CN101368180A - Small RNA numerator for differentiation of mesenchyma stem cell into hematopoiesis cell and function target point thereof - Google Patents
Small RNA numerator for differentiation of mesenchyma stem cell into hematopoiesis cell and function target point thereof Download PDFInfo
- Publication number
- CN101368180A CN101368180A CNA2008102241153A CN200810224115A CN101368180A CN 101368180 A CN101368180 A CN 101368180A CN A2008102241153 A CNA2008102241153 A CN A2008102241153A CN 200810224115 A CN200810224115 A CN 200810224115A CN 101368180 A CN101368180 A CN 101368180A
- Authority
- CN
- China
- Prior art keywords
- stem cell
- cell
- little rna
- derivatives
- eid1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention provides small RNA (shR337) capable of differentiating hematopoietic stem cells (MSC) from human nonhematopoietic stem cells (HSC) such as mesenchymal stem cells (MSC). The discovery of the small RNA also provides an action target capable of differentiating the hematopoietic stem cells from the human nonhematopoietic stem cells such as the bone marrow mesenchymal stem cells. The small RNA can restrict the protein translation of EIDI genes after being transfected to human bone marrow mesenchymal stem cells to transform the human bone marrow mesenchymal stem cells into hematopoietic stem cells with CD45<+>surface antigen positive, and the hematopoietic stem cells with CD45<+>surface antigen positive can be further differentiated into myeloid cells and lymphoid cells. Mice in vivo experiments show that the differentiation of the small RNA to the mesenchymal stem cells is directional and undivided.
Description
Technical field
The invention belongs to the genomic medicine field, more specifically, relate to a kind of little hairpin RNA with particular sequence, it passes through the expression of the differentiation inhibiting factor of inhibition ElA sample, thereby mescenchymal stem cell is divided into hematopoietic cell.
Background technology
Hematopoietic stem cell transplantation is the emerging treatment technology a kind of likely of some disease that is difficult to cure of treatment.Yet the source of hemopoietic stem cell remains obstruction hemopoietic stem cell treatment technology and brings into play one of major obstacle of effect clinically.Seek the stem cell in other source and make it to be divided into the important topic that hemopoietic stem cell is present scientists study.Mescenchymal stem cell (MSC) is many a kind of stem cells of various countries scientist research, and (HSC) is the same with hemopoietic stem cell, and the both has the ability of self and keeps the hemopoietic function of organ.The feature that the mesenchymal stem cells MSCs of tissue culture amplification is different from hemopoietic stem cell is that mesenchymal stem cells MSCs is not expressed CD45 and CD31 molecule (1).Although report is arranged recently to be thought, under suitable culture condition, mesenchymal stem cells MSCs can be induced to be divided into hemopoietic stem cell (2), but the most studies personnel think that still vitro culture still can not be converted into mesenchymal stem cells MSCs hemopoietic stem cell (4-5).Therefore seek new method mesenchymal stem cells MSCs is changed into hemopoietic stem cell in that to expand stem cell application clinically significant.
The expression of discovering the dissimilar medium and small RNA of hematopoietic cell in recent years is significantly different, and plays important regulatory role in this cells whose development process that do not coexist.For example, miR-181 relevant with the lymphocytic growth of B-(6), miR-142 is relevant with the lymphocytic growth of miR-223 and T-, miR-221 relevant with miR-222 (7) with people's erythropoiesis, the granulocyte differentiation of miR-223 and mouse is relevant, and miR-10, miR-126 reduces relevant (8) with miR-17 with megalokaryocyte.In addition, people also find some little RNA, as miR-128 and miR-181, can play the effect (9) that stops the hemopoietic stem cell differentiation.Although have been found that some miRNA, for example miR-130a and miR-10a, thereby by effect HOXA1 gene and the differentiation of MAFB gene transcription factor gene inducing cell, still unclear whether some miRNA of people or other little RNA just can determine the self process of cell, and can be hemopoietic stem cell with the mesenchymal stem cells MSCs directed differentiation at cytocerastic commitment.
Summary of the invention
The present invention relates to a kind of little hairpin RNA with particular sequence, it passes through the expression of the differentiation inhibiting factor (EID1) of inhibition E1A sample, thereby mescenchymal stem cell (MSC) is divided into hematopoietic cell stem cell (HSC).
Core content of the present invention has following six aspects.
First aspect, the invention provides a kind of bob folder nucleic acid shR-337 or derivatives thereof that non-hematopoietic stem cell can be divided into hemopoietic stem cell, described bob folder nucleic acid shR-337 has the core nucleotide sequence: 5 '-GAUCCCGUGUAACACAAUGGUGAGUAUUUGacuagaauauaCAAAUACUCACCAUU GUGUUACAUUUUUUGGAAA-3 ' (SQE.ID.No.1).The structure of this bob folder nucleic acid results from first intron position of human body protein encoding gene SH3PXD2B, similar with the bob folder nucleic acid of external source, two chains of the stem of this bob folder nucleic acid are complete complementation, comprise at least 21 Nucleotide (ACAUUGUGUUACCACUCAUAA sees Figure 1B).This class small nucleic acids can be expressed by high abundance in hemopoietic stem cell, and in non-hematopoietic stem cell, very low as the expression abundance in the mesenchymal stem cells MSCs.Deutero-contains the little RNA of the core texture of above-mentioned nucleic acid thus, comprises the small nucleic acids of different lengths and can transcribe the small nucleic acids expression vector that generates this type of small nucleic acids in vivo, also has certain function that mescenchymal stem cell is converted into hemopoietic stem cell.
It should be appreciated by those skilled in the art, any one Nucleotide in the nucleotide sequence of the present invention can be that nature is literalness, also can modify, comprise peptide Nucleotide (PNA), locking Nucleotide (LNA) or methoxy-or Nucleotide of modifying of ethoxy through the different chemical method.
In addition, those skilled in the art be also to be understood that Nucleotide of the present invention, and it can also comprise the single-chain nucleic acid of being derived out by above-mentioned hair clip nucleic acid, as 5 '-GAUCCCGUGUAACACAAUGGUGAGUAUUUG-3 ' etc., or double-strandednucleic acid
5′-GUAACACAAUGGUGAGUAUUUG-3’
||||||||||||||||||||||
3 '-CAUUGUGUUACCACUCAUAAAC-5 ' etc.
Second aspect, (GeneBank gene registration number is: NM_014335.2) to the invention provides the action target spot EID1 (E1A-sample differentiation inhibiting factor 1) that mescenchymal stem cell can be divided into hemopoietic stem cell.3 ' untranslated region at EID1 exists 5 and the interactional action site of the described little RNA of first aspect present invention (Fig. 1 C).Suppress the expression of EID1 and can induce non-hematopoietic stem cell, as the directed differentiation of bone marrow stem cell to hemopoietic stem cell.
The third aspect, according to above-mentioned aspect, the present invention studies show that further some siRNA molecules of target EID1 also have the effect of the little RNA of endogenous, they can suppress the expression of target EID1 effectively, thus as endogenic shR-337 can the inducing bone mesenchymal stem cell to the directed differentiation of hemopoietic stem cell.The present invention is with the siRNA molecule called after siR-EID1 of this target EID1, and it includes, but not limited to the siRNAs of SEQ.ID.No.2-23 correspondence listed in the following table 1, and their derivative.
Fourth aspect, the invention provides a kind of method that mescenchymal stem cell is converted into hemopoietic stem cell, it comprises little RNA or derivatives thereof of the present invention transfection in mescenchymal stem cell, by the expression of restraining effect target spot EID1 mescenchymal stem cell is converted into hemopoietic stem cell.
The 5th aspect the invention provides the purposes of little RNA or derivatives thereof of the present invention, and it can be used to prepare the medicine that mescenchymal stem cell is converted into hemopoietic stem cell, is used for the treatment of people's hematologic disease.In addition, little RNA or derivatives thereof of the present invention can also be used to prepare the test kit that comprises it.
The 6th aspect the invention provides the test kit that comprises little RNA or derivatives thereof of the present invention.
Below will the invention will be further elaborated by embodiment, but embodiment does not limit protection scope of the present invention.Those skilled in the art can not deviate from the modification and the change of the spirit and scope of the present invention according to design of the present invention and disclosed technical scheme fully, and this is also within protection scope of the present invention.
Description of drawings
Fig. 1. a kind of have a bobby pin RNAshR-337 that non-hematopoietic stem cell can be divided into hemopoietic stem cell.(A) expression level of shR-337 in the different dry cell; (B) exemplary configuration of shR-337 and (C) action target spot of shR-337 inhibition EID1 genetic expression.
Fig. 2. cross and express the little RNA of shR-337 can suppress target EID1 effectively in the level of translating biosynthesizing.(A) little RNA of no function and shR-337 have the structure of the little rna expression carrier of function.(B) the new expression level of the little RNA of shR-337 in different cells of identifying.(C) real-time quantitative PCR discloses the expression not influence of the little RNA of shR-337 to EID1mRNA to the EID1 genetic expression quantitative analysis under the different condition, and the expression that corresponding siRNA can significantly reduce EID1mRNA.(D) western blot analysis shows that the little RNA of shR-337 induces the decline of EID1 protein level significantly, disclosing the little RNA of shR-337 can suppress the synthetic of EID1 in the level of translating, and wherein identical protein applied sample amount guarantees by the amount of the identical Actin muscle that makes immune marking analysis and obtain.
Fig. 3. the propagation and the differentiation of forced expression shR-337 energy inducing cell in human marrow-interstitial stem cell.(A) (model: EHSY LAB, Japanese OLYMPUS) observed human marrow-interstitial stem cell under inverted microscope, transfection have the human marrow-interstitial stem cell of false little RNA (Mock) and the cellular form of the human marrow-interstitial stem cell that transfection has shR-337.(B) in growth medium, cultivated 24 hours behind the cell transfecting, in transferring to the cytodifferentiation substratum, cultivate the immunohistochemical staining that carries out the single-minded CD45 of hemopoietic stem cell after 12 hours again.(C) cell colony of CD45 male hemopoietic stem cell forms capability analysis.The colony number of cell that formed in 14 days behind the little RNA carrier of human marrow-interstitial stem cell transfection shR337 and vacation.N〉6/ group, p＜0.001.。
Fig. 4. forced expression shR-337 is to the influence of hemopoietic stem cell system differentiation in the body.(A) immunofluorescence at 60 days mouse bone marrow cells positions and Hochest33342 (Sigma-Aldrich, cat.no.H-3201) dyeing after the Transplanted cells.Showed among the figure and planted contrast, transfection have people CD45, CD13 or the antigenic cell of CD33 specificity in false little RNA (Mock) and the mouse bone marrow cells after shR-33760 days.(B) hemopoietic stem cell that is undertaken by human marrow-interstitial stem cell in NOD-SCID mouse body is rebuild.105GFP+CD45+BMSCs is transplanted to the NOD-SCID mouse that crosses through the radiotreatment of critical lethal dose.After transplanting for 8 weeks, the fluidic cell figure of bone marrow cells in mice shows the reconstruction with various kinds of cell system (lymphocyte and medullary cell).(C) shR-337 induces the working machine drawing of hemopoietic stem cell system differentiation.(D) expression level of RUNX1 in different situations.
Embodiment
Below will do further detailed elaboration to the present invention by embodiment.But, will be understood by those skilled in the art that following embodiment only is presented for purposes of illustration, does not limit protection scope of the present invention, the spirit and scope of the present invention are limited by accompanying Claim.The relevant technician in this area can not deviate from the modification and the change of the spirit and scope of the present invention according to design of the present invention and disclosed technical scheme fully, and this is also within protection scope of the present invention.
Sample of bone marrow derives from volunteer's (age be 20-50 year) of 30 health, marrow obtain the governing principle of utilizing human material to carry out scientific research of following management committee of BJ Union Hospital, under the prerequisite that the donor agrees, carry out.Separate from marrow that to have phenotype be Flk1
+CD31
-CD34
-The basic step of stem cell be: obtain monocyte by saccharose gradient density centrifugation (centrifugal force is 1.077g/ml).Utilization is combined with CD5, and the magnetic bead of GlyA and CD34 is rejected the hemopoietic stem cell in the monocyte that obtains.In order to obtain the cell clone in unicellular source, each patient's medullary cell is covered with fibronectin (fibronectin by what limiting dilution assay was diluted to 9600 holes successively, catalog number (Cat.No.) W1509, available from Genitix, Britain) and collagen protein (collagen, catalog number (Cat.No.) W1557 is available from Genitix, Britain) on the culture plate, making cell count is 1/hole.Cell culture medium is the Eagle substratum of Dulbecco improvement and contains 40%MCDB-201 (catalog number (Cat.No.) M6770, Sigma-Aldrich) and the trace element Ham F12 perfect medium, above-mentioned culture medium supplemented 2% foetal calf serum (catalog number (Cat.No.) 12319018, GIBCO), the commentaries on classics selenium Regular Insulin of 1ng (insulin transferring selenium) (catalog number (Cat.No.) 17-838Z ITS, Bi Long-bit is won Bioisystech Co., Ltd, Xi'an), 10
-9M dexamethasone (dexamethasone) (catalog number (Cat.No.) D-2915, Sigma), 10
-4M2-phosphoric acid-xitix (catalog number (Cat.No.) A-8960, Sigma), 20ng/ml interleukin-6 (R﹠amp; D systems, catalog number (Cat.No.) 406-ML), 10ng/ml Urogastron (catalog number (Cat.No.) E-9644, Sigma), growth factor B B (the Sigma-Aldrich in 10ng/ml thrombocyte source, catalog number (Cat.No.) P-3201), the part of 50ng/ml tire beef liver Tyrosylprotein kinase 3 (Flt-3) (Sigma catalog number (Cat.No.) P2850), form protein-4 (the catalog number (Cat.No.) P2714 of the bone of 30ng/ml, Sigma Chemical, StLouis, MO) and the penicillin of 100 units/ml (catalog number (Cat.No.) 15140-122, GibcoInvitrogen) and the Streptomycin sulphate of 100 μ g/ml (catalog number (Cat.No.) 15140-122, Gibco Invitrogen).Cell at 37 ℃, is cultivated in the wet air of 5% carbonic acid gas.Changed once in the every 4-6 of substratum days.During tissue culture, the single attached cell in the culture tank was identified at first day that cultivates.Every day the checklist cell colony formation.Unicellular colony is by the collection of trypan blue method and carry out amplification cultivation.CD133
+The blood of hemopoietic stem cell from blood bank CD133 is arranged through coupling
+The magnetic bead of immune antibody separates.
The structure and the transfection of the expression vector of embodiment 2. bob folder small nucleic acids pre-shR337
We use information biology to find that from first intron of human body protein encoding gene SH3PXD2B a bob presss from both sides little rna gene, called after shr-337.For confirming that this little rna gene can produce the little RNA of function corresponding, we detect its expression (Figure 1A) in hemopoietic stem cell with the cloning and sequencing technology.In order to make up the virus vector that to express this little RNA, synthesized hair clip dna sequence dna with the corresponding weak point of sequence of pre-shR337 with the method for chemosynthesis: 5 '-GATCCCGTGTAACACAATGGTGAGTATTTGactagaatataCAAATACTCACCATT GTGTTACATTTTTTGGAAA-3 ' and 5 '-AGCTTTTCCAAAAAATGTAACACAATGGTGAGTATTTGtatattctagtCAAATAC TCACCATTGTGTTACACGG-3 ', two DNA annealing of synthetic are formed double-stranded DNA, the molecular cloning method that utilizes standard with above-mentioned dna clone to retrovirus carrier pMSCV (catalog number (Cat.No.) 35140, Invitrogen) in.The small nucleic acids expression plasmid that makes up utilizes U6 promoter expression purpose small nucleic acids pre-shR337.This plasmid (is originated: basis institute of medical courses in general institute cell centre) (4,8,9,11) to people's renal epithelial cell H293T by the transfection of cell transfecting reagent.The control plasmid mock-GFP transfection that uses the same method.The retrovirus that contains in the transfection H293T cell of mock-GFP and shR337-GFP is respectively 3 * 10
6/ ml and 4 * 10
6/ ml.
After Fig. 2 B has provided the human marrow-interstitial stem cell that the virus vector transfection that will contain shR-337 cultivates in the embodiment 1, the expression level of shR-337 in cell that the quantitative RT-PCR by standard detects.Compare with the situation of contrast and false little RNA transfection, behind the transfection shR-337 virus expression carrier (expression vector collection of illustrative plates synoptic diagram is seen Fig. 2 A), the expression level of intracellular shR-337 significantly increases (Fig. 2 B).And can keep in the cell midium or long term behind the transfection shR337.Efficiently expressing behind the shR-337 target gene EID1 that can detect shR337 with the RT-PCR reaction in 2 days has small variation (Fig. 2 C) on its transcriptional level, but with the protein expression level of immune marking analysis discovery EID1 significant reduction (Fig. 2 D) has taken place.Endogenic EID1 downward modulation is consistent in this point and the hemopoietic stem cell, the expression of simultaneous CD45 marker molecule (Fig. 3 A and 3B).
Unicellularly can generate the offspring who has broken up in order to be unequivocally established by incubation growth, the stem cell of transfection separated inoculate in 24 well culture plates that scribble fibronectin and collagen protein, and in substratum, add the mixture of hemopoietic stem cell cytokine and somatomedin.The human marrow-interstitial stem cell of transfection identifies by detecting in the transfection carrier contained green fluorescent protein, and bone marrow interstital stem cell differentiation becoming hemopoietic stem cell is tested and appraised narrow spectrum CD45 surface antigen (Fig. 3 A) and identifies.
From the marrow of each group, choose 2000 cells, and carry out 14 days tissue culture.Cell in vitro group forms capability analysis and shows (1,2,3,5), in this culturing process of 14 days, crosses expression shR-337 and helps growth and form progenitor cell.This variation is because the selective amplification of transfectional cell.Only when containing the cell amplification of shR-337, expanded cells mainly just mainly is to contain the cell of green fluorescent protein and have CD45 male feature, shown in Fig. 3 B.Though at bone marrow interstital stem cell, the cell count that transfection has the bone marrow interstital stem cell of false little RNA carrier and transforms initial inoculation under three kinds of situations of the bone marrow stem cell that shR-337 is arranged is 5000/hole, but the transfectional cell that only contains shR337 could fast breeding (Fig. 3 C).Quantitative analysis shows to have only 0.02% cell can form CD45 male group through 14 days cultivation in infection has the bone marrow stem cell of false little RNA carrier, have 0.5% cell can form CD45 positive cells group and have in the bone marrow stromal cell of shR337 through 14 days cultivation in infection.This result shows that the expression amount of mandatory rising shR337 in bone marrow interstital stem cell can become hemopoietic stem cell with the narrow spectrum directed differentiation of bone marrow interstital stem cell.
The target gene EID1 that embodiment 4. suppresses shR-337 can induce the conversion of bone marrow interstital stem cell to hemopoietic stem cell equally
Present embodiment has synthesized the little RNAs molecule of a series of interference siR-EID1 of the reticent EID1 gene in high specificity ground by chemical synthesis, and (sequence sees Table 1, SQE.ID.No.2-23), but it should be appreciated by those skilled in the art that it is not limited to these siRNAs, can also comprise the siRNAs molecule that other can make the downward modulation of target EID1 gene accordingly, or their derivative.In the present embodiment, with one of them siR-EID1, be SQE.ID.No.2, in the mesenchymal stem cells MSCs that transfection is cultivated in the embodiment 1, and analyze the EID1 expression of gene with quantitative RT-PCR method and change, compare with the little RNA contrast of vacation, transfection in the mesenchymal stem cells MSCs of EID1-siRNA the expression amount of EID1 reduced by 40% (Fig. 2 C), become hemopoietic stem cell and can break up through the mesenchymal stem cells MSCs of above-mentioned processing, and be accompanied by the expression (Fig. 3 A) of CD45 specificity surface antigen, and the false little RNA of transfection does not have the specificity expression of CD45 surface antigen.We find that the action target spot of shR-337 is the EID1 gene from the result of study of present embodiment, and the EID1 gene that knocks out in the bone marrow interstital stem cell can cause the bone marrow interstital stem cell directed differentiation to become hemopoietic stem cell.
The sequence of the siRNA molecule (siR-EID1) of table 1. target EID1mRNA different loci.
With transfection have the bone marrow interstital stem cell of the retrovirus enzyme carrier of shR-337 and false shRNA be transplanted to respectively severe combined immunodeficiency mouse through the radiotreatment of critical lethal dose (product of mouse be non-obese diabetes (nonobese diabetic) (NOD)/LtSz-scid/scid (SCID), source: Shanghai knubble biological technical institute, about body weight 20g, age: 6-8 week, male) in the body.Can detect the hematopoietic cell that is divided into by the bone marrow interstital stem cell of expressing GFP after 60 days.Utilize the antigenic monoclonal antibody of anti-Humanized cell that the marrow of mouse is carried out immunohistochemical analysis, discovery is in the expression that can detect hemopoietic stem cell progenitor cell genetic marker molecule in the marrow of the mouse of the radiotreatment of critical lethal radiation dose, and these hemopoietic progenitor cell can further be divided into the marrow sample white corpuscle of feature representation CD33 molecular marker with the lymphocyte (Fig. 4 A) of feature representation CD13 molecular marker.On the contrary, at control group and the marrow position of transplanting the mouse experiment group that false siRNA is arranged, almost detect CD45, CD33 or CD13 feature molecular marker positive cells less than human archeocyte.
We have also collected each organ of experimental mouse respectively, detect the cell that whether exists in each organ by after people's the bone marrow interstital stem cell differentiation by the GFP luminescence method.Detected result is not observed the noble cells of people's bone marrow interstital stem cell.This shows shR-337 can specificity people from ground bone marrow interstital stem cell directed differentiation is become hemopoietic stem cell.We have also adopted the monoclonal antibody such as the anti-CD13 of three kinds of anti-people source white corpuscles and stem cell molecular marker, and CD33 and CD45 antibody carries out phenotype analytical to the interstital stem cell noble cells in the mouse bone marrow cells.8 week backs obtain from the medullary space of mouse has infected transfection and has the component of the human marrow-interstitial stem cell of shR-337 to carry out cell flow cytometer showed (Fig. 4 B).Consistent with the result of in vitro study, in people's bone marrow interstital stem cell, express shR-337 and can make CD13 male lymphocyte bring up to 2.8% of experimental group from 0.5% of control group.Equally, CD33 male medullary cell is also increased significantly.
The foregoing description shows the siRNAs that shR-337 is relevant with other EID1, by suppressing the EID-1 expression of gene, can be in vivo with external specificity ground with non-hematopoietic stem cell, be divided into hemopoietic stem cell as human marrow-interstitial stem cell.This result of study discloses these small RNA moleculars and perhaps can be used for the differentiation of large-scale mescenchymal stem cell to hematopoietic cell, so that replaces hemopoietic stem cell to be used for the treatment of blood of human body disease.
Reference
1.Angelopoulou，M.，Novelli，E.，Grove，J.E.，Rinder，H.M.，Civin，C.，Cheng，L.，Krause，D.S.，2003.Cotransplantation?of?human?mesenchymal?stemcells?enhances?human?myelopoiesis?and?megakaryocytopoiesis?inNOD/SCID?mice.Exp.Hematol?31，413-420.
2.Chamberlain?G，Fox?J，Ashton?B，Middleton?J.Concise?review：mesenchymal?stem?cells：their?phenotype，differentiation?capacity，immunological?features，and?potential?for?homing.Stem?Cells.2007Nov；25(11)：2739-49.
3.Jiang，Y.，Jahagirdar，B.N.，Reinhardt，R.L.，Schwartz，R.E.，Keene，C.D.，Ortiz-Gonzalez，X.R.，Reyes，M.，Lenvik，T.，Lund，T.，B?lackstad，M.，Du，J.，Aldrich，S.，Lisberg，A.，Low，W.C.，Largaespada，D.A.，Verfaillie，C.M.，2002a.Pluripotency?of?mesenchymal?stem?cells?derived?from?adultmarrow.Nature418，41-49.
4.Chen，C.Z.，Li，L.，Lodish，H.F.&Bartel，D.P.(2004)MicroRNAsmodulate?hematopoietic?lineage?differentiation.Science，303，83-86.
5.Chen?X，Xu?H，Wan?C，McCaigue?M，Li?G.Bioreactor?expansion?of?humanadult?bone?marrow-derived?mesenchymal?stem?cells.Stem?Cells.2006Sep；24(9)：2052-9.
6.Chen?Y，Haviernik?P，Bunting?KD，Yang?YC.Cited2?is?required?for?normalhematopoiesis?in?the?murine?fetal?liver.Blood.2007?Oct15；110(8)：2889-98.
7.Fazi，F.，Rosa，A.，Fatica，A.，Gelmetti，V.，De?Marchis，M.L.，Nervi，C.&Bozzoni，I.(2005)A?minicircuitry?comprised?of?microRNA-223?andtranscription?factors?NFI-A?and?C/EBPalpha?regulates?humangranulopoiesis.Cell，123，819-831.
8.Felli，N.，Fontana，L.，Pelosi，E.，Botta，R.，Bonci，D.，Facchiano，F.，Liuzzi，F.，Lulli，V.，Morsilli，O.，Santoro，S.，Valtieri，M.，Calin，G.A.，Liu，C.G.，Sorrentino，A.，Croce，C.M.&?Peschle，C.(2005)MicroRNAs?221?and?222inhibit?normal?erythropoiesis?and?erythroleukemic?cell?growth?via?kitreceptor?down-modulation.PNAS，102，18081-18086.
9.Garzon，R.，Pichiorri，F.，Palumbo，T.，Iuliano，R.，Cimmino，A.，Aqeilan，R.，Volinia，S.，Bhatt，D.，Alder，H.，Marcucci，G.，Calin，G.A.，Liu，C.G.，Bloomfield，C.D.，Andreeff，M.&?Croce，C.M.(2006)MicroRNAfingerprints?during?human?megakaryocytopoiesis.PNAS?103，5078-5083.
10.Georgantas，III，R.W.，Hildreth，R.，Morisot，S.，Alder，J.，Liu，C.G.，Heimfeld，S.，Calin，G.A.，Croce，C.M.&?Civin，C.I.(2007)CD34+hematopoietic?stem-progenitor?cell?microRNA?expression?and?function：acircuit?diagram?of?differentiation?control.PNAS，104，2750-2755.
11.Yin，J.Q.&?Zhao，R.C.Identifying?expression?of?new?small?RNAs?bymicroarrays.Methods.43，123-30(2007).
12.T.Gu?et?al.A?novel?class?of?endogenous?short?hairpin?RNA?in?human.(Accompanying?manuscript)2008.
