA；
M13F：TGTAAAACGACGGCCAGT；
M13R：AACAGCTATGACCATG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710218899.8A CN106868184B (en) | 2017-04-05 | 2017-04-05 | Method, kit and oligonucleotide for detecting PKLR gene mutation and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710218899.8A CN106868184B (en) | 2017-04-05 | 2017-04-05 | Method, kit and oligonucleotide for detecting PKLR gene mutation and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106868184A true CN106868184A (en) | 2017-06-20 |
| CN106868184B CN106868184B (en) | 2020-11-06 |
Family
ID=59160976
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710218899.8A Active CN106868184B (en) | 2017-04-05 | 2017-04-05 | Method, kit and oligonucleotide for detecting PKLR gene mutation and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106868184B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111057759A (en) * | 2019-12-24 | 2020-04-24 | 北京艾迪康医学检验实验室有限公司 | Primer, kit and method for detecting PAH gene mutation |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103555826A (en) * | 2013-09-27 | 2014-02-05 | 合肥艾迪康临床检验所有限公司 | Primer, method and kit for detecting mutation of MLH1 gene's 12th exon |
| CN105177152A (en) * | 2015-09-29 | 2015-12-23 | 福州艾迪康医学检验所有限公司 | Method and primers for detecting HLA-B*51 allelomorphic gene |
| CN105506107A (en) * | 2015-12-30 | 2016-04-20 | 杭州艾迪康医学检验中心有限公司 | Primers and method for detecting polymorphic hotspot mutation condition of DOCK2 gene |
| CN105755132A (en) * | 2016-04-08 | 2016-07-13 | 杭州艾迪康医学检验中心有限公司 | Method, oligonucleotide and kit for detecting polymorphic mutation site of WAS gene |
-
2017
- 2017-04-05 CN CN201710218899.8A patent/CN106868184B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103555826A (en) * | 2013-09-27 | 2014-02-05 | 合肥艾迪康临床检验所有限公司 | Primer, method and kit for detecting mutation of MLH1 gene's 12th exon |
| CN105177152A (en) * | 2015-09-29 | 2015-12-23 | 福州艾迪康医学检验所有限公司 | Method and primers for detecting HLA-B*51 allelomorphic gene |
| CN105506107A (en) * | 2015-12-30 | 2016-04-20 | 杭州艾迪康医学检验中心有限公司 | Primers and method for detecting polymorphic hotspot mutation condition of DOCK2 gene |
| CN105755132A (en) * | 2016-04-08 | 2016-07-13 | 杭州艾迪康医学检验中心有限公司 | Method, oligonucleotide and kit for detecting polymorphic mutation site of WAS gene |
Non-Patent Citations (3)
| Title |
|---|
| HERVE ROUGER等: "Five unknown mutations in the LR pyruvate kinase gene associated with severe hereditary nonspherocytic haemolytic anaemia in France", 《BRITISH JOURNAL OF HAEMATOLOGY》 * |
| HUIMIN LI等: "A Novel and a Previously Described Compound Heterozygous PKLR Gene Mutations Causing Pyruvate Kinase Deficiency in a Chinese Child", 《FETAL AND PEDIATRIC PATHOLOGY》 * |
| 李栋梁等: "目标序列捕获测序检出红细胞丙酮酸激酶缺乏症PKLR基因新的复合突变", 《中国实验血液学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111057759A (en) * | 2019-12-24 | 2020-04-24 | 北京艾迪康医学检验实验室有限公司 | Primer, kit and method for detecting PAH gene mutation |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106868184B (en) | 2020-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109593841A (en) | Detect method, kit, oligonucleotides and its application of F13A1 gene mutation | |
| CN104745697B (en) | Detect the method and primer of NF1 the 31st No. 34 full extron of gene | |
| CN105506107A (en) | Primers and method for detecting polymorphic hotspot mutation condition of DOCK2 gene | |
| CN109486938A (en) | Detect method, primer and the application of SMN1 and SMN2 gene mutation | |
| CN106987642A (en) | Detect the kit and method of the full extron of MPL genes | |
| CN109402234A (en) | Detect the primer and method of DMD A827T, 6436 insC site mutation of DMD A5741T and DMD | |
| CN108531575A (en) | Detect primer, kit and the method for the full exon sequence mutation of TERC genes | |
| CN106520967A (en) | Method and primer for detecting hereditary blood coagulation factor XI(F11) genes | |
| CN108998525A (en) | Detect primer, method and the kit of ATRX gene point mutation | |
| CN104862407A (en) | Primer and method for detecting EZH2 genes | |
| CN106399567A (en) | Primer for detecting WRAP53 gene mutation and application of primer | |
| CN110358820A (en) | Detect method, primer and the kit of LDLR gene mutation | |
| CN106868174A (en) | Detect the kit and method of the full extron of ADAMTS13 genes | |
| CN108004309A (en) | Detect primer, method and the kit of MTHFR677, MTHFR1298 and MTRR66 | |
| CN106868184A (en) | Detect method, kit, oligonucleotides and its application of PKLR gene mutations | |
| CN106086215A (en) | The method in detection No. 4 full exon sequence mutational site of dyskeratosis congenita disease NHP2 gene and primer | |
| CN110804658A (en) | Method, primer and kit for detecting PTPN11 gene mutation | |
| CN110951862A (en) | Method, primer and kit for detecting CYP21A2 gene mutation | |
| CN106222287A (en) | The method of detection ELA2 gene and primer | |
| CN110358821A (en) | Detect primer, kit and the method for glucose 6 phosphate dehydrogenase deficiency G6PD gene mutation | |
| CN103540659B (en) | Detect the method in DNMT3A mutational site, primer and test kit | |
| CN109628563A (en) | Detect primer, kit and the method in the mutational site PIGA gene promoter region 4972A > G | |
| CN106967799A (en) | Detect method, oligonucleotides and its application of BTK gene mutations | |
| CN107058531A (en) | A kind of kit and method for detecting Niemann-Pick disease SMPD1 gene mutations | |
| CN103710438A (en) | Method and primers for detecting fifth exon mutation site of RUNX1 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200930 Address after: Floor 1 and 2, Guangfa Longping venture building, No. 98, XIONGTIAN Road, Longping high tech park, Furong district, Changsha City, Hunan Province Applicant after: Changsha aidikang medical laboratory Co., Ltd Address before: Xihu District Hangzhou city Zhejiang province 310030 Vibration Road No. 208 Building 2 North Building 1 to 5 storeys, 2 blocks south 1 to 2 Applicant before: ADICON CLINICAL LABORATORIES CENTER, Inc. |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |