CN105349501A - Recombined Ad-TNFR2 shRNA adenoviridae and construction and application thereof - Google Patents
Recombined Ad-TNFR2 shRNA adenoviridae and construction and application thereof Download PDFInfo
- Publication number
- CN105349501A CN105349501A CN201510899024.XA CN201510899024A CN105349501A CN 105349501 A CN105349501 A CN 105349501A CN 201510899024 A CN201510899024 A CN 201510899024A CN 105349501 A CN105349501 A CN 105349501A
- Authority
- CN
- China
- Prior art keywords
- adenovirus
- tnfr2
- tnfr2shrna
- adenoviridae
- phbad
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses recombined Ad-TNFR2 shRNA adenoviridae. The adenoviridae contains siRNA expressed by an interference TNFR2 gene of the nucleotide sequence shown in SEQ ID No.1, the siRNA is connected under a U6 promoter of shuttle plasmid pHBAd-U6-GFP to prepare adenoviridae shuttle plasmid, and the adenoviridae shuttle plasmid and skeleton plasmid pHBAd-BHG carry out co-transfection on cells 293 to obtain the recombined adenoviridae Ad-TNFR2 shRNA. The recombined Ad-TNFR2 shRNA adenoviridae is used for obstructing/reducing expression of TNFR2 and obstructing a biological effect, generated through the path, of the TNF, so that tool medicine is designed for exploring the effect and the intracellular action mechanism, in the pain and allergy generation process, of the TNFR2; the medicine for stopping inflammatory factors from activating receptors is designed so as to weaken the pain and allergy effect caused after the receptors are activated.
Description
Technical field
The invention belongs to gene biological field of engineering technology, relate to a kind of structure of adenovirus, particularly relate to a kind of recombinant adenovirus disturbing TNFR2 to express.
Background technology
Nmda receptor is the excitatory amino acid receptor that in central nervous system, a class is important, belongs to ionotropic receptor, in synaptic plasticity and exitotoxicity, has vital role.
The different tetramer that nmda receptor is made up of NR1, NR2 and NR3 subunit, often kind of subunit distribution in central nervous system is not quite similar.It is generally acknowledged, NR1 is the required subunit of nmda receptor, distributes in a large number in brain and spinal cord, is that to realize its channel function necessary.Nmda receptor not only plays important physiological action in nervous system development process, and also plays keying action to the formation of neuronal circuit.The people such as Bird find, in the amygdala in rats neurone of arthritis model, the phosphorylation (pNR1) of nmda receptor NR1 obviously raises, and the expression of NR1 does not have considerable change; In slice patch clamp experiment, the antagonist AP5 giving amygdala neuronal NMDA receptor significantly can reduce the EPSC amplitude of nmda receptor mediation, and at suppression PKA, namely after having blocked the approach of PKA phosphorylation NR1, the EPSC of nmda receptor mediation is also blocked, and similar phenomenon does not occur after suppression PKC.This illustrates that the NR1 phosphorylation of PKA mediation is at postsynaptic membrane up-regulated, and being to cause cynapse to transmit the major reason that Changes of Plasticity occurs, is also that hyperalgesic basis occurs.
Tumour necrosis factor (TNF-α) is the inflammatory factor secreted by neurone and spongiocyte, and many biological effects of TNF-α are mediated by two cell surface receptor TNFR1 and TNFR2.Most biological activity of TNF-α carrys out transmission of signal by TNFR1, as the activation and host defense etc. of programmed cell death, antiviral activity, transcription factor NF-kappaB; Only immunity system is confined to by the signal path of TNFR2.These two acceptors are members of TNF receptor superfamily.
When pain occurs, the neuropeptide material that not only neurone produces take part in importing into of pain signal, and the multiple pro-inflammatory cytokine of neurogliocyte release, as IL-1 β and TNF-α etc. also promote importing into, as obviously will there is the up-regulated of TNF-α at inflammatory pain model mouse spinal cord of nociceptive information.
Data shows, maincenter and periphery factor cause spinal cord TNF-alpha expression to raise, and can facilitate the generation of inflammatory and neuropathic pain; The TNF-α of spinal cord spongiocyte release can improve neuronic excitability; The endogenic TNF-alpha expression of pain caused by cancer animal raises and strengthens thermosensitive response; In sheath, direct injection TNF-α can strengthen the reaction of rat spinal cord Megalobrama hoffmanni, and brings out the sufficient behavior of contracting of animal spontaneity and hot plate reaction fast, and significantly weakens the generation of rat allodynic at the antibody of the TNF-α acceptor of intrathecal injection dissolving.These all illustrate above, and TNF-α can bring out hyperpathia by activating TNF acceptor (TNFR) in spinal levels.
The people such as Wei study discovery, utilize TNF-alpha inhibitor at brain stem RVM, can weaken the quick reaction of pain that nervus infraorbitalis Chronic constriction injury (CCI) brings out, and lower the expression of pNR1.Therefore, it is contemplated that at spinal levels TNF-α by activating TNFR, having mediated the phosphorylation of nmda receptor NR1 subunit, having caused the Changes of Plasticity of neuromuscular juinction and the quick generation of pain.Recently research shows, TNF-α can increase common mouse spinal cord
confluent monolayer cells NMDA electric current, can weaken the hot plate reaction caused by intrathecal injection TNF-α, illustrate that TNF-α have impact on the functional activity of nmda receptor by its acceptor TNFR after application nmda receptor blocker MK-801 in sheath.
2 kinds of hypotype TNFR1 (55KD) of current known TNFR and TNFR2 (75KD) have expression in dorsal root ganglion (DRG) and spinal cord, but the two pain modulation in effect also disputable.It is generally acknowledged that TNFR1 has substantial connection with pain signal transmission, hyperpathia, TNFR2 does not participate in this process.And recently researched and proposed different viewpoints, Schafers etc. are by confirming with experiment in vitro in body, after nerve injury, TNFR1 plays a major role in the process causing Sensory neurone excitement and the reaction of induction pain, TNFR2 plays synergy when TNFR1 effect, it does not produce alone the effect of similar TNFR1, but after nerve damage, there is facilitation to closing on the excitement not damaging Sensory neurone.The people such as Xu think, in the neurogenic pain that root amputation injury model causes before L5 abdomen, the TNF-α of dorsal root ganglion and posterior horn of spinal cord and the rise of acceptor TNFR1 thereof are mainly worked in pain initiating process, but have nothing to do with the rest pain that neural cutting produces.Knock out the mouse experiment prompting of TNFR1 and TNFR2 gene in addition, TNFR1 and TNFR2 participates in inflammatory pain and bitterly quick process, but TNFR1 has played leading role, and TNFR2 is the inflammatory pain reaction that take part in commitment.
TNF-α is increasing expression when pain signal imports into, and participates in generation and the maintenance of the quick and allodynic of pain, but it has mediated this process by which kind of mode, which kind of approach to cause hyperpathia by after spinal cord TNFR is activated, at present also and unclear.In view of above research, when needing generation quick to inflammatory pain, TNFR1 and TNFR2 and pain mutual relationship that is quick and pNR1 do further research.The basis of above-mentioned research needs to build a kind of plasmid vector disturbing TNFR genetic expression, combines for blocking-up TNF and TNFR, blocks TNF and produce biological effect by this approach.
Summary of the invention
The object of this invention is to provide a kind of restructuring Ad-TNFR2shRNA adenovirus, and the construction process of this recombinant adenovirus, for the expression blocking/reduce TNFR2, thus the biological effect that alleviation TNF-α is produced by this approach.
For achieving the above object, the invention provides the restructuring Ad-TNFR2shRNA adenovirus of a kind of siRNA containing interference TNFR2 genetic expression, described siRNA has the nucleotide sequence shown in SEQIDNo.1.
The shuttle plasmid adopted for building described restructuring Ad-TNFR2shRNA adenovirus is pHBAd-U6-GFP, and the siRNA of described interference TNFR2 genetic expression is connected under the U6 promotor of described shuttle plasmid.
Further, it is pHBAd-BHG that the present invention builds the skeleton plasmid that described recombinant adenovirus adopts, and packing cell is 293 cells.
The construction process of restructuring Ad-TNFR2shRNA adenovirus of the present invention is the siRNA of nucleotide sequence shown in design SEQIDNo.1, shRNA shown in SEQIDNo.2 and SEQIDNo.3 that chemosynthesis is corresponding complementary strand goal gene fragment, the double-strand that annealing obtains described goal gene fragment expresses masterplate, be connected with the carrier pHBAd-U6-GFP of BamHI and EcoRI double digestion and build adenovirus shuttle plasmid, again by described adenovirus shuttle plasmid and skeleton plasmid pHBAd-BHG cotransfection 293 cell, recombinant adenovirus Ad-TNFR2shRNA can be obtained.
Restructuring Ad-TNFR2shRNA adenovirus constructed by the present invention as a kind of instrument medicine, for blocking/reducing the expression of TNFR2, can reduce the combination of TNF-α and TNFR2, thus alleviates the quick effect of induced pain of TNF-α.
By the design of the above-mentioned instrument medicine of the present invention, can explore further TNFR2 pain quick generation in effect and born of the same parents in mechanism of action, and then being applied to clinical service, design blocks inflammatory factor and activates the medicine of its acceptor, with the quick effect of pain caused after weakening receptor activation.
Accompanying drawing explanation
Fig. 1 is the plasmid map of pHBAd-U6-GFP interference carrier.
Fig. 2 is that the cell of recombinant adenoviral vector plasmid goes out malicious result.
Fig. 3 is the fluorescence display result of adenovirus Ad-TNFR2shRNA infected rats PC12 cell.
Fig. 4 is the WesternBlot detected result of adenovirus Ad-TNFR2shRNA infected rats PC12 cell.
Embodiment
Embodiment 1
The siRNA sequence that design interference TNFR2 expresses, is specially: 5'-ttgacaccctacaagccagaa-3'.
Synthetic contains the shRNA expressed sequence of above-mentioned siRNA, and described sequence connects positive-sense strand and the antisense strand of above-mentioned siRNA by the loop ring of 7 bases, and introduces BamHI and EcoRI restriction enzyme site respectively at sequence two ends.
Topstrand(62bp)：
5'-AATTCGttgacaccctacaagccagaaTGTGCTTttctggcttgtagggtgtcaaTTTTTTg-3'；
Bottomstrand(62bp)：
5'-GATCCAAAAAAttgacaccctacaagccagaaAAGCACAttctggcttgtagggtgtcaaCg-3'。
Above-mentioned complementation is utilized 3 ' and 5 ' the strand annealing double-strand that obtains corresponding object segment shRNA express masterplate annealed product.Cycle of annealing is:
System: 20 μ l;
10×Buffer2μl；
100mMTris-ClpH7.5；
1MNaCl；
10mMEDTA；
shDNA-R/shDNA-F：1/1μl；
H
2O：16μl。
Program: 95 DEG C 10 minutes; 75 DEG C 10 minutes; 55 DEG C 10 minutes; 35 DEG C 10 minutes; 15 DEG C 10 minutes.
As shown in Figure 1, be MCS (multiple clone site) district after its U6 promotor, BamHI and EcoRI is insertion point to the plasmid map of pHBAd-U6-GFP interference carrier, and object segment inserts BamHI, EcoRI site, is expressed by U6 promoter regulation.GFP genetic expression containing PCMV promoter regulation in this adenovirus carrier.
With restriction enzyme BamHI and EcoRI double digestion carrier pHBAd-U6-GFP, it is as follows that enzyme cuts system:
20 μ l enzymes cut system 37 DEG C 1 hour;
4 μ l carriers (500ng/ μ l);
1μlBamHI/1μlEcoRI；
2μl10×buffer；
12μlH
2O。
Enzyme cuts into rear glue and reclaims, recovery system: 20 μ l, containing 10 × Buffer2 μ l, and 100mMTris-ClpH7.5,1MNaCl, 10mMEDTA.
The annealed product T4 ligase enzyme of above-mentioned interference sequence TNFR2shRNA is connected between BamHI, EcoRI site of carrier pHBAd-U6-GFP, builds adenovirus shuttle plasmid, expressed by U6 promoter regulation.
Primer is the oligo sequence of Shanghai Sani's biosynthesizing PAGE glue purifying, is diluted to 100 μMs respectively.