13.Kasper?LH，Boussouar?F，Ney?PA，Jackson?CW，Rehg?J，van?Deursen?JM，Brindle?PK.A?transcription-factor-binding?surface?of?coactivator?p300?isrequired?for?haematopoiesis.Nature.2002?Oct?17；419(6908)：738-43.
14.Kung?AL，Rebel?VI，Bronson?RT，Ch′ng?LE，Sieff?CA，Livingston?DM，Yao?TP.Gene?dose-dependent?control?of?hematopoiesis?and?hematologictumor?suppression?by?CBP.Genes?Dev.2000Feb1；14(3)：272-7.
15.Liechty?KW，MacKenzie?TC，Shaaban?AF，Radu?A，Moseley?AM，Deans?R，Marshak?DR，Flake?AW.Human?mesenchymal?stem?cells?engraft?anddemonstrate?site-specific?differentiation?after?in?utero?transplantation?insheep.Nat?Med.2000?Nov；6(11)：1282-6.
16.Liu?X，Wang?L，Zhao?K，Thompson?PR，Hwang?Y，Marmorstein?R，ColePA.The?structural?basis?of?protein?acetylation?by?the?p300/CBPtranscriptional?coactivator.Nature.2008?Feb?14；451(7180)：846-50.
17.Messina，D.N.，J.Glasscock，W.Gish，and?M.Lovett.2004.An?ORFeome-based?analysis?of?human?transcription?factor?genes?and?the?construction?of?amicroarray?to?interrogate?their?expression.Genome?Res.14：2041-2047.
18.Miyake?S，Sellers?WR，Safran?M，Li?X，Zhao?W，Grossman?SR，Gan?J，DeCaprio?JA，Adams?PD，Kaelin?WG?Jr.Cells?degrade?a?novel?inhibitor?ofdifferentiation?with?E1A-like?properties?upon?exiting?the?cell?cycle.MolCell?Biol.2000?Dec；20(23)：8889-902.
19.Ogryzko，V.V.，Schiltz，R.L.，Russanova，V.，Howard，B.H.&?Nakatani，Y.The?transcriptional?coactivators?p300?and?CBP?are?histoneacetyltransferases.Cell?87，953-959(1996).
20.Pittenger?MF，Mackay?AM，Beck?SC，Jaiswal?RK，Douglas?R，Mosca?JD，Moorman?MA，Simonetti?DW，Craig?S，Marshak?DR.Multilineage?potentialof?adult?human?mesenchymal?stem?cells.Science.1999?Apr2；284(5411)：143-7.
21.Ramkissoon，S.H.，Mainwaring，L.A.，Ogasawara，Y.，Keyvanfar，K.，PhilipMcCoy，Jr，J.，Sloand，E.M.，Kajigaya，S.&Young，N.S.(2005)Hematopoietic-specific?microRNA?expression?in?human?cells.LeukemiaResearch，30，643-647.
22.Rebel?VI，Kung?AL，Tanner?EA，Yang?H，Bronson?RT，Livingston?DM.Distinct?roles?for?CREB-binding?protein?and?p300?in?hematopoietic?stemcell?self-renewal.Proc?Natl?Acad?Sci?U?S?A.2002?Nov12；99(23)：14789-94.
23.G.Ren，L.Zhang，X.Zhao，G.Xu，Y.Zhang，A.I.Roberts，R.C.Zhao，andY.Shi.(2008)Mesenchymal?Stem?Cell-Mediated?ImmunosuppressionOccurs?via?Concerted?Action?of?Chemokines?and?Nitric?Oxide.CellS?temCell?2(2)：141-150
24.Reyes，M.T.Lund，T.Lenvik，D.Aguiar，L.Koodie，and?C.M.Verfaillie.Purification?and?ex?vivo?expansion?of?postnatal?human?marrow?mesodermalprogenitor?cells.Blood?98，2615-2625(2001).
25.Sandberg?ML，Sutton?SE，Pletcher?MT，Wiltshire?T，Tarantino?LM，Hogenesch?JB，Cooke?MP.c-Myb?and?p300?regulate?hematopoietic?stemcell?proliferation?and?differentiation.Dev?Cell.2005?Feb；8(2)：153-66.
26.Serafini?M，Dylla?SJ，Oki?M，Heremans?Y，Tolar?J，Jiang?Y，Buckley?SM，Pelacho?B，Burns?TC，Frommer?S，Rossi?DJ，Bryder?D，Panoskaltsis-Mortari?A，O′Shaughnessy?MJ，Nelson-Holte?M，Fine?GC，Weissman?IL，Blazar?BR，Verfaillie?CM.Hematopoietic?reconstitution?bymultipotent?adult?progenitor?cells：precursors?to?long-term?hematopoieticstem?cells.J?Exp?Med.2007?Jan?22；204(1)：129-39.
27.Sorrentino?BP.Clinical?strategiesfor?expansion?of?haematopoietic?stemcells.Nat?Rev?Immunol.2004?Nov；4(11)：878-88.
28.XuW，Fukuyama?T，Ney?PA，Wang?D，Rehg?J，Boyd?K，van?Deursen?JM，Brindle?PK.Global?transcriptional?coactivators?CREB-binding?protein?andp300?are?highly?essential?collectively?but?not?individually?in?peripheral?Bcells.Blood.2006?107(11)：4407-16.
