CN106868046A - One kind targeting rat phospholipase C γ 2 disturbs recombined adhenovirus, construction method and application - Google Patents
One kind targeting rat phospholipase C γ 2 disturbs recombined adhenovirus, construction method and application Download PDFInfo
- Publication number
- CN106868046A CN106868046A CN201710117407.6A CN201710117407A CN106868046A CN 106868046 A CN106868046 A CN 106868046A CN 201710117407 A CN201710117407 A CN 201710117407A CN 106868046 A CN106868046 A CN 106868046A
- Authority
- CN
- China
- Prior art keywords
- plc
- cell
- 2shrna
- viruses
- shrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
- A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10041—Use of virus, viral particle or viral elements as a vector
- C12N2710/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Animal Behavior & Ethology (AREA)
- General Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Recombined adhenovirus and its construction method are disturbed the invention discloses one kind targeting rat phospholipase C γ 2, targeting rat phospholipase C γ 2 disturb recombined adhenovirus be in skeleton plasmid pHBAd BHG of the oligonucleotides shRNA insertions containing adenoviral gene group for will target rat phospholipase C γ 2 after obtain, the nucleotide sequence of the oligonucleotides shRNA is as shown in SEQ ID NO.1.SiRNA nucleotide sequence of the present invention for the genes of rat phospholipase C γ 2, design and synthesize based on the corresponding shRNA oligonucleotide sequences of adenovirus shuttle vector, using the U6 promoters of the self-contained RNA dependence polymerase IIIs of adenovirus vector, the shRNA of targeting genes of interest is constantly produced in target cell, because shRNA can be processed into siRNA by intracellular Dicer enzymes, gene interference effect can be played.
Description
Technical field
Field is built the invention belongs to biotechnology, and in particular to one kind targeting rat phospholipase C γ 2 disturbs recombinant adenovirus
Poison, construction method and application.
Background technology
Acute hepatic failure is that the major Liver caused by many factors is damaged, so cause liver synthesis in itself, removing toxic substances,
There is one group of clinical syndrome of serious hindrance in the function such as excretion and bioconversion, its cause of disease is complicated, and disease development is rapid, dies of illness
Rate is high (up to 80%), and special treatment means are still lacked at present.Its main pathological change is the mortality of liver cell.Oneself sends out
Existing, one of liver cell main vital form of acute hepatic failure is apoptosis, and the generation of acute hepatic failure is close with hepatocellular apoptosis
It is related.Apoptosis, also known as the programmed death of cell, is a process extremely complex, by gene accuracy controlling, is declined in liver
Played an important role in the generation, the evolution that exhaust.In recent years, hepatocellular apoptosis correlation factor quilt in increasing hepatic failure
It was found that, its function is constantly studied.For example, studies have found that TNF-α, TGF-β 1, IGF-1, NGF overexpression etc. can be induced
The a large amount of apoptosis of liver cell, trigger liver failure.Even so, hepatic failure genesis mechanism to not illustrating completely yet at present.Therefore,
It was found that the gene of new participation hepatic failure hepatocellular apoptosis also will be hepatic failure in helping further appreciate that hepatic failure mechanism
Treatment provides new target.We have found in early stage rat hepatic failure genomics and liver regeneration genomics research, phosphatide
Enzyme C γ 2 (phospholipase C gamma 2, PLC γ 2) gene is in whole hepatic failure generating process and hepatic injury causes
Liver regeneration later stage experssion significantly increase, systems biology analysis show the gene may with hepatocellular apoptosis have closely pass
System.
PLC γ 2 belong to one of PLC γ subfamily members, and PLC γ 2 hydrolyze PIP2 and produce IP3 and DAG after being activated, the two
Can respectively by inducing Ca2+Signal pathway and PKC signal pathways, pull a series of physiological and biochemical activities.PLC γ 2 are generally recognized
Be to be played an important role in inflammatory reaction, in recent years studies have found that, PLC γ 2 also participate in the regulation and control of Apoptosis.Such as
Takatma etc. has found that growths of the PLC γ 2 to cell plays negative regulation effect, and knocking out after the gene DT40 cell lines apoptosis can not be by
Induction, if cDNA is transferred in the cell again, apoptosis can recover.Open soldier etc. and find that the PLC γ 2 of activation can be believed by PKC α
Number path induces the apoptosis of Gastric Cancer MGC 80-3 cells.
RNA interference is a kind of important gene silencing means, and compared to gene knockout, experiment is relatively easy, and screening site is more,
It is readily available experimental result.Relative to traditional antisensenucleic acids, ribozyme technology, technology specificity is high, techniqueflow is designed more
For simple and easy to apply, the effect of inhibition of gene expression is more notable；Curative effect is rapid and continuation is preferable.
RNA interference (RNAinterference, RNAi) is one of important mechanisms of silence after genetic transcription.Although feeding
In newborn zooblast siRNA can efficiently, the expression of specific inhibition of gene, but artificial synthesized RNA is with general eucaryon plasmid
The efficiency that carrier is transfected is low, it is difficult to as gene therapy medicament, it is also difficult to realize the purpose of gene interference.
Therefore, we intend disturbing recombined adhenovirus to lower by building the shRNA of the genes of targeting rat phospholipase C γ 2
The gene expressions of PLC γ 2, observation suppresses influence of the gene expression to hepatocyte apoptosis, to be provided for hepatic failure treatment
New target.
The content of the invention
Recombined adhenovirus, construction method are disturbed it is an object of the invention to provide one kind targeting rat phospholipase C γ 2 and answer
With transfection efficiency is high, can realize gene interference as gene therapy medicament.
The invention provides a kind of rat phospholipase C γ 2 interference recombined adhenovirus, targeting rat phospholipase C γ 2 disturbs weight
Group adenovirus is that the oligonucleotides shRNA that will target rat phospholipase C γ 2 inserts the skeleton plasmid containing adenoviral gene group
Obtained after in pHBAd-BHG, the nucleotide sequence of the oligonucleotides shRNA is as shown in SEQ ID NO.1.
Present invention also offers a kind of above-mentioned interference of targeting rat phospholipase C γ 2 recombination adenovirus construction method, its feature
It is to specifically include following steps：
Step 1, the synthesis of single-stranded shRNA oligonucleotides
Step 1.1, is respectively synthesized the F sequences and R sequences of single-stranded shRNA oligonucleotides；
Wherein, F sequences are：
AATTCGCCAGCTTCGTGAGAAGATCATTCAAGAGATGATCTTCTCACGAAGCTGGCTTTTTTG；
R sequences are：
GATCCAAAAAAGCCAGCTTCGTGAGAAGATCATCTCTTGAATGATCTTCTCACGAAGCTGGCG；
Step 2, the structure of recombinant shuttle plasmid and identification
Step 2.1, with EcoR I and BamH I double digestion shuttle vector pHBAd-U6-GFP, gel reclaim linearisation,
The empty carrier of sequence fragment long；
Step 2.2, concentration is diluted to for 1 μ g/1 μ L by the F sequences, the R sequences that synthesize with 1 × TE respectively, obtain F solution with
R solution, then anneals F solution and R solution, forms annealed product double-strand F/R；
Step 2.3, the double-strand F/R in step 2.2 is connected with the empty carrier of sequence fragment long in step 2.1, obtains weight
Group plasmid pHBAd-PLC γ 2shRNA；
Step 3, the structure of the adenovirus of recombinant rat phospholipase C γ 2
Step 3.1, HEK293 cells is inoculated in the DMEM complete culture solutions containing 10%FBS, in 5%CO2, 37 DEG C of rings
Cultivated in border, when cell density reaches 70-80%, recombinant plasmid pHBAd-PLC γ 2shRNA and skeleton plasmid pHBAd-BHG
Mediated through transfection reagent LipofiterTM, cotransfection HEK293 cells obtain cell mixture；
Step 2.2, the cell mixture is inoculated in the DMEM complete culture solutions containing 10%FBS, is shaken by the figure of eight
It is dynamic, 5%CO2, cultivate under the conditions of 37 DEG C, fresh DMEM complete culture solutions are changed after 6h, observation of cell goes out malicious situation, works as cell
Gradually into botryoidalis and when there is plaque, the cell come off from culture dish bottom is collected into centrifuge tube, centrifuge tube is alternately placed in
Freeze thawing under liquid nitrogen and 37 DEG C of water bath conditions, is then centrifuged for, and collects supernatant venom, that is, obtain Ad-PLC γ 2shRNA 1st generation seeds culture of viruses
P1；
Step 2.3, with the HEK293 cells that first generation seed culture of viruses P1 densities of infection are 90%, collects second generation seed culture of viruses P2；
Step 2.4, with the HEK293 cells that second generation seed culture of viruses P2 densities of infection are 90%, collects third generation seed culture of viruses P3, institute
State third generation seed culture of viruses P3 and be the interference recombined adhenovirus of targeting rat phospholipase C γ 2.
Suppressing liver cell increasing present invention also offers a kind of above-mentioned interference recombined adhenovirus of targeting rat phospholipase C γ 2
Application in growing.
Compared with prior art, a kind of targeting rat phospholipase C γ 2 that the present invention is provided disturbs recombined adhenovirus, builds
Method and application, have the advantages that：
1st, the present invention is directed to facilitations of the PLC γ 2 in hepatocellular apoptosis, for the genes of rat phospholipase C γ 2
SiRNA nucleotide sequences, design and synthesize based on the corresponding shRNA oligonucleotide sequences of adenovirus shuttle vector, using adenopathy
The U6 promoters of the self-contained RNA dependence polymerase IIIs of poisonous carrier, constantly produce targeting genes of interest in target cell
ShRNA, because shRNA can be processed into siRNA by intracellular Dicer enzymes, plays gene interference effect；Build PLC γ 2 and recombinate gland
Virus can be regulated and controled with replacing the pattern of gene with specific aim cell growth situation, targeting rat phospholipase C of the invention
γ 2 disturbs recombined adhenovirus, to remarkably promoting effect in hepatocyte apoptosis, for the prevention and treatment of hepatic failure are provided
New treatment thoughts.
2nd, the present invention is that the shRNA oligonucleotides that will target the genes of rat phospholipase C γ 2 using defective adenoviral is introduced
In rat hepatocytes, to suppress the expression of phospholipase C γ 2 in host cell, suppress Apoptosis, promote cell propagation, so that
Reach the purpose of prevention and treatment hepatic failure, effect is significant.
Brief description of the drawings
Fig. 1 is that targeting rat phospholipase C γ 2 of the invention disturbs the structure of recombined adhenovirus and the flow of experimental verification
Figure；
Fig. 2 is that the shuttle plasmid pHBAd-U6-GFP used by the present invention coagulates through the agarose of BamH I, EcoR I double digestions
Glue qualification result；
Wherein, swimming lane 1 is the BamH I/EcoR I double digestion results of pHBAd-U6-GFP, and swimming lane 2 is
GeneRayDNAMarker；
Fig. 3 is the cytopathic effect (× 100) observed under light microscopic in recombined adhenovirus packaging process of the invention；
Wherein, Fig. 3 A be shuttle vector pHBAd-U6-GFP (empty carrier) with skeleton plasmid pHBAd-BHG cotransfections after
1st generation seed culture of viruses P1, Fig. 3 C for arriving are during 2nd generation the seed culture of viruses P2, Fig. 3 E that obtain is Fig. 3 C after the 1st generation seed culture of viruses P1 infection in Fig. 3 A
2nd generation seed culture of viruses P2 infection after the 3rd generation seed culture of viruses P3 that obtains；Fig. 3 B are recombinant plasmid pHBAd-PLC γ 2shRNA and skeleton matter
1st generation the seed culture of viruses P1, Fig. 3 D that obtain is the 2 obtained after the 1st generation seed culture of viruses P1 infection in Fig. 3 B after grain pHBAd-BHG cotransfections
For seed culture of viruses P2, Fig. 3 F are the 3rd generation seed culture of viruses P3 that obtain after the 2nd generation seed culture of viruses P2 infection in Fig. 3 D；
Fig. 4 is the fluorescence microscope (× 100) of Ad-PLC γ 2shRNA transfected into rat liver cells of the invention；
Wherein Fig. 4 A are the result of Ad-PLC γ 2shRNA, and Fig. 4 B are the unloaded results of Ad-U6-GFP；
Fig. 5 is qRT-PCR detections of the Ad-PLC γ 2shRNA of the invention to the jamming effectiveness of PLC γ 2 in rat hepatocytes
As a result；
Fig. 6 is the electrophoretogram of the protein expressions of PLC γ 2 after Ad-PLC γ 2shRNA infected rats liver cells of the invention；
Fig. 7 is the expressing quantities of PLC γ 2 after Ad-PLC γ 2shRNA infected rats liver cells of the invention；
Fig. 8 is that Ad-PLC γ 2shRNA of the invention influence situation to rat hepatocytes proliferation activity；
Fig. 9 is that Ad-PLC γ 2shRNA of the invention suppress hepatocyte apoptosis situation；
Wherein, Fig. 9 A are control group testing result, and Fig. 9 B are Ad-PLC γ 2shRNA group testing results, and Fig. 9 C are Ad-U6-
The unloaded group testing results of GFP.