The reaction system that the object fragment shRNA handled well is connected with carrier: the annealed product that 1 μ l has diluted; The carrier that 100-200ng enzyme cuts; 2 μ lligasebuffer; 1 μ lT4ligase; With H
2o is diluted to cumulative volume 20 μ l.
Above connecting fluid is spent the night at 4 DEG C.
By the adenovirus shuttle plasmid transformed competence colibacillus cell DH5a built, resistance: Amp; 37 DEG C of overnight incubation.
TNFR2shRNA after conversion carries out flat board and chooses bacterium, and 37 DEG C of 250rpm shake bacterium 14 hours, and checked order by bacterium liquid, sequencing result conforms to aim sequence.
Embodiment 2
The adenovirus shuttle plasmid bacterium liquid 2ml of logarithmic phase prepared by Example 1, adds 100ml containing in the LB substratum of 100 μ g/mlAmp, and 37 DEG C of 300rpm concussions are shaken bacterium and spent the night, and is carry plasmid kit in century to extract plasmid by health.
293 cells are inoculated in 60mm culture dish by day before transfection, and substratum is DMEM+10%Hyclon foetal calf serum, put 37 DEG C containing 5%CO
2incubator in overnight incubation.
Until Growth of Cells to cover with floorage 70 ~ 80% time, get recombinant adenoviral vector plasmid TNFR2shRNA and skeleton plasmid pHBAd-BHG, use Lipofiter
tMliposome (Chinese Hang Seng thing, Hanbio) transfection reagent carries out transfection.
Concrete steps are:
A. transfection changes perfect medium in first 2 hours.Get 2 μ g recombinant adenoviral vector plasmid TNFR2shRNA, 4 μ g skeleton plasmid pHBAd-BHG, dilute with 300 μ lDMEM nutrient solutions, and room temperature places 5min.
B. 15 μ lLipofiter are got
tM, dilute with 300 μ lDMEM nutrient solutions, room temperature places 5min.
C. both mixed, room temperature lucifuge places 20min.Then joined by mixture in 60mm culture dish, 8 words rock and are placed on 37 DEG C containing 5%CO
2incubator in cultivate.
Transfection, after 6 hours, changes fresh cell culture fluid.
Every day observation of cell go out malicious sign.Going out malicious phenomenon is that cell change becomes greatly round, in botryoidalis, and starts to occur obvious plaque (Fig. 2).Treat cell major part pathology and come off from bottom to carry out receipts poison, all cells and nutrient solution in 60mm culture dish are closed in 15ml centrifuge tube.
By 15ml centrifuge tube multigelation three times in liquid nitrogen and 37 DEG C of waters bath with thermostatic control, centrifugal 5 minutes of 3000rpm, collects the supernatant liquor containing virus, discards precipitation.This supernatant is Ad-TNFR2shRNA first-generation seed culture of viruses (P1), it can be used as the seed culture of viruses of a large amount of virus amplification subsequently.
Get 2ml from P1 for viral supernatants (about about 3ml), infect the cell (cell density ensures more than 90%) of a 10cm Tissue Culture Dish.Remaining viral supernatants puts into the cryopreservation tube of outward turning, and-80 DEG C of reservations, retain as seed culture of viruses.
Virus amplification two days later, is treated that receipts poison can be carried out in all cells bottom surface that comes off, is together taken in 15ml centrifuge tube by cell together with nutrient solution, according to freezing-thawing method freeze thawing above three times, gets supernatant and carries out next generation and to increase or in-80 DEG C of preservations.Often all so repeatedly carry out for virus amplification and receipts poison later.
By each 75cm
24 × 10 are inoculated in square vase
6individual 293 cells, inoculate 4 75cm
2culturing bottle, overnight incubation, until Growth of Cells full to 90% time, by whole for P2 generation virus (except taking a morsel and staying seed culture of viruses except) inoculation culture bottle, 24 hours, basis of microscopic observation 60% cytopathy, the complete pathology of 48 hours later cell.Results sick cell suspension, centrifugal 5 minutes of 2000rpm, abandons supernatant, add 4mlSTbuffer (nutrient solution+10% serum+2.5% glycerine), votex mixes, freeze thawing three times between-80 DEG C and 37 DEG C, the centrifugal 5min of 3000rpm, gets supernatant, as third generation virus (P3).