SEQUENCE?LISTING
＜110〉Institute of Biophysics, Academia Sinica
＜120〉class can be divided into mescenchymal stem cell the small RNA molecular and the action target spot thereof of hematopoietic cell
<130>IB083046
<160>23
<170>PatentIn?version3.1
<210>1
<211>75
<212>RNA
＜213〉artificial
<400>1
<210>2
<211>21
<212>DNA
＜213〉artificial
<400>2
<210>3
<211>21
<212>DNA
＜213〉artificial
<400>3
<210>4
<211>21
<212>DNA
＜213〉artificial
<400>4
<210>5
<211>21
<212>DNA
＜213〉artificial
<400>5
<210>6
<211>21
<212>DNA
＜213〉artificial
<400>6
<210>7
<211>21
<212>DNA
＜213〉artificial
<400>7
<210>8
<211>21
<212>DNA
＜213〉artificial
<400>8
<210>9
<211>21
<212>DNA
＜213〉artificial
<400>9
<210>10
<211>21
<212>DNA
＜213〉artificial
<400>10
<210>11
<211>21
<212>DNA
＜213〉artificial
<400>11
<210>12
<211>21
<212>DNA
＜213〉artificial
<400>12
<210>13
<211>21
<212>DNA
＜213〉artificial
<400>13
<210>14
<211>21
<212>DNA
＜213〉artificial
<400>14
<210>15
<211>21
<212>DNA
＜213〉artificial
<400>15
<210>16
<211>21
<212>DNA
＜213〉artificial
<400>16
<210>17
<211>21
<212>DNA
＜213〉artificial
<400>17
<210>18
<211>21
<212>DNA
＜213〉artificial
<400>18
<210>19
<211>21
<212>DNA
＜213〉artificial
<400>19
<210>20
<211>21
<212>DNA
＜213〉artificial
<400>20
<210>21
<211>21
<212>DNA
＜213〉artificial
<400>21
<210>22
<211>21
<212>DNA
＜213〉artificial
<400>22
<210>23
<211>21
<212>DNA
＜213〉artificial
<400>23
Claims (10)
1. one kind is converted into the little RNA or derivatives thereof of hemopoietic stem cell with mescenchymal stem cell, and it comprises the hair clip nucleic acid or derivatives thereof of the core nucleotide sequence with SQE.ID.No.1.
2. the described little RNA or derivatives thereof of claim 1, it also comprises single-chain nucleic acid 5 '-GAUCCCGUGUAACACAAUGGUGAGUAUUUG-3 ' that is derived out by described hair clip nucleic acid etc., or double-strandednucleic acid 5 '-GUAACACAAUGGUGAGUAUUUG-3 ' || || || || || || || || || || || 3 '-CAUUGUGUUACCACUCAUAAAC-5 ' etc.
3. the described little RNA or derivatives thereof of claim 1, it also comprises the siRNA siR-EID1 of reticent EID1, it comprises the siRNAs of SEQ.ID.No.2-23 correspondence, and their derivative.
4. each described little RNA or derivatives thereof of claim 1 to 3, its action target spot is the EID1 gene.
5. each described little RNA or derivatives thereof of claim 1 to 3, any one Nucleotide in the described nucleotide sequence is that nature is literalness, or modify through the different chemical method, comprise peptide Nucleotide (PNA), locking Nucleotide (LNA) or methoxy-or Nucleotide of modifying of ethoxy.
6. each described little RNA or derivatives thereof of claim 1 to 3, it also comprises the little rna expression system that the pairing dna sequence dna of described little RNA sequence is constituted by the various viruses that can express described little RNA and plasmid cloning vector.
7. method that mescenchymal stem cell is converted into hemopoietic stem cell, it comprises each described little RNA or derivatives thereof transfection of claim 1 to 6 in mescenchymal stem cell, by the expression of restraining effect target spot EID1 mescenchymal stem cell is converted into hemopoietic stem cell.
8. the purposes of each described little RNA or derivatives thereof of claim 1 to 6, it is converted into hemopoietic stem cell by the expression of restraining effect target spot EID1 with mescenchymal stem cell.
9. the described purposes of claim 8, it is used to prepare the medicine that mescenchymal stem cell is converted into hemopoietic stem cell.
10. one kind is converted into the test kit of hemopoietic stem cell with mescenchymal stem cell, and it comprises each described little RNA or derivatives thereof of claim 1 to 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008102241153A CN101368180A (en) | 2008-10-15 | 2008-10-15 | Small RNA numerator for differentiation of mesenchyma stem cell into hematopoiesis cell and function target point thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008102241153A CN101368180A (en) | 2008-10-15 | 2008-10-15 | Small RNA numerator for differentiation of mesenchyma stem cell into hematopoiesis cell and function target point thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101368180A true CN101368180A (en) | 2009-02-18 |
Family
ID=40412181
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008102241153A Pending CN101368180A (en) | 2008-10-15 | 2008-10-15 | Small RNA numerator for differentiation of mesenchyma stem cell into hematopoiesis cell and function target point thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101368180A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088065A (en) * | 2013-01-25 | 2013-05-08 | 黄兵 | Method capable of forming hematopoietic stem cells by quickly inducing reversal decision of mesenchymal stem cells in large scale with high purity |
| CN106190970A (en) * | 2015-04-30 | 2016-12-07 | 黄兵 | The direct transdifferentiation of inducing umbilical cord mesenchymal stem is the method for annatto pigment |
| CN106754927A (en) * | 2016-12-26 | 2017-05-31 | 中国人民解放军军事医学科学院野战输血研究所 | Purposes of the nucleic acid in cell macronucleus differentiation efficiency is improved |
| CN114752688A (en) * | 2022-04-28 | 2022-07-15 | 北京大学口腔医学院 | Method, probe and kit for identifying human embryonic bone marrow-derived mesenchymal stem cells and application thereof |
-
2008
- 2008-10-15 CN CNA2008102241153A patent/CN101368180A/en active Pending
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088065A (en) * | 2013-01-25 | 2013-05-08 | 黄兵 | Method capable of forming hematopoietic stem cells by quickly inducing reversal decision of mesenchymal stem cells in large scale with high purity |
| WO2014114023A1 (en) * | 2013-01-25 | 2014-07-31 | 北京银杏德济生物技术有限公司 | Method capable of massively and rapidly inducing mesenchymal stem cells to transdetermine into hematopoietic stem cells of high purity |
| CN103088065B (en) * | 2013-01-25 | 2014-12-10 | 北京银杏德济生物技术有限公司 | Method capable of forming hematopoietic stem cells by quickly inducing reversal decision of mesenchymal stem cells in large scale with high purity |
| JP2015509712A (en) * | 2013-01-25 | 2015-04-02 | ペキン ギンクゴ バイオサイエンス カンパニー リミテッドＢｅｉｊｉｎｇ Ｇｉｎｋｇｏ Ｂｉｏｓｃｉｅｎｃｅ Ｃｏ．，Ｌｔｄ． | A method for rapidly inducing mesenchymal stem cells to convert to hematopoietic stem cells on a large scale with high purity |
| US20150315545A1 (en) * | 2013-01-25 | 2015-11-05 | Beijing Ginkgo Bioscience Co., Ltd. | Method of rapidly inducing large-scale and high-purity mesenchymal stem cells to transdetermine into hematopoietic stem cells |
| US9481867B2 (en) * | 2013-01-25 | 2016-11-01 | Beijing Ginko Bioscience Co., Ltd. | Method of rapidly inducing large-scale and high-purity mesenchymal stem cells to transdetermine into hematopoietic stem cells |
| CN106190970A (en) * | 2015-04-30 | 2016-12-07 | 黄兵 | The direct transdifferentiation of inducing umbilical cord mesenchymal stem is the method for annatto pigment |
| CN106190970B (en) * | 2015-04-30 | 2021-02-19 | 黄兵 | Method for inducing direct transdifferentiation of umbilical cord mesenchymal stem cells into erythroblasts |
| CN106754927A (en) * | 2016-12-26 | 2017-05-31 | 中国人民解放军军事医学科学院野战输血研究所 | Purposes of the nucleic acid in cell macronucleus differentiation efficiency is improved |
| CN114752688A (en) * | 2022-04-28 | 2022-07-15 | 北京大学口腔医学院 | Method, probe and kit for identifying human embryonic bone marrow-derived mesenchymal stem cells and application thereof |
| CN114752688B (en) * | 2022-04-28 | 2024-02-23 | 北京大学口腔医学院 | Method, probe and kit for identifying mesenchymal stem cells derived from human embryo bone marrow and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sugimura et al. | Haematopoietic stem and progenitor cells from human pluripotent stem cells | |
| Kong et al. | MIR-23A microRNA cluster inhibits B-cell development | |
| Wei et al. | FOXF1 mediates mesenchymal stem cell fusion-induced reprogramming of lung cancer cells | |
| JP2017513477A5 (en) | ||
| Gargiulo et al. | In vivo shRNA screens in solid tumors | |
| Basak et al. | miR‐15a‐5p regulates expression of multiple proteins in the megakaryocyte GPVI signaling pathway | |
| US9481867B2 (en) | Method of rapidly inducing large-scale and high-purity mesenchymal stem cells to transdetermine into hematopoietic stem cells | |
| JP6893633B2 (en) | Extraction method of differentiated cells | |
| CN102884188A (en) | Method for producing induced pluripotent stem cells | |
| Tubsuwan et al. | Parallel assessment of globin lentiviral transfer in induced pluripotent stem cells and adult hematopoietic stem cells derived from the same transplanted β-thalassemia patient | |
| Zhong et al. | Tumorigenicity risk of iPSCs in vivo: nip it in the bud | |
| CN101368180A (en) | Small RNA numerator for differentiation of mesenchyma stem cell into hematopoiesis cell and function target point thereof | |
| CN105343894A (en) | Recombinant mesenchymal stem cell efficient in secreting prostaglandin E2 (PGE2) and its application | |
| US9163234B2 (en) | Culture method | |
| CN105316286A (en) | Method for preparing recombination mesenchymal stem cell and recombination mesenchymal stem cell prepared through method | |
| Kim et al. | Generation of CD34+ cells from human embryonic stem cells using a clinically applicable methodology and engraftment in the fetal sheep model | |
| AU2008361210A1 (en) | An endogenous short hairpin RNA and the use of the same | |
| JP2021048875A (en) | Method for producing pancreatic endocrine cells, and transdifferentiation agent | |
| CN111109200A (en) | Mouse model for resisting MLL leukemia by changing epigenetic modification level and construction method and application thereof | |
| CN104774872B (en) | Change the method and its application of cell fate | |
| Dias et al. | Functional genetic dropout screens and in vivo validation of candidate therapeutic targets using mouse mammary tumoroids | |
| CN106190970B (en) | Method for inducing direct transdifferentiation of umbilical cord mesenchymal stem cells into erythroblasts | |
| CN110904038B (en) | Mesenchymal stem cells and application thereof | |
| CN106754927B (en) | Nucleic acid is improving the purposes in cell macronucleus differentiation efficiency | |
| CN107998374A (en) | The medical usage of NOTCH4 or its inhibitor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20090218 |