Specific embodiment
The present invention is described in detail with reference to the accompanying drawings and detailed description, it is to be understood that protection of the invention
Scope is not limited by specific embodiment.The test method of unreceipted actual conditions in the following example, generally according to normal
Rule conditional operation, due to not being related to inventive point, therefore is not described in detail to its step.
When embodiment provides number range, it should be appreciated that except non-invention is otherwise noted, two ends of each number range
Any one numerical value can select between point and two end points.Unless otherwise defined, in the present invention all technologies for using and
Scientific terminology is identical with the meaning that those skilled in the art of the present technique are generally understood that.Except the specific method, equipment used in embodiment,
Outside material, grasp and record of the invention according to those skilled in the art to prior art can also be used and this
Any method, equipment and material in the similar or equivalent prior art of method, equipment described in inventive embodiments, material come real
The existing present invention.
The shuttle vector pHBAd-U6-GFP and skeleton plasmid pHBAd-BHG containing adenoviral gene group in following embodiments
Purchased from Shanghai Han Heng biotech firms；HEK293 cell lines are permanent purchased from the Shanghai Chinese, and coli strain DH5 α are purchased from Invitrogen
Company；DMEM high glucose mediums, LB culture mediums, hyclone, pancreatin are purchased from GIBCO companies；BamHI, EcoRI restriction enzyme
Enzyme, T4 ligases, DNAladder are purchased from Fermentas companies；DNA is small, a large amount of extraction agent boxes are century purchased from health；
Gel reclaims kit is purchased from Axygen；MTT cell proliferation detecting kits are purchased from Sigma Co., USA；DNase I is purchased from U.S.
Roche companies of state；HiScript Reverse Transcriptase (RNase H) are purchased from genecopoeia companies；Rabbit-anti is big
Mouse PLC γ 2 are purchased from Abcam companies；Small anti-rat β-actin, HRP mark sheep anti-Mouse two anti-igg, HRP mark goat-anti rabbits
Two anti-igg are purchased from Wuhan Boster Biological Technology Co., Ltd.；It is APC-Annexin/7-AAD cell apoptosis detection kits, thin
Born of the same parents' cycle detection kit extracts kit is purchased from Nanjing Keygen Biotech.
Recombined adhenovirus are disturbed the invention provides one kind targeting rat phospholipase C γ 2, by targeting rat phospholipase C γ 2
Skeleton plasmid pHBAd-BHG of the oligonucleotides shRNA insertions containing adenoviral gene group in after obtain, the oligonucleotides
The nucleotide sequence of shRNA is as shown in SEQ ID NO.1.
Targeting rat phospholipase C γ 2 disturbs the structure of recombined adhenovirus and the flow of experimental verification as shown in figure 1, specific
Built according to following steps：
Step 1, the synthesis of single-stranded shRNA oligonucleotides
According to the gene orders (NM_017168.1) of P of Rats LC γ in GenBank 2, using the design software of Oligo companies
Oligonucleotide RNAi Designer design a siRNA oligonucleotide sequence target spot for PLC γ 2, Jin Ershe
Nucleotide sequence of the meter based on pHBAd-U6-GFP shuttle vectors, is respectively the F sequence (nucleotides of single-stranded shRNA oligonucleotides
Sequence is as shown in SEQ ID NO.2) and R sequences (nucleotide sequence (is shown in Table 1) as shown in SEQ ID NO.3, transfers to the Shanghai Chinese permanent
Bioisystech Co., Ltd synthesizes.Design considerations is as follows：Loop structures in Ad-PLC γ 2-shRNA templates are selected
TTCAAGAGA is avoiding the formation of termination signal；Positive-sense strand template 5 ' end with the addition of AATTC, with EcoR I digestions after formed
Cohesive end is complementary, and 5 ' ends of antisense strand template with the addition of GATCC, complementary with the cohesive end that BamHI digestions are formed.
The F sequences of table 1 and R sequences and its corresponding PLC γ 2RNA target spots
Step 2, the structure of recombinant shuttle plasmid and identification
Step 2.1, with EcoR I and BamH I double digestion shuttle vector pHBAd-U6-GFP, its digestion system such as institute of table 2
Show.
The digestion system of table 2
Digestion system reacts 1h at 37 DEG C, and gel reclaims linearisation, sequence fragment long empty carrier, solidifying with agarose
Gel electrophoresis are identified.Qualification result show bar band between 5000-6000bp (see Fig. 2), the size of the empty carrier of sequence fragment long
It is 5118bp, as a result meets Expected Results.
Step 2.2, concentration is diluted to for 1 μ g/1 μ L by the F sequences, the R sequences that synthesize with 1 × TE respectively, obtain F solution with
R solution, then anneals F solution and R solution, forms annealed product double-strand F/R；F solution and the system such as table 3 of R solution annealing
It is shown.
The F solution of table 3 and the system of R solution annealing
| 10×Buffer | 2μL |
| R solution (1 μ g/1 μ L) | 1μL |
| F solution (1 μ g/1 μ L) | 1μL |
| 16μL | |
| Total system | 20μL |
Annealing conditions are：After 95 DEG C of 10min, every 20 DEG C of 10min reductions, finally double-strand is formed to 15 DEG C of annealing 10min.
Step 2.3, the double-strand F/R in step 2.2 is connected with the empty carrier of sequence fragment long in step 2.1, obtains weight
Group plasmid pHBAd-PLC γ 2shRNA, linked system is as shown in table 4.
The empty carrier linked system of the double-strand F1/R1 of table 4 and sequence fragment long
| F/R double-strands (20 μm of ol/L) | 1μL |
| The empty carrier (200ng/ μ L) of sequence fragment long | 1μL |
| ligasebuffer | 2μL |
| T4DNAligase | 1μL |
| 15μL | |
| Total system | 20μL |
Above linked system at 4 DEG C overnight (time be more than 12h).
Step 2.4, the identification of recombinant plasmid pHBAd-PLC γ 2shRNA, comprises the following steps that；
Draw 10 μ L recombinant plasmid pHBAd-PLC γ 2shRNA and add the centrifugation containing 100 μ L coli strain DH5 α
Guan Zhong, is gently mixed uniformly, and 30min is placed on ice.Centrifuge tube is put into heat shock 90s in 42 DEG C of water-baths, is put rapidly after taking-up
In on ice, 2min is cooled down.To in centrifuge tube add 5 times of LB fluid nutrient mediums of volume, 37 DEG C of shaken cultivation 45-60min,
8000rpm is centrifuged 30s, removes part supernatant, after staying 100 μ L or so nutrient solution, piping and druming uniform, is coated on containing ammonia with triangle spreading rod
On the selective LB flat boards in benzyl XiLin, it is inverted culture dish and shakes bacterium 14h in 37 DEG C of 250r/min, after single bacterium colony grows, picking weight
The single bacterium colony of group plasmid pHBAd-PLC γ 2shRNA conversions is sent to the sequencing of Shanghai Sani Bioisystech Co., Ltd.