Embodiment 3
Restructuring Ad-TNFR2shRNA adenovirus is to the infection of P of Rats C12 cell and westernblot checking.
With density 2 × 10
5in plantation MEF clone to 6 orifice plate, after the degree of converging of Growth of Cells to 60%, infect Ad-GFP and Ad-TNFR2shRNA adenovirus respectively, 37 DEG C of 5%CO
2cultivate 2 hours in incubator, change nutrient solution, cultivate after 36 hours, at the luciferase expression of fluorescence microscopy Microscopic observation GFP, result as shown in Figure 3.
Collecting cell, washs 3 times with PBS, and scraper scraping cells moves into EP pipe, and centrifugal 3 minutes of 1000rpm, abandons supernatant, put into-8 DEG C of Refrigerator stores by after cell precipitation liquid nitrogen flash freezer.From-80 DEG C of refrigerators, take out cell, add the complete lysate of 500 μ lRIPA, cracking on ice 2 hours, centrifugal 30 minutes of 12000rpm, receive supernatant, abandon precipitation.Measure protein content in supernatant liquor sample with BCA method, carry out the checking of WesternBlot Protein Detection.Concrete grammar is for getting each sample protein 50 μ g, to add 5 × SDS sample-loading buffer to final concentration be 1 ×, the EP pipe containing loading sample is placed in boiling water and boils and make protein denaturation in 5 minutes, get 15 μ l well loadings, carry out SDS-PAGE electrophoresis 4 ~ 5 hours, voltage is 40V.Albumen is gone to pvdf membrane (200mA transferase 12 .5 hour), transferring film anti-to be hatched with primary antibodie, two respectively afterwards, finally utilizes chemiluminescence method to analyze protein content again.
Result shows, and Ad-TNFR2shRNA adenovirus obviously lowers the expression of TNFR2, and efficiency is obvious, sees Fig. 4.
Embodiment 4
293 cells are laid in 40 10cm culture dish, treat that cell covers with, in every block plate, add the P3 virus 20 μ l of Ad-TNFR2shRNA, after the complete pathology of cell (4 ~ 7 days), about 500 μ l10%NP-40 are added with lysing cell in every block plate, frozen in-80 DEG C.
Within 1 day in advance, from-80 DEG C of refrigerators, take out virus, room temperature (or 4 DEG C) is melted.Collecting cell lysate, centrifugal 10 minutes of 12000rpm, abandons cell debris, collects supernatant.Every 100ml supernatant adds 50mlPEG8000 (20%PEG8000,2.5MNaCl), places 1 hour precipitate virus (can proper extension) on ice.
The centrifugal said mixture of 12000rpm 20 minutes, abandons supernatant, is suspended in by throw out (solvent is 20mMTris-HCl, pH8.0) in the CsCl solution of 10ml density 1.10g/ml, venom pinkiness.
Preparation method is as follows for CsCl gradient: the CsCl solution (solvent is the same) adding 2.0ml density 1.40g/ml, slowly adds the CsCl solution of 3.0ml density 1.30g/ml, then add 5ml viral suspension.Centrifugal 2 hours of 20000rpm room temperature.
The virus band of collection density between 1.30g/ml and 1.40g/ml in dialysis tubing (dialysis tubing use before with 10mMEDTA-Na
2boil 10 minutes).At dialysis buffer liquid (50g sucrose, 10ml1MTris-HCl, pH8.0,2ml1MMgCl
2be settled to 1L) in 4 DEG C stir dialysed overnight, a dialyzate is changed in centre.Collect virus, measure virus titer.
Get the Ad-TNFR2shRNA virus liquid after 10 μ l purifying, add the Tris-HCl dilution of 90 μ lpH8.0, using the Tris-HCl of 100 μ lpH8.0 as blank, measure OD with spectrophotometric
260and OD
260/ OD
280value.
OD
260/ OD
280normal range be 1.20 ~ 1.40, detected result is 1.31, meets normal range.
Virion number (VP) and OD
260reduction formula be (OD
260) × extension rate × 1.1 × 10
12vP/ml.
Measured OD
260be 0.123, volume 1ml, total viral particles number is 2.8 × 10
12vP.
The detection of infection titer adopts the TCID improved
50method, recording total titre is 1 × 10
11pFU.
SEQUENCELISTING
<110> Mountain Western Medicine S University
<120> recombinates Ad-TNFR2shRNA adenovirus and structure thereof and application
<160>3
<170>Patentinversion3.2
<210>1
<211>21
<212>DNA
<213> artificial sequence
<400>1
TTGACACCCTACAAGCCAGAA21
<210>2
<211>62
<212>DNA
<213> artificial sequence positive-sense strand
<400>2
AATTCGTTGACACCCTACAAGCCAGAATGTGCTTTTCTGGCTTGTAGGGTGTCAATTTTT60
TG62
<210>3
<211>62
<212>DNA
<213> artificial sequence antisense strand
<400>3
GATCCAAAAAATTGACACCCTACAAGCCAGAAAAGCACATTCTGGCTTGTAGGGTGTCAA60
CG62
Claims (7)
1. restructuring Ad-TNFR2shRNA adenovirus, the siRNA containing interference TNFR2 genetic expression, described siRNA has the nucleotide sequence shown in SEQIDNo.1.
2. restructuring Ad-TNFR2shRNA adenovirus according to claim 1, wherein building the shuttle plasmid that described adenovirus adopts is pHBAd-U6-GFP.
3. restructuring Ad-TNFR2shRNA adenovirus according to claim 2, the siRNA of wherein said interference TNFR2 genetic expression is connected under the U6 promotor of described shuttle plasmid.
4. restructuring Ad-TNFR2shRNA adenovirus according to claim 2, wherein building the skeleton plasmid that described adenovirus adopts is pHBAd-BHG.
5. restructuring Ad-TNFR2shRNA adenovirus according to claim 2, wherein building the packing cell that described adenovirus adopts is 293 cells.
6. the construction process of Ad-TNFR2shRNA adenovirus of recombinating, the siRNA of nucleotide sequence shown in design SEQIDNo.1, shRNA shown in SEQIDNo.2 and SEQIDNo.3 that chemosynthesis is corresponding complementary strand goal gene fragment, the double-strand that annealing obtains described goal gene fragment expresses masterplate, be connected with the carrier pHBAd-U6-GFP of BamHI and EcoRI double digestion and build adenovirus shuttle plasmid, again by described adenovirus shuttle plasmid and skeleton plasmid pHBAd-BHG cotransfection 293 cell, obtain recombinant adenovirus Ad-TNFR2shRNA.
7. Ad-TNFR2shRNA adenovirus of recombinating described in claim 1 is as the application blocking/reduce the instrument medicine that TNFR2 expresses.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510899024.XA CN105349501A (en) | 2015-12-09 | 2015-12-09 | Recombined Ad-TNFR2 shRNA adenoviridae and construction and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510899024.XA CN105349501A (en) | 2015-12-09 | 2015-12-09 | Recombined Ad-TNFR2 shRNA adenoviridae and construction and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105349501A true CN105349501A (en) | 2016-02-24 |
Family
ID=55325565
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510899024.XA Pending CN105349501A (en) | 2015-12-09 | 2015-12-09 | Recombined Ad-TNFR2 shRNA adenoviridae and construction and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105349501A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868046A (en) * | 2017-03-01 | 2017-06-20 | 河南科技大学 | One kind targeting rat phospholipase C γ 2 disturbs recombined adhenovirus, construction method and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008063639A2 (en) * | 2006-11-21 | 2008-05-29 | Massachusetts Eye And Ear Infirmary | Compositions and methods for preserving cells of the eye |
| WO2009045397A1 (en) * | 2007-10-02 | 2009-04-09 | Stowers Institute For Medical Research | Methods for treating polycystic kidney desease (pkd) or other cyst forming diseases |
| CN101838648A (en) * | 2010-01-20 | 2010-09-22 | 暨南大学 | shRNA for inhibiting mouse TRAF6 gene expression and application thereof |
-
2015
- 2015-12-09 CN CN201510899024.XA patent/CN105349501A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008063639A2 (en) * | 2006-11-21 | 2008-05-29 | Massachusetts Eye And Ear Infirmary | Compositions and methods for preserving cells of the eye |