Sequencing result shows that shRNA interference sequences set with this research in the recombinant plasmid pHBAd-PLC γ 2shRNA of clone
The target sequence positive-sense strand for counting synthesis is completely the same.This proves that the oligonucleotide sequence of synthesis has been inserted into shuttle vector pHBAd-
In U6-GFP, recombinant shuttle plasmid is successfully constructed.
Step 3, rat phospholipase C γ 2 disturbs the structure of recombined adhenovirus
Step 3.1, HEK293 cells are inoculated in the DMEM complete culture solutions of hyclone containing 10%Hyclon (FBS)
In, in 5%CO2, overnight incubation in 37 DEG C of environment.When cell growth is to exponential phase (cell density 70-80%), by weight
Group plasmid pHBAd-PLC γ 2shRNA and skeleton plasmid pHBAd-BHG mediates cotransfection through transfection reagent LipofiterTM
HEK293 cells, obtain cell mixture.
It is as follows the step of specific cotransfection when cell growth is to exponential phase：
A. 2 μ g recombinant plasmids pHBAd-PLC γ 2shRNA and 4 μ g skeleton plasmid pHBAd-BHG are taken, it is complete with 300 μ LDMEM
Full nutrient solution is diluted, and 5min is placed at room temperature, obtains plasmid mixed liquor.
B. 15 μ LLipofiterTM are taken, is diluted with 300 μ LDMEM complete culture solutions, room temperature places 5min, is tried
Agent solution.
C. cell mixture and reagent solution are mixed, lucifuge is incubated 20min at room temperature, obtains cell mixture.
Step 3.2, the cell mixture is inoculated in the 60mm cultures equipped with the DMEM complete culture solutions containing 10%FBS
In ware, rocked by the figure of eight, 5%CO2(volume fraction), cultivate under the conditions of 37 DEG C, fresh DMEM is changed after 6h and is cultivated completely
Liquid.Observation of cell goes out malicious situation, when cell is gradually into botryoidalis and when there is plaque (8 days or so), shows that recombined adhenovirus are packed
Success.
The cell come off from culture dish bottom is collected into centrifuge tube, centrifuge tube is alternately placed in liquid nitrogen and 37 DEG C of water-bath bars
Freeze thawing is carried out under part, wherein, liquid nitrogen and 37 DEG C are placed 3 times respectively, 3000rpm room temperatures centrifugation 5min, collect supernatant venom, are obtained final product
To Ad-PLC γ 2shRNA 1st generation seeds culture of viruses P1 (referring to Fig. 3).
Step 3.3, with the HEK293 cells that first generation seed culture of viruses P1 densities of infection are 90%, collects second generation seed culture of viruses P2, tool
Gymnastics conduct：
The HEK293 cells that 3mL first generation seed culture of viruses P1 densities of infection are at least 90% are taken, cell to be contaminated takes off after cultivating 3 days
Fall, the cell for coming off be placed in new centrifuge tube, and by centrifuge tube alternately be placed in liquid nitrogen and 37 DEG C of water bath conditions under frozen
Melt, wherein liquid nitrogen and 37 DEG C of placement 3 times respectively, 3000rpm centrifugation 5min, collect supernatant venom, collect second generation seed culture of viruses P2 (ginsengs
See Fig. 3).
Step 3.4, with the HEK293 cells that second generation seed culture of viruses P2 densities of infection are 90%, collects third generation seed culture of viruses P3, tool
Gymnastics conduct：
The HEK293 cells that 3mL second generation seed culture of viruses P2 densities of infection are at least 90% are taken, cell to be contaminated takes off after cultivating 3 days
Fall, the cell for coming off be placed in new centrifuge tube, and by centrifuge tube alternately be placed in liquid nitrogen and 37 DEG C of water bath conditions under frozen
Melt, wherein, liquid nitrogen and 37 DEG C are placed 3 times respectively, 3000rpm centrifugation 5min, collect supernatant venom, obtain third generation seed culture of viruses P3
(referring to Fig. 3), the third generation seed culture of viruses P3 is targeting rat phospholipase C γ 2 and disturbs recombined adhenovirus.
It should be noted that Fig. 3 is the cytopathy observed under light microscopic in recombined adhenovirus packaging process of the invention
Effect (× 100)；
Wherein, Fig. 3 A be shuttle vector pHBAd-U6-GFP (empty carrier) with skeleton plasmid pHBAd-BHG cotransfections after
1st generation seed culture of viruses P1, Fig. 3 C for arriving are during 2nd generation the seed culture of viruses P2, Fig. 3 E that obtain is Fig. 3 C after the 1st generation seed culture of viruses P1 infection in Fig. 3 A
2nd generation seed culture of viruses P2 infection after the 3rd generation seed culture of viruses P3 that obtains；Fig. 3 B are recombinant plasmid pHBAd-PLC γ 2shRNA and skeleton matter
1st generation the seed culture of viruses P1, Fig. 3 D that obtain is the 2 obtained after the 1st generation seed culture of viruses P1 infection in Fig. 3 B after grain pHBAd-BHG cotransfections
For seed culture of viruses P2, Fig. 3 F are the 3rd generation seed culture of viruses P3 that obtain after the 2nd generation seed culture of viruses P2 infection in Fig. 3 D.
For the ease of description, recombined adhenovirus are disturbed to use " Ad- targeting rat phospholipase C γ 2 in following examples
The abbreviation of PLC γ 2shRNA ".
Below, we verify the effect of Ad-PLC γ 2shRNA of the present invention by some experimental datas：
First, titre detection
The titre of the Ad-PLC γ 2shRNA being prepared to the above method detects, third generation seed culture of viruses P3 sample titres
Determined with improved tissue culture infective dose (50%tissue culture infective dose, TCID50) method.
Specific method is as follows：
HEK293 cells are cultivated first, and when cell density is 80%, trypsin digestion cell simultaneously counts cell quantity.
1 × 10 is prepared with the DMEM nutrient solutions containing 5%FBS5The cell suspension of/ml, 100 μ l/ holes are seeded to 96 orifice plates.Meanwhile, from
Virus liquid is made continuous 10 times of dilution, from 10 in heart pipe-6~10-13.Table 5 is shown three kinds of dilutions of restructuring interference virus
Gradient.To in 96 orifice plates, 100 μ l/ holes, each dilution factor sets 8 multiple holes to the virus inoculation that will have been diluted, and sets up 2 holes and be free of
The DMEM of adenovirus is used as negative control.96 orifice plates are placed in 37 DEG C of CO after mixing2Cultivated in incubator, observation of cell after 8 days
Lesion (CPE) situation, and CPE holes are counted, calculate often capable positive rate.
For 100 μ L samples, virus titer is calculated by Karber methods, method is as follows：T=101+d(s-0. 5), wherein d=
Log10 dilution factor=1 (for 10 times of dilution factors), s=positive rates sum (is counted) from first 10 times of dilution factor；Root again
According to formula T=a × 10bTCID50/mL=a × 10b-0.7PFU/mL, PFU/mL is converted into by TCID50/mL.Note：Repeat twice
The titre value difference that experiment is obtained should<100.7
The titre of the Ad-PLC γ 2shRNA measured using the above method as shown in table 5, drip by Ad-PLC γ 2shRNA infection
Spend is 1.58 × 1010PFU/ml, virus titer is high.
The virus titer of table 5 dilutes result
2nd, Ad-PLC γ 2shRNA are detected to rat hepatocytes infection conditions and jamming effectiveness
It should be noted that the preparation method of Ad-U6-GFP zero loads adenovirus is with Ad-PLC γ in following embodiments
2shRNA, difference is that to use shuttle vector pHBAd-U6-GFP thin with skeleton plasmid pHBAd-BHG cotransfections HEK293
Born of the same parents.
(1) fluorescence microscope infection conditions
The in vitro culture rat hepatocytes of 1 week are taken, with every hole 1 × 106Individual cell is inoculated in the orifice plate of cell culture 6,37 DEG C,
5%CO2Overnight incubation in incubator.It is divided into Ad-PLC γ 2shRNA groups, Ad-U6-GFP zero loads group and control group etc. totally three
Group, every group of 3 repeating holes.It is 100Ad-PLC γ 2shRNA and Ad-U6-GFP zero load adenovirus that first 2 groups are added dropwise MOI successively, right
According to then virus-free infection is organized, continuing to cultivate containing 10%FBS, in the DMEM conditioned mediums of HGF5ng/ml, fluorescence shows after 24h
Micro mirror is observed infectious effect and is taken pictures, and as a result referring to Fig. 4, wherein Fig. 4 A are the result of Ad-PLC γ 2shRNA, and Fig. 4 B are Ad-
U6-GFP unloaded result.
Fluorescence microscope is descended in visible Ad-PLC γ 2shRNA groups and the unloaded group cells of Ad-U6-GFP green fluorescence egg
White expression, the cell of fluoresced green accounts for more than the 90% of total cells, illustrates that the recombined adhenovirus for building effectively infect
Liver cell, while being had not significant impact to cytoactive.
(2) fluorescence real-time quantitative PCR (qRT-PCR) detection Ad-PLC γ 2shRNA jamming effectiveness
Each group cell is collected after infection 24h, each group cell total rna is extracted respectively with Trizol methods, in 260/280nm wavelength
Lower measure total serum IgE purity, each group ratio meets requirement of experiment between 1.8-2.0.3.8 μ g total serum IgEs are taken, in EDC-
In 5min is reacted at 70 DEG C in 810PCR instrument, it is placed on ice after of short duration centrifugation.Reaction system is as shown in table 6.
Reaction system in the EDC-810PCR instrument of table 6
Reaction system shown in table 6 is reacted into 60min in the EDC-810PCR instrument at 42 DEG C, is then reacted at 95 DEG C
5min, the cDNA for being synthesized, in ViiATM(ABI companies, the U.S.) enters performing PCR in 7 quantitative real time PCR Instruments, and its reaction system is such as
Shown in table 7.
PCR reaction systems in the quantitative real time PCR Instrument of table 7
PCR reaction conditions are as follows：50 DEG C of 2min, 95 DEG C of 10min；95 DEG C of 30sec, 60 DEG C of 30sec, totally 40 circulations, OK
Solubility curve.Wherein, genes of interest PLC γ 2 and the reference gene β-Actin primer sequences softwares of PrimerPremier 5.0,
It is designed according to gene order, by Beijing, Qing Ke biotech companies synthesize, and sequence is as shown in table 8.It is with β-Actin finally
Reference gene, according to formula：Relative amount=2-ΔΔCtThe expression quantity of PLC γ 2 is calculated, by PCR amplification cycles number and fluorescence signal
Intensive analysis and result of calculation.
The real-time quantitative PCR primer information of table 8
QRT-PCR results as shown in figure 5, compared with control group, PLC γ 2mRNA water in Ad-PLC γ 2shRNA group cells
It is flat to significantly reduce, it is 0.05 times of control, statistical analysis are shown, Ad-PLC γ 2shRNA group PLC γ 2mRNA levels are relatively compareed
Group there were significant differences (p<0.01), illustrate that the jamming effectiveness of Ad-PLC γ 2shRNA is high, PLC γ 2 in liver cell can be significantly reduced
The expression quantity of gene.
(3) influences of the Ad-PLC γ 2shRNA to the protein expressions of rat hepatocytes PLC γ 2
Design control group, Ad-PLC γ 2shRNA groups and Ad-U6-GFP zero load groups, every group of 3 repeating holes.Cellular control unit
Unused any virus is infected, and Ad-PLC γ 2shRNA groups and Ad-U6-GFP zero loads group are separately added into infection multiplicity
(Multiplicityofinfection, MOI) is 100 Ad-PLC γ 2shRNA and Ad-U6-GFP zero load adenovirus.
After culture 24h, nutrient solution is discarded, with the 4 DEG C of PBS of precooling (0.01M, pH7.2) washed cells 3 times, in each hole
(volume ratio of RIPA and PMSF is 100 to add the μ L of RIPA lysates 400 containing PMSF (100mM):1), cracked on ice
30min, during cell fragment and lysate moved into 1.5ml centrifuge tubes, 10000 × g centrifugations 5min, collects supernatant at 4 DEG C, obtains
To albumen is extracted, protein concentration is detected using BCA methods.Take 40 μ g extract albumen carry out PAGE gel electrophoresis (concentration glue it is dense
It is 5% to spend, and resolving gel concentration is 10%) separation albumen, by albumen electrotransfer to the pvdf membrane after separation, with containing 5% degreasing
The TBST confining liquids of milk powder close 2h at room temperature, and the primary antibody [antibody (1 of rabbit-anti P of Rats LC γ 2 is added dropwise respectively：200 volume dilutions)
With small anti-rat β-actin antibody (internal reference) (1：200 volume dilutions)], 4 DEG C of overnight incubations (being more than 12h).Washed with TBST
Film (5min × 6 time) is added dropwise corresponding HRP marks secondary antibody (1 to wash away unnecessary primary antibody:50000 volume dilutions) in 37 DEG C of incubations
2h, then wash film (5min × 6 time) to remove unnecessary secondary antibody with TBST.After being developed the color through ECL luminescence reagents, with X-ray film compressing tablet, show
The development of shadow liquid, fixing solution are fixed, and develop photographic film.Film is scanned after drying, film gray value is analyzed with BandScan5.0.PLCγ
2 albumen relative expression quantities are represented with the ratio between destination protein band gray value and internal reference β-actin protein band gray values, tested
It is repeated 3 times.
This research western blotting method detects the protein expressions of rat hepatocytes PLC γ 2 after Ad-PLC γ 2shRNA infection,
Result as shown in fig. 6, can significantly see the protein bands of PLC γ 2 in Fig. 6, illustrate can be good expression rat hepatocytes
The albumen of PLC γ 2.
After transfected into rat liver cell 24h, the protein levels of PLC γ 2 are obvious compared with control group and the unloaded groups of Ad-U6-GFP in cell
Reduce, statistics display significant difference (p<0.01).The expressing quantities of control group PLC γ 2 are 0.733 ± 0.065, with Ad-U6-
GFP zero loads group (0.764 ± 0.091) is compared to without significant difference (p>0.05), as a result referring to Fig. 7.Show Ad-PLC γ 2shRNA
The expression of the albumen of In Cultured Rat liver cell PLC γ 2 can be significantly inhibited.
3rd, influences of the Ad-PLC γ 2shRNA to rat hepatocytes proliferation activity
Design control group, Ad-PLC γ 2shRNA groups and Ad-U6-GFP zero load groups, will be in exponential phase, growth shape
The good rat hepatocytes of state are with every hole 2 × 104Individual cell is inoculated in 96 orifice plates, per the μ L of pore volume 100, in 37 DEG C, 5%CO2Training
In foster case after overnight incubation, (method described in four -1) carries out interference recombined adhenovirus infection as stated above, and every group 5 multiple
Hole, separately sets negative control hole (i.e. control group).Ad-PLC γ 2shRNA (Ad-PLC γ 2shRNA groups) and Ad-U6-GFP are used respectively
24h, 48h and 72h add MTT (whole mass concentration 5mg/mL) 20 μ per hole after the infection of unloaded adenovirus (Ad-U6-GFP zero loads group)
L, continues to be incubated 4h, adds the μ L of dimethyl sulfoxide (DMSO) 150 concussions to be incubated 10min, crystal violet is fully dissolved.On ELIASA
Each hole absorbance (absorbance, A) is determined at 568nm wavelength, is returned to zero with cell free broth hole.Growth and proliferation of cell rate
(%)=experimental group A/ negative control group A value × 100%.
MTT testing results as shown in figure 8, with the extension of incubation time, the absorbance of Ad-PLC γ 2shRNA groups by
Cumulative strong, statistical analysis show, the absorbance of the Ad-PLC γ 2shRNA groups at each time point is all remarkably higher than corresponding time point
Control group and Ad-U6-GFP zero loads group (p<0.01), and the unloaded group of control group and Ad-U6-GFP difference between the two without system
Meter learns meaning (p>0.05), show that the genes of silence PLC γ 2 can promote the propagation of rat hepatocytes.Fig. 8 is shown rats'liver
Proliferative conditions (to normal cell group corresponding time period ratio, * * p of the cell in different time points<0.01, n=5)
4th, Cell cycle influences of the Ad-PLC γ 2shRNA to rat hepatocytes
Design control group, Ad-PLC γ 2shRNA groups and Ad-U6-GFP zero load groups, will be in exponential phase, growth shape
The good rat hepatocytes of state are with every hole 2 × 105Individual cell is inoculated in 6 orifice plates, per pore volume 2mL, 37 DEG C, 5%CO2 incubators
With the Ad-PLC γ 2shRNA infection cells (Ad-PLC γ 2shRNA groups) of MOI=100 after middle overnight incubation, while setting negative
Control group (i.e. control group) and positive controls (i.e. Ad-U6-GFP zero loads group).Continue in 37 DEG C, 5% (v/v) CO2Incubator
With 0.25% trypsin digestion cell without EDTA after middle culture 24h, cell is collected in digestion after terminating, and 1000rpm is centrifuged 5min,
Remove supernatant, the resuspended rinses of PBS 2 times.1000rpm, 5min, PBS re-suspended cells are used after removing supernatant, are slowly added to 80% second of precooling
Alcohol, abandons centrifugation supernatant (1000rpm, 5min) after 4 DEG C of fixed 6h, washed 2 times with precooling PBS.Add 100 μ LRNase (50ug/
Ml), 37 DEG C of water-bath 30min；400 μ LPI dye liquors are added, 4 DEG C of lucifuges react 30min.Finally use flow cytomery each group
The cell cycle of cell.Experiment is repeated 3 times.
The FCM analysis result of cell cycle as shown in Table 9, transfection 24h after, control group and Ad-U6-GFP zero load group
(76.64 ± 0.32) % is respectively in the ratio of G1 phase cells and (77.48 ± 0.73) %, Ad-PLC γ 2shRNA group G1 phases are thin
Born of the same parents' ratio is then down to (74.77 ± 1.31) %, and statistical analysis show, the latter significant difference (p compared with first two groups<0.01)；
And Ad-PLC γ 2shRNA group S phase cell proportions increase to (19.77 ± 0.85) %, with control group ((16.10 ± 0.94) %)
Pole is compared with Ad-U6-GFP zero loads group ((15.14 ± 0.87) %) to dramatically increase (p ＜ 0.01).Can from above numerical value
Go out, the Ad-PLC γ 2shRNA group liver cell G1 phases shorten, and the S phases extend, cell is in vegetative state, cell cycle progression is accelerated.
The cell cycle distribution of the rat hepatocytes of table 9
Note：Difference is represented with different capitalizations after column data extremely significantly (p ﹤ 0.01), identical capitalization represents difference
Not significantly (p ﹥ 0.05).Significance is p<0.05.
5th, influences of the Ad-PLC γ 2shRNA to hepatocyte apoptosis rate
Design control group, Ad-PLC γ 2shRNA groups and Ad-U6-GFP zero load groups, will be in exponential phase, growth shape
The good rat hepatocytes of state are with every hole 2 × 105Individual cell is inoculated in 6 orifice plates, per pore volume 2mL, 37 DEG C, 5%CO2Incubator
With the Ad-PLC γ 2shRNA infection cells (Ad-PLC γ 2shRNA groups) of MOI=100 after middle overnight incubation, while setting negative
Control group (i.e. control group) and positive controls (i.e. Ad-U6-GFP zero loads group).Continue in 37 DEG C, 5% (v/v) CO2Incubator
With 0.25% trypsin digestion cell without EDTA after middle culture 24h, cell is collected in digestion after terminating, and 1000rpm is centrifuged 5min,
Supernatant is removed, PBS is resuspended to be washed 2 times.Cell precipitation is collected after removing supernatant, cell precipitation is added to containing 5 μ L7-AAD dye liquors
In Binding Buffer, mix, at room temperature lucifuge reaction 10min.450 μ LBindingBuffer are added after reaction, is added
1 μ LAnnexinV-APC, mix, at room temperature lucifuge reaction 10min.Finally, on flow cytometer in machine testing each group cell
Apoptosis situation.Experiment is repeated 3 times.
As shown in figure 9, wherein Fig. 9 A are control group testing result, Fig. 9 B are for the FCM analysis result of Apoptosis
Ad-PLC γ 2shRNA group testing results, Fig. 9 C are the unloaded group testing results of Ad-U6-GFP, parallel with the longitudinal axis in Fig. 9 A, 9B, 9C
Line be boundary, left side is the AnnexinV-APC annexin V of mark (i.e. fluorescein APC) negative, and line right side is
AnnexinV-APC is positive, and left lower quadrant (LL) is that AnnexinV, 7-AAD are double-negative, represents normal live cells；Left upper quadrant
(UL) for 7-AAD is mono- positive, the cell of cell fragment and damage is represented；Right lower quadrant (LR) is AnnexinV mono- positive, is represented
Viable apoptotic cell；Upper right (UR) quadrant is AnnexinV, 7-AAD double positive, represents non-viable apoptotic cell.Result shows, turns
After dye 24h, the unloaded group apoptosis rate of control group and Ad-U6-GFP is respectively 9.87% and 9.52%, and Ad-PLC γ
2shRNA group apoptosis rates are down to 4.89%, and statistical analysis show, infected group apoptosis rate difference pole compared with other two groups
Significantly (p ＜ 0.01), show that suppressing the expression of PLC γ 2 can suppress hepatocyte apoptosis.
, but those skilled in the art once know basic creation although preferred embodiments of the present invention have been described
Property concept, then can make other change and modification to these embodiments.So, appended claims are intended to be construed to include excellent
Select embodiment and fall into having altered and changing for the scope of the invention.
Obviously, those skilled in the art can carry out various changes and modification without deviating from essence of the invention to the present invention
God and scope.So, if these modifications of the invention and modification belong to the scope of the claims in the present invention and its equivalent technologies
Within, then the present invention is also intended to comprising these changes and modification.
Sequence table
<110>University Of Science and Technology Of He'nan
<120>One kind targeting rat phospholipase C γ 2 disturbs recombined adhenovirus, construction method and application
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 883
<212> DNA
<213>Artificial sequence
<400> 1
ttcggatttc ttggctttat atatcttgtg gaaggacgaa acaccggtcc gcagaattcg 60
ccagcttcgt gagaagatca ttcaagagat gatcttctca cgaagctggc ttttttggat 120
ccattaggcg gccgcgtgga taaccgtatt accgccatgc attagttatt aatagtaatc 180
aattacgggg tcattagttc atagcccata tatggagttc cgcgttacat aacttacggt 240
aaatggcccg cctggctgac cgcccaacga cccccgccca ttgacgtcaa taatgacgta 300
tgttcccata gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg 360
gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga 420
cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag tacatgacct tatgggactt 480
tcctacttgg cagtacatct acgtattagt catcgctatt accatggtga tgcggttttg 540
gcagtacatc aatgggcgtg gatagcggtt tgactcacgg ggatttccaa gtctccaccc 600
cattgacgtc aatgggagtt tgttttggca ccaaaatcaa cgggactttc caaaatgtcg 660
taacaactcc gccccattga cgcaaatggg cggtaggcgt gtacggtggg aggtctatat 720
aagcagagct ggtttagtga accgtcagat ccgctagcgc taccggacgc caccatggtg 780
agcaagggcg aggagctgtt caccggggtg gtgcccatcc tggtcgagct ggacggcgac 840
gtaaacgggc cacaagttca gcgtgtccgg cgagggcgag ggc 883
<210> 2
<211> 63
<212> DNA
<213>Artificial sequence
<400> 2
aattcgccag cttcgtgaga agatcattca agagatgatc ttctcacgaa gctggctttt 60
ttg 63
<210> 3
<211> 63
<212> DNA
<213>Artificial sequence
<400> 3
gatccaaaaa agccagcttc gtgagaagat catctcttga atgatcttct cacgaagctg 60
gcg 63
Claims (3)
1. a kind of targeting rat phospholipase C γ 2 disturbs recombined adhenovirus, it is characterised in that targeting rat phospholipase C γ 2 is disturbed
Recombined adhenovirus are that the oligonucleotides shRNA that will target rat phospholipase C γ 2 inserts the skeleton plasmid containing adenoviral gene group
Obtained in pHBAd-BHG, the nucleotide sequence of the oligonucleotides shRNA is as shown in SEQ ID NO.1.
2. targeting rat phospholipase C γ 2 according to claim 1 disturbs recombination adenovirus construction method, it is characterised in that
Specifically include following steps：
Step 1, the synthesis of single-stranded shRNA oligonucleotides
Step 1.1, is respectively synthesized the F sequences and R sequences of single-stranded shRNA oligonucleotides；
Wherein, F sequences are：
AATTCGCCAGCTTCGTGAGAAGATCATTCAAGAGATGATCTTCTCACGAAGCTGGCTTTTTTG；
R sequences are：
GATCCAAAAAAGCCAGCTTCGTGAGAAGATCATCTCTTGAATGATCTTCTCACGAAGCTGGCG；
Step 2, the structure of recombinant shuttle plasmid and identification
Step 2.1, with EcoR I and BamH I double digestion shuttle vector pHBAd-U6-GFP, gel reclaims linearisation, sequence long
The empty carrier of column-slice section；
Step 2.2, concentration is diluted to for 1 μ g/1 μ L by the F sequences, the R sequences that synthesize with 1 × TE respectively, obtains F solution and R is molten
Liquid, then anneals F solution and R solution, forms annealed product double-strand F/R；
Step 2.3, the double-strand F/R in step 2.2 is connected with the empty carrier of sequence fragment long in step 2.1, obtains recombinating matter
Grain pHBAd-PLC γ 2shRNA；
Step 3, targeting rat phospholipase C γ 2 disturbs the structure of recombined adhenovirus
Step 3.1, HEK293 cells is inoculated in the DMEM complete culture solutions containing 10%FBS, in 5%CO2, in 37 DEG C of environment
Culture, when cell density reaches 70-80%, recombinant plasmid pHBAd-PLC γ 2shRNA and skeleton plasmid pHBAd-BHG are through turning
Transfection reagent LipofiterTM is mediated, and cotransfection HEK293 cells obtain cell mixture；
Step 2.2, the cell mixture is inoculated in the DMEM complete culture solutions containing 10%FBS, is rocked by the figure of eight,
5%CO2, cultivate under the conditions of 37 DEG C, fresh DMEM complete culture solutions are changed after 6h, observation of cell goes out malicious situation, when cell gradually
Into botryoidalis and when there is plaque, the cell come off from culture dish bottom is collected into centrifuge tube, centrifuge tube is alternately placed in liquid
Freeze thawing under nitrogen and 37 DEG C of water bath conditions, is then centrifuged for, and collects supernatant venom, that is, obtain Ad-PLC γ 2shRNA 1st generation seeds culture of viruses P1；
Step 2.3, with the HEK293 cells that first generation seed culture of viruses P1 densities of infection are 90%, collects second generation seed culture of viruses P2；
Step 2.4, with the HEK293 cells that second generation seed culture of viruses P2 densities of infection are 90%, collects third generation seed culture of viruses P3, and described the
Three generations's seed culture of viruses P3 is targeting rat phospholipase C γ 2 and disturbs recombined adhenovirus.
3. a kind of targeting rat phospholipase C γ 2 as claimed in claim 1 disturbs recombined adhenovirus in hepatocyte growth is suppressed
Application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710117407.6A CN106868046A (en) | 2017-03-01 | 2017-03-01 | One kind targeting rat phospholipase C γ 2 disturbs recombined adhenovirus, construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710117407.6A CN106868046A (en) | 2017-03-01 | 2017-03-01 | One kind targeting rat phospholipase C γ 2 disturbs recombined adhenovirus, construction method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106868046A true CN106868046A (en) | 2017-06-20 |
Family
ID=59169172
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710117407.6A Pending CN106868046A (en) | 2017-03-01 | 2017-03-01 | One kind targeting rat phospholipase C γ 2 disturbs recombined adhenovirus, construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106868046A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102168075A (en) * | 2011-02-28 | 2011-08-31 | 重庆医科大学附属儿童医院 | Recombinant adenovirus carrying rat retinoic acid receptor (RAR) gamma gene and construction method thereof |
| CN105039394A (en) * | 2015-09-08 | 2015-11-11 | 内蒙古民族大学 | Method for obtaining new castor-oil plant materials with improved ricinoleic acid content |
| CN105349501A (en) * | 2015-12-09 | 2016-02-24 | 山西医科大学 | Recombined Ad-TNFR2 shRNA adenoviridae and construction and application thereof |
-
2017
- 2017-03-01 CN CN201710117407.6A patent/CN106868046A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102168075A (en) * | 2011-02-28 | 2011-08-31 | 重庆医科大学附属儿童医院 | Recombinant adenovirus carrying rat retinoic acid receptor (RAR) gamma gene and construction method thereof |
| CN105039394A (en) * | 2015-09-08 | 2015-11-11 | 内蒙古民族大学 | Method for obtaining new castor-oil plant materials with improved ricinoleic acid content |
| CN105349501A (en) * | 2015-12-09 | 2016-02-24 | 山西医科大学 | Recombined Ad-TNFR2 shRNA adenoviridae and construction and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| ERNESTO DIAZ-FLORES ET AL.: ""PLC-{gamma} and PI3K Link Cytokines to ERK Activation in Hematopoietic Cells with Normal and Oncogenic Kras"", 《SCIENCE SIGNALING》 * |
| X.G. CHEN ET AL.: ""Construction of recombinant adenovirus Ad-rat PLCg2-shRNA and successful suppression of PLCg2 expression in BRL-3A cells"", 《GENETICS AND MOLECULAR RESEARCH》 * |
| 萧树东: "《胃肠病学和肝病学：基础理论与临床进展》", 31 October 2004, 上海世界图书出版公司 * |
| 赵晓龙: ""构建大鼠白细胞介素1β基因shRNA及过表达腺病毒载体"", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107893076A (en) | CRISPR Cas9 targeting knock outs human breast cancer cell RASSF2 genes and its specific sgRNA | |
| Philipson et al. | Molecular biology of adenoviruses | |
| CN105121645A (en) | Cell lines for virus production and methods of use | |
| CN101755049B (en) | Primary micro RNA expression cassette | |
| CN107190024A (en) | A kind of construction method of stable expression NS1 albuminous cells strain | |
| CN112410290A (en) | Micropterus salmoides cardiac fibroblast line and application thereof | |
| CN108486060A (en) | It is a kind of to be used to treat excretion body of tumour and its preparation method and application | |
| CN104694576B (en) | A kind of method of IFNAR1 genes in 1 cell lines of silence DF | |
| CN114107311A (en) | Target participating in porcine transmissible gastroenteritis virus infection and application thereof | |
| CN102181399B (en) | Mouse liver tumor cell line for highly expressing CD133 and preparation method thereof | |
| CN105624162B (en) | For the siRNA of mammal R-Spondin2 gene targets, ShorthairpinRNA and carrier and application | |
| CN107217071A (en) | A kind of adenovirus of recombinant rat phospholipase C γ 2, construction method and its application | |
| CN106868046A (en) | One kind targeting rat phospholipase C γ 2 disturbs recombined adhenovirus, construction method and application | |
| CN105121634A (en) | Cell strain having increased virus production ability and production method therefor | |
| CN105695421A (en) | Long-acting recombinant rabies virus vaccine strain and preparation method thereof | |
| CN102352359B (en) | Anti-pig O type foot and mouth disease virus shRNA design and carrier construction method | |
| CN101368180A (en) | Small RNA numerator for differentiation of mesenchyma stem cell into hematopoiesis cell and function target point thereof | |
| CN107338269A (en) | Conditionally replicating adenovirus carrier and application of the virus replication by Transcription inhibition type Tet on system regulations | |
| CN105925576B (en) | SiRNA, ShorthairpinRNA and carrier and application for mammal R Spondin3 gene targets | |
| CN101906417A (en) | shRNA for hepatitis B virus and recombinant adeno-associated virus vector treating vector carrying same | |
| Yang et al. | Establishment of a cell line from swim bladder of the Grass carp (Ctenopharyngodon idellus) for propagation of Grass Carp Reovirus Genotype II | |
| CN109321574A (en) | Inhibit short hairpin shRNA, slow virus and its application of ILT5 expression | |
| Kong et al. | Establishment of an immortal turkey turbinate cell line suitable for avian metapneumovirus propagation | |
| CN110157736A (en) | A method of promoting the stem cells hyperplasia of goat hair follicle | |
| CN109402117A (en) | A kind of adeno-associated virus and its preparation method and application of silencing mouse intestinal RASGRP1 expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170620 |