| WO2009045397A1 (en) * | 2007-10-02 | 2009-04-09 | Stowers Institute For Medical Research | Methods for treating polycystic kidney desease (pkd) or other cyst forming diseases |
| CN101838648A (en) * | 2010-01-20 | 2010-09-22 | 暨南大学 | shRNA for inhibiting mouse TRAF6 gene expression and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| FUQIAN YANG: "TNFR2 promotes Adriamycin resistance in breast cancer cell by repairing DNA damage", 《MOLECULAR MEDICINE REPORTS》 * |
| MARTINE PERROT-APPLANAT ET AL: "Similar NF-κB Gene Signatures in TNF-α Treated Human Endothelial Cell and Breast Tumor Biopsies", 《PLOS ONE》 * |
| OSBURG,B ET AL: "Rattus norvegicus tumor necrosis factor receptor type II mRNA,partial cds", 《GENBANK：AG420214.1》 * |
| 赵晓龙 等: "构建大鼠白细胞介素1β基因shRNA腺病毒载体", 《中国组织工程研究》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868046A (en) * | 2017-03-01 | 2017-06-20 | 河南科技大学 | One kind targeting rat phospholipase C γ 2 disturbs recombined adhenovirus, construction method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fu et al. | A novel fish cell line derived from the brain of Chinese perch Siniperca chuatsi: development and characterization | |
| LeBlanc et al. | RNA trafficking in parasitic plant systems | |
| WO2006058489A1 (en) | A recombinant adeno-associated virus expressing human antisense gene cyp2j2 and its preparation methods | |
| Baulcombe | The role of viruses in identifying and analyzing RNA silencing | |
| CN109576231A (en) | Isolated recombination oncolytic adenovirus, pharmaceutical composition and its purposes in the drug for the treatment of tumour and/or cancer | |
| CN102994534B (en) | Duck plague virus gE gene transfer vector pUC-Delta gE-EGFP and recombinant strain DPV-Delta gE-EGFP | |
| CN103882056A (en) | Artificial chromosome plasmids of H5N1 subtype of avian influenza virus and duck enteritis virus bacteria | |
| CN105349502A (en) | TNFR1 gene recombinant adenovirus and construction thereof | |
| CN107586759B (en) | Construction method and application of recombinant Newcastle disease virus | |
| Mohanty et al. | A point mutation in the rhesus rotavirus VP4 protein generated through a rotavirus reverse genetics system attenuates biliary atresia in the murine model | |
| CN107267469A (en) | Dynein mosaic type recombinant human B type adenovirus and preparation method thereof | |
| CN108004216B (en) | Application and recombinant herpes simplex virus and its preparation method and application of the TSPO in treatment glioma | |
| CN105420264B (en) | A kind of preparation method of anti-tobacco potato Y virus vaccine | |
| CN105396143A (en) | MiRNA of specificity of Ebola virus and method for inhibiting Ebola virus through miRNA | |
| CN106520710A (en) | Preparation method and application of live vector vaccine for expressing duck Tembusu virus (DTMUV) prm and E protein recombinant Newcastle disease virus (NDV) | |
| CN105349501A (en) | Recombined Ad-TNFR2 shRNA adenoviridae and construction and application thereof | |
| CN105274142A (en) | Replicative recombinant human 55-type Adenovirus vector and preparation method and application thereof | |
| CN109182277A (en) | A kind of swamp eel rhabdovirus CrERV and RT-PCR detection primer and application | |
| JP2003531605A (en) | Viral clearance of neoplastic cells from mixed cellular compositions | |
| Castellano et al. | Fig mosaic in mexico and south Africa | |
| CN103548775A (en) | CD81 (cluster of differentiation 81) and OCLN (occludin) dual-transgenosis murine, construction method of same and application of same | |
| CN109136200A (en) | A kind of recombination infectious hematopoietic necrosis poison and its construction method and application | |
| CN105296600A (en) | Application of Med23 genes and medicine related to Med23 genes | |
| Bowman | Plant Virology | |
| CN103898053A (en) | Stable knockdown Numb and Numblike cell line and construction method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination |