CN106834345A - A kind of method that polygenes superposition cotransformation improves rape synthesis resistance - Google Patents
A kind of method that polygenes superposition cotransformation improves rape synthesis resistance Download PDFInfo
- Publication number
- CN106834345A CN106834345A CN201611225064.7A CN201611225064A CN106834345A CN 106834345 A CN106834345 A CN 106834345A CN 201611225064 A CN201611225064 A CN 201611225064A CN 106834345 A CN106834345 A CN 106834345A
- Authority
- CN
- China
- Prior art keywords
- plant
- rape
- kinds
- conversion
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to plant genetic engineering studying technological domain, and in particular to a kind of method that polygenes superposition cotransformation improves rape synthesis resistance.The method includes：The identification of the structure, carrier of plant expression vectors containing multiple genes, carrier convert Agrobacterium, prepare the steps such as conversion fluid, flower-dipping method conversion rape, screening, identification, selfing acquisition homozygote；In the plant expression vectors containing multiple genes, comprising the 5 kinds of degeneration-resistant functional genes and 3 kinds of selectable marker genes that are sequentially connected in series, specifically put in order for：LB‑HYG –GUS‑BAR‑ ICE1‑ LOS5 ‑CBF3‑ABAR‑NCED3‑RB.The present invention is combined by optimizing resistant gene, and multiple degeneration-resistant key nodes are gene constructed in same expression vector.After the carrier is converted into plant, once conversion can enable plant while adapting to various adverse environmental factors, improve the comprehensive anti-adversity ability of plant, show preferable production application value.
Description
Technical field
The invention belongs to plant genetic engineering studying technological domain, and in particular to a kind of polygenes superposition cotransformation improves oil
The method of dish synthesis resistance.
Background technology
Rape belongs to Cruciferae (Cruciferae) Brassica genus (Brassica), be in the world most important oil crops it
One, every field of its application throughout production and living.The subject matter that current rape breeder faces is that cultivation rape is high
Anti- new varieties come adapt to because abiotic and biotic is increasingly frequent caused by Global climate change the problems such as.Using genetic engineering
Improvement rape variety overcomes the range-restricted problem of traditional breeding method pattern gene exchange to a certain extent, is rapeseed breeding
Work can provide one of effective way for utilizing.
The abiotic stress such as arid, salinization of soil, extreme climate have a strong impact on the performance of crop yield potentiality.Caused by arid
Loss be almost other natural calamities caused by loss summation.Therefore, how to be increased by improving the anti-adversity ability of crop
Plus crop yield, it has also become the great demand of agriculture sustainable high-efficient development.The main task of crop breeding for stress tolerance is exactly to be polymerized
It is present in the beneficial gene in different germ plasm resources, is that excellent kind is cultivated in agricultural production.Because plant stress tolerance is many bases
Because of the complicated quantitative character for controlling, there is crosstalk again between different degeneration-resistant signal paths, turn accordingly, with respect to single-gene
Change, the key node gene in degeneration-resistant signal path is improved the resistance tool of plant by the way of polygenes superposition cotransformation
Have the advantages that many irreplaceable.But in the prior art there is not yet the preferable application report of this aspect.
The content of the invention
Method present invention aim at a kind of polygenes superposition cotransformation to improve rape synthesis resistance, the method is led to
Excessive gene stacking cotransformation, will contain five kinds of adversity gene expression vectors while being transferred to rape, so as to improve rape to various sides of body
Urgent integrated resilience.
Details are as follows for the technical solution used in the present invention.
A kind of method that polygenes superposition cotransformation improves rape synthesis resistance, comprises the following steps：
（1）The structure of plant expression vectors containing multiple genes
By Gateway technologies, with reference to Cre/Loxp recombination systems and bacteriophage lambda site-specific recombination system, with many wheel weights
The mode of group superposition constructs pABA-oriT carriers, and the clone gene expression cassette in the T-DNA areas of the carrier is contained and is sequentially connected in series
5 kinds of degeneration-resistant functional genes and 3 kinds of selectable marker genes；
5 kinds of degeneration-resistant functional genes include：2 ABA synthesis related genes NCED3, LOS5,1 ABA signal pathway dependency basis
Because of ABAR, 2 freeze proof regulatory gene ICE1, CBF3；
3 kinds of selectable marker genes include hygromycin gene HYG, GUS and glufosinate resistance gene BAR；
5 kinds of degeneration-resistant functional genes and 3 kinds of selectable marker genes pABA-oriT carrier T-DNA areas specifically put in order for：
LB-HYG–GUS-BAR-ICE1-LOS5-CBF3-ABAR-NCED3-RB；
It should be explained that：
5 kinds of degeneration-resistant functional genes are driven expression by 2 class promoters, specifically：
ICE1 and LOS5 genes are driven by pSuper composing types overexpression promoter, and the element of the promoter is：In sweet dew
The upstream of alkali synthase promoter sequentially adds mannopine synthetase transcription activating domain and three octopine synthase transcriptional activations
Domain（Lee at.al., 2007, Novel plant transformation vectors containing the
superpromotor. Plant physiology 145: 1294-1300）；
Tri- genes of CBF3, ABAR and NCED3 are driven by stress induced overexpression promoter pRD29A；
3 kinds of selectable marker genes drive by 35S promoter and express, and are planted as later stage transgenosis using this 3 kinds of selectable marker genes
The selection markers of thing；
（2）To step（1）In constructed recombinant expression carrier identification
First, using PCR authentication methods to step（1）In constructed recombinant expression carrier identified, to ensure 5 kinds of functions
Gene is coexisted in same expression vector, and when PCR is identified, the primer sequence of design is as follows：
NCED –F：5'AACTTAGTGAGACCCTCCTCTGTT 3',
NCED-R：5' TAGTGTTGGATTCTTTGGCTTTGG 3'；
ABAR-F：5'AACTTAGTGAGACCCTCCTCTGTT 3',
ABAR-R：5’ ACTTTAATCGCCAATTCCTCGACG 3’；
CBF–F：5'AACTTAGTGAGACCCTCCTCTGTT 3',
CBF-R： 5’ TTGAAATGTTCCGAGCCAAATCCT 3’；
LOS5-F：5 ' ATAGATACGCTGACACGCCAAGCC 3 ',
LOS5-R：5’ CTATAAGGTCACTGGTGGCCGAAC 3’；
ICE1-F：5 ' ATAGATACGCTGACACGCCAAGCC 3 ',
ICE1-R：5’ CTCTTCCCTTTCTCCACCACCACC 3’；
Secondly, correct recombinant expression carrier further carries out sequence verification to be identified to PCR, to ensure 5 kinds of tables of functional gene
It is completely correct up to frame；
（3）To step（2）The middle correct recombinant expression carrier conversion Agrobacterium of identification, prepares conversion fluid
By step（2）The middle correct electroporated Agrobacterium competent cell of recombinant expression carrier plasmid of identification, specific steps ginseng
Examine as follows：
Draw 1 ~ 2 μ L plasmids to be added in 100 μ L Agrobacterium competent cells, then the electroporated 5ms of 2.5KV are rapidly added
1mL SOC culture mediums, 28 DEG C, 1 ~ 2 h of 200rpm vibration recovery cultures；
Take 200 μ L bacterium solutions coat the YEB containing 50 mg/L kanamycins, 50 mg/L gentamicins, 10 mg/L tetracyclines consolidate
On body culture medium flat plate, 28 DEG C are inverted 1 ~ 2d of culture；Then select positive colony and enter performing PCR identification；
First, 2 ~ 3 PCR of picking identify correct positive monoclonal bacterial plaque mixing（In case single clone's miniplasmids loses influence
Transformation efficiency）It is inoculated in YEP fluid nutrient mediums（Containing 50 mg/L kanamycins, 50 mg/L gentamicins, 10 mg/L tetracyclines）
In, 28 DEG C, 220 rpm constant-temperature shaking cultures to OD600 =0.6 or so；
Then, the YEP fluid nutrient mediums that 1 mL bacterium solutions are seeded to 500 mL are taken（It is big containing 25 mg/L kanamycins, 25 mg/L celebratings
Mycin, 5 mg/L tetracyclines）In, 28 DEG C, 220 rpm constant-temperature shaking cultures to OD600=1.0 ~ 1.5 or so；
Finally, 4000 rpm room temperatures are centrifuged 15 min, abandon supernatant, and the strain that will be enriched with is resuspended with conversion Buffer, is diluted to
OD600=0.8 ~ 1.0 or so, as conversion fluid is standby；
The conversion Buffer, is the volume fraction Silwet-L77+0.01 of+5% mass fraction sucrose of 1/2 MS nutrient solutions+0.05%
The acetosyringone of the 6-BA+8 mg/L of mg/L（acetosyringone）；
It should be noted that conversion Buffer and conversion fluid need matching while using；
（4）Using agriculture bacillus mediated flower-dipping method（Flower-dip）Conversion rape
First, rape is pre-processed, by rape seed after planting, rape first the flowers are in blossom put after 2 ~ 3 days in, in turning
The previous day of change, the healthy and strong plant of growth selection removes unnecessary branch（Remove unnecessary side inflorescence）, every plant only retains main inflorescence
And 2 ~ 3 preferable side inflorescences of branch growth state, excision bloomed piece and small bud of the inflorescence top end diameter less than 5 mm, will protect
Stay inflorescence bagging use to be transformed；
Secondly, during conversion, whole inflorescence is immersed in conversion fluid and is soaked 90 ~ 120 seconds, period gently rocks conversion fluid, to prevent
Agrobacterium is precipitated, so as to influence changing effect；
Bagging and listing mark after conversion；
Under preferable case, same operation mode and method are converted 1 time every other day, continuous conversion 3 times；
Finally, after last time is converted, continue bagging and remove bag after 5 days, cut unnecessary open flower and do not open
Bud, makes conversion pod normal growth, until after maturation, seed is harvested by individual plant；
It should be noted that the rape is, for example, specifically cabbage type rape, it is to avoid ultraviolet on daytime during outdoor conversion operation
Too strong that Agrobacterium vigor is impacted, preferably at candlelight point carries out for conversion operation；
（5）The screening and identification of transformant
By step（4）Middle harvested rape seed sowing, after sowing 7 ~ 10 days, when Brassica Napus Seedling lobus cardiacus just grows, sprays 50
Mg/L herbicide bastas（Main component is glufosinate-ammonium）, the next day once, totally three times；
Brassica Napus Seedling to showing resistance to Basta carries out hygromycin resistance screening, specially：In four leaf stage, in rape
The 3rd tablet of mg/L hygromycin of true leaf surface smear 50 that seedling is unfolded completely, carries out hygromycin resistance screening；
Brassica Napus Seedling to showing resistance to Basta and hygromycin, takes its blade, extracts genomic DNA and enters performing PCR identification
And sequencing identification, the primer sequence synchronization is rapid when PCR is identified（2）Middle primer sequence；
（6）Transformant selfing obtains homozygote
To step（5）Middle screening, the correct transformant of identification continue to cultivate, and the bagging when florescence makes its selfing, harvests individual plant kind
Son；
Seed to harvesting continues to plant, same to step（5）Operation, proceed Basta resistances, hygromycin resistance, PCR identification and
Sequencing identification, and to identifying that correct transformant continues selfing；
Conversion homozygote is obtained after being identified through the continuous selfing of 4 generations, i.e., with the transgene rape of comprehensive adverse-resistant characteristic.
（7）Obtaining transgene rape to screening carries out adverse-resistant characteristic analysis
To step（6）Obtained in transgene rape seed, after planting, further its phenotype, economical character can be carried out
Analysis, in addition can be to its temperture of leaves, stomatal aperture, percentage of water loss, abscisic acid in upgrowth situation under the conditions of Different stress（ABA）Contain
Amount, MDA（MDA）The physiological indexes situation such as content is measured, so that the anti-adversity ability of synthetic determination transgene rape
With production application potentiality.
A kind of to cultivate the method with comprehensive resistance new rape variety, the method is superimposed co-transformation method reality by polygenes
It is existing.
Compared to the prior art, the beneficial effect of the inventive method：
Many proterties of plant such as yield, resistance etc. improve these by many bases by controlled by multiple genes with genetic engineering method
Because of the proterties for controlling, it is necessary to carry out polygenic stack combinations.Traditional polygenes method for transformation mainly has：1）By multiple genes
Different plants are converted respectively, and polygenes transformant is then successfully obtained by hybridization；2）Multiple genes are implemented in different tables respectively
Up to carrier, polygenes transformed plant is obtained by converting again.These methods waste time and energy, the cycle is more long, limit them and are answering
With the advantage in field.
The present invention is combined by optimizing resistant gene, and multiple degeneration-resistant key nodes are gene constructed in same expression vector
In.After the carrier is converted into plant such as rape, once conversion can enable plant while obtaining various resistance,
I.e.：Plant can be made efficiently quickly to start the degeneration-resistant reaction of body under the conditions of various environment stresses, reduce environment stress to body
Damage；Being additionally, since multiple resistance gene has certain synergy, can the efficient controlled by multiple genes of Crop Improvement quantity
Proterties, improves the comprehensive anti-adversity ability of plant, make its show significantly to grow in nutrient growth and generative growth phase it is excellent
Gesture, with preferable production application value.
Brief description of the drawings
Fig. 1 is rape genetic transformation flow, wherein a. initial bloom stages conversion；B. bagging after converting；C. transformant is solid；
Fig. 2 is transformant Basta and hygromycin resistance is screened；
Fig. 3 is that high temperature stress processes growth phenotype, wherein a, b. seedling stage；C. florescence；D. productive phase；
Fig. 4 is that drought stress processes growth phenotype；
Fig. 5 is cold Stress treatment growth phenotype；
Fig. 6 is the expression analysis that the drought stresses of 15% PEG 6000 process lower 5 kinds of functional genes, wherein * *：Two sample means
Number t inspection P Zhi≤0.01；*：Two average of samples t inspection P Zhi≤0.05；Error amount：Average+s.e；
Fig. 7 is the expression analysis that 150 mM NaCl salt stresses process lower 5 kinds of functional genes, wherein * *：Two average of samples t
Inspection P Zhi≤0.01；*：Two average of samples t inspection P Zhi≤0.05；Error amount：Average+s.e；
Fig. 8 is that seedling root is long and plant height compares, wherein the lower seedling root difference long of (A) Different stress treatment；(B) Different stress
The lower Seedling Height difference for the treatment of；Mock：Blank；NaCl：100 mM NaCl；Mannitol：200mM mannitol；ABA：5 μM
ABA；**：Two average of samples t inspection P value≤0.01；*：Two average of samples t inspection P value≤0.05；Error amount：
Average+s.d；
Fig. 9 compares for polygenes transformant K15 with the blade face temperature of nontransgenic plants WT, wherein (A) second true leaf leaf
Face temperature；(B) the 3rd true leaf blade face temperature a. soil moisture content 35%；B. soil moisture content 5%；
Figure 10 is stomatal aperture and percentage of water loss, wherein (A) stomatal aperture is observed；(B) stomatal aperture measurement；(C) blade loses
Water rate；**：Two average of samples t inspection P value≤0.01；*：Two average of samples t inspection P value≤0.05；Error amount：
Average+s.d；
Figure 11 is ABA assays and MDA assays, wherein ABA contents in (A) seedling；(B) ABA contents in blade
35%、0%：Soil moisture content；(C) MDA concentration in leaves Mock：Blank；**：Two average of samples t check P values
≤0.01；*：Two average of samples t inspection P value≤0.05；Error amount：Average+s.d.
Specific embodiment
Explanation is further explained to the technical scheme of the application with reference to embodiment, specific embodiment is being introduced
Before, with regard to being briefly discussed below situations such as involved partial material, experimental facilities, experimental site in following embodiments.
Biomaterial：
It is to be understood that 5 kinds of degeneration-resistant functional genes and 3 kinds of selectable marker gene pcr amplification primer things employed in the application
Combination, is designed by inventor, and offer, the structure of pABA-oriT carriers, according to existing are synthesized by Shanghai Sheng Gong bio-engineering corporations
Technical operation, by Gateway technologies, builds with reference to Cre/Loxp recombination systems and bacteriophage lambda site-specific recombination system
Form, because associative operation belongs in existing gene recombination technology more routine operation, so no longer describing in detail；
Transgenic acceptor employed in following embodiments is cabbage type rape Y42, belongs to a kind of Hybrid Oil of open type
Dish cytoplasmic male sterility restorer, but realization of the invention is not rely on the specific rape variety, also can be using other oil
Vegetable kind（Strain）Carry out associative operation；
Relevant primer synthesis, examining order are completed by Shanghai Sheng Gong bio-engineering corporations in following embodiments；
Major experimental equipment：
Far infrared thermal imaging system SC-3000, U.S.'s cogenerated products；
Dehydration measuring system (QUIN TIX-224-1CN), German Sai Duolisi products；
Experimental site：
The interior of rape material is planted in the related phjytotron of He'nan University and carries out, outdoor cultivation in He'nan University in the school
Carried out in experimental plot；Daily management refers to existing breeding experiment field condition routine operation；
Phjytotron material is planted in 7cm × 7cm × 8cm（Length × width × height）Nutritive cube in, host material is arabidopsis
Nutrition Soil；
Water planting material is planted in 1/2 Hoagland.
Embodiment 1
The method that polygenes superposition cotransformation provided by the present invention improves rape synthesis resistance, it contains polygenes to build
Based on plant recombination expression vector, thus the present embodiment is only with regard to the building process and its qualification process of the recombinant expression carrier
It is briefly discussed below.
It should be noted that recombinant vector pABA-oriT carriers used in following embodiments, by Gateway technologies, knot
Cre/Loxp recombination systems and bacteriophage lambda site-specific recombination system are closed, built-up, the phase in the way of many wheel restructuring superpositions
Close technical operation and specifically for example refer to patent《A kind of method for building the recombinant expression carrier for expressing multiple genes simultaneously》（Specially
Sharp application number：2010102949516）Middle associative operation, the application is not repeated.
It is emphasized that the recombinant vector pABA-oriT carriers employed in the application, in the T-DNA of the carrier
Clone gene expression cassette comprising gene order be by particular design and combination, 5 kinds for being sequentially connected in series are contained altogether degeneration-resistant
Functional gene and 3 kinds of selectable marker genes；
5 kinds of degeneration-resistant functional genes include：2 ABA synthesis related genes NCED3, LOS5,1 ABA signal pathway dependency basis
Because of ABAR, 2 freeze proof regulatory gene ICE1, CBF3；
3 kinds of selectable marker genes include hygromycin gene HYG, GUS and glufosinate resistance gene BAR；
5 kinds of degeneration-resistant functional genes and 3 kinds of selectable marker genes pABA-oriT carrier T-DNA areas specifically put in order for：
LB-HYG–GUS-BAR-ICE1-LOS5-CBF3-ABAR-NCED3-RB。
It should be explained that：
5 kinds of degeneration-resistant functional genes are driven expression by 2 class promoters, specifically：
ICE1 and LOS5 genes are driven by pSuper composing types overexpression promoter, and the element of the promoter is：In sweet dew
The upstream of alkali synthase promoter sequentially adds mannopine synthetase transcription activating domain and three octopine synthase transcriptional activations
Domain；
Tri- genes of CBF3, ABAR and NCED3 are driven by stress induced overexpression promoter pRD29A；
3 kinds of selectable marker genes drive by 35S promoter and express, and are planted as later stage transgenosis using this 3 kinds of selectable marker genes
The selection markers of thing.
Constructed pABA-oriT recombinant expression carriers are identified using PCR authentication methods, with ensure 5 kinds it is degeneration-resistant
Functional gene is coexisted in same expression vector, and when PCR is identified, primer sequence design is as follows：
NCED–F：5'- AACTTAGTGAGACCCTCCTCTGTT- 3',
NCED-R：5' –TAGTGTTGGATTCTTTGGCTTTGG-3'；
ABAR-F：5'- AACTTAGTGAGACCCTCCTCTGTT- 3',
ABAR-R：5'-ACTTTAATCGCCAATTCCTCGACG -3’；
CBF–F：5'- AACTTAGTGAGACCCTCCTCTGTT-3',
CBF-R： 5'–TTGAAATGTTCCGAGCCAAATCCT-3'；
LOS5-F：5'- ATAGATACGCTGACACGCCAAGCC-3',
LOS5-R：5'–CTATAAGGTCACTGGTGGCCGAAC-3'；
ICE1-F：5'- ATAGATACGCTGACACGCCAAGCC-3',
ICE1-R：5' –CTCTTCCCTTTCTCCACCACCACC-3'；
Further, correct recombinant expression carrier further carries out sequence verification to be identified to PCR, to ensure 5 kinds of functional genes
Expression cassette it is completely correct.
Embodiment 2
Using the pABA-oriT recombinant vectors prepared by embodiment 1, inventor is further prepared for conversion fluid, and utilizes agriculture bar
The flower-dipping method of bacterium mediation（flower-dip）Transgeneic procedure is carried out to rape, related experiment process is briefly discussed below.
Prepare conversion fluid
The electroporated Agrobacterium competent cells of correct recombinant vector pABA-oriT will be identified, detailed process is：
Draw 1 μ L plasmids to be added in 100 μ L Agrobacterium competent cells, electroporated 5 ms of 2.5 KV, it is then rapid to add
Enter 1mL SOC culture mediums, 28 DEG C, 200 rpm vibration recovery cultures, 1.5 h；
Take 200 μ L bacterium solutions coat the YEB containing 50 mg/L kanamycins, 50 mg/L gentamicins, 10 mg/L tetracyclines consolidate
On body culture medium flat plate, 28 DEG C are inverted 2 d of culture；Then select positive colony and enter performing PCR identification；
First, 2 PCR of picking identify the combined inoculation of correct positive monoclonal bacterial plaque in YEP fluid nutrient mediums（Containing 50 mg/L
Kanamycins, 50 mg/L gentamicins, 10 mg/L tetracyclines）In, 28 DEG C, 220 rpm constant-temperature shaking cultures to OD600 =
0.6 or so；
Then, the YEP fluid nutrient mediums that 1 mL bacterium solutions are seeded to 500 mL are taken（It is big containing 25 mg/L kanamycins, 25 mg/L celebratings
Mycin, 5 mg/L tetracyclines）In, 28 DEG C, 220 rpm constant-temperature shaking cultures to OD600=1.0 or so；
Finally, 4000 rpm room temperatures are centrifuged 15 min, abandon supernatant, and the strain that will be enriched with is resuspended with conversion Buffer, is diluted to
OD600=1.0 or so, as conversion fluid is standby；
The conversion Buffer, is the mass fraction Silwet-77+0.01 of+5% mass fraction sucrose of 1/2 MS nutrient solutions+0.05%
The acetosyringone of the 6-BA+8 mg/L of mg/L（acetosyringone）；
It should be noted that conversion Buffer and conversion fluid need matching while using.
Conversion rape
The present embodiment is mainly using agriculture bacillus mediated flower-dipping method（Flower-dip）To contain ABAR, NCED3, LOS5, CBF3,
The eukaryotic expression binary vector of five kinds of degeneration-resistant functional genes of ICE1（Recombinant vector pABA-oriT）Conversion rape；Transformation receptor material
Expect to be cabbage type rape Y42, convert is carried out in rape initial bloom stage, part Experiment is operated as shown in figure 1, detailed process is briefly introduced
It is as follows.
First, rape is pre-processed, by rape seed after planting, rape first the flowers are in blossom put after 2 ~ 3 days in,
In the previous day of conversion, the healthy and strong plant of growth selection removes unnecessary branch（Remove unnecessary side inflorescence）, every plant only retains master
The healthy and strong side inflorescence of inflorescence and 2 ~ 3 branch growths, excision has been bloomed piece and small bud of the inflorescence top end diameter less than 5 mm, will be protected
Stay inflorescence bagging use to be transformed.
Secondly, afternoon 17 is selected:00 or so carries out conversion operation, during conversion, whole inflorescence is immersed in conversion fluid and is soaked
90 ~ 120 seconds or so, period gently rocked conversion fluid, to prevent Agrobacterium from precipitating, so as to influence changing effect；
Bagging moisturizing and listing mark after conversion；
Same operation, converts 1 time every other day, continuous conversion 3 times；
After last time is converted, continue bagging and remove bag after 5 days, cut unnecessary open flower and non-open bud, make
Conversion pod normal growth, until after maturation, seed is harvested by individual plant.
Finally, T0 is harvested on 5 plants of transformation receptor rapes for about 4100, seed, average setting percentage is 820/plant.
Embodiment 3
The transgene rape seed obtained to embodiment 2, further enter due to there is a part of false positive seed, thus still needing
Row resistance screening and identification, while for ease of production and application, also needing further to prepare homozygote, the just related sieve of the present embodiment
Choosing, identification and homozygotic acquisition process are briefly discussed below.
The screening and identification of transformant
The T0 harvested in embodiment 2 is seeded in greenhouse for seed, after sowing 7 ~ 10 days, is just grown in Brassica Napus Seedling lobus cardiacus
When（I.e. rough leaf outlet when）, the mg/L herbicide bastas of foliage-spray 50（Main component is glufosinate-ammonium）, the next day one
It is secondary, spray altogether three times.After one week, non-transformed body plant pair Basta is sensitive and leaf margin jaundice, leaf-shrinkage, new life true leaf chlorosis,
Plant gradually dries up dead；And transformant shows to grow Basta resistances normal (as shown in Figure 2).
Brassica Napus Seedling to showing resistance to Basta continues to cultivate it to four leaf stage, the 3rd unfolded completely in seedling
The mg/L hygromycin of piece true leaf surface smear 50, observes the hygromycin resistance of seedling after 5 days, nontransgenic plants blade smears tide
Mycin region is gathered brown spot, and gradually chlorosis dries up；And rotaring gene plant blade growth is normal (as shown in Figure 2).
Resistance is shown to Basta and hygromycin（Double-resistant）Brassica Napus Seedling, take its blade, extract genome
DNA, carries out two-wheeled PCR identifications with Basta resistant genes primer and hygromycin gene primer respectively；
When PCR is identified, Basta resistant gene design of primers is：
BAR-F：5'-CGGTCTGCACCATCGTCAACCACT-3',
BAR-R：5' –ACGCTCTTGAAGCCCTGTGCCTC- 3'；
Hygromycin gene design of primers is：
HYG-F：5'- TGCTGCTCCATACAAGCCAA- 3',
HYG-R：5'-ACCGCAAGGAATCGGTCAAT-3'；
PCR response procedures are designed as：95℃、5min；95 DEG C, 40s, 55 DEG C ~ 65 DEG C, 30s, 72 DEG C, 30 ~ 60s, 35 circulations,
72℃、10min。
Field culture is moved to the two-wheeled PCR plant be positive of identification, in being received by individual plant after florescence bagging selfing, maturation
Obtain seed and continue to repeat above-mentioned appraisal, Basta resistances, hygromycin resistance, PCR identifications are carried out, until obtaining conversion of pure
It is fit.
Finally, identified by continuous 4 generation, obtain 9 transgenic homozygous strains.
Embodiment 4
The transgene rape strain that one of them obtained to screening in embodiment 3 has comprehensive adverse-resistant characteristic is named as many bases
Because of converting material K15, with non-transgenic original material（That is, cabbage type rape Y42, WT）Used as control, inventor is further right
Growth phenotype, physiological change etc. are analyzed under the conditions of its economical character, environment stress, and related experiment is briefly discussed below.
Economical character under grown in field environment
Under the pattern of crop field（Plant spacing and each about 25 cm of line space）K15 and WT materials are sowed respectively, when whole plant blossoms
The agronomic shape of K15 and WT materials is measured, including branch amount, root long, plant height, fresh weight, dry weight etc..Measurement result such as following table institute
Show：
Note：* two average of samplestThere is significant difference in inspection；* * two average of samplestInspection exists extremely notable
Sex differernce.
Upper table data are analyzed, it can be seen that in full-bloom stage, it is K15 plant branch amount, root long, plant height, fresh weight, dry
Weight notable or pole is significantly more than or higher than WT.Fresh weight and dry weight such as K15 plant are respectively 660.0g, 99.2 g, and WT plants
The fresh weight and dry weight of strain are respectively 282.5 g, 45.6 g, and either to be above WT plant twices more for fresh weight or dry weight.
Growth phenotype under the conditions of environment stress
（1）Growth phenotype under high temperature stress
(30 DEG C ~ 35 DEG C) treatment of high temperature stress, specific place are carried out to K15 and WT materials in seedling stage and vegetative growth phase respectively
Reason method：
The nutritive cube for completing dibbling is positioned in plastic disk by the quantity of the alms bowl of every disk 15, moves into artificial intelligence regulating climatic chamber, in
16/8 light dark, 30 ~ 35 DEG C, cultivate under the condition of culture of relative air humidity 35-40%, 1/2 is poured in incubation in good time
Hoagland nutrient solutions, make Nutrition Soil humidity remain at 30% or so；
5 leaf phases moved into the observation phenotype of continued growth under the same conditions in Plastic Drum.
Result shows, the tolerance of K15 plant pair high temperature stress is apparently higher than WT (Fig. 3).And the resistance to height of K15 plant
Warm nature not only shows that K15 plant are respectively provided with absolute growth vigor in seedling stage and vegetative growth phase；Topmost difference exists
In under continuous high temperature, K15 can be smoothly completed by the transformation of nutrient growth to reproductive growth, and WT plant are under continuous high temperature
Nutrient growth to the transition of reproductive growth can not be completed because not carrying out low temperature vernalization.
（2）Growth phenotype under drought stress
K15 the and WT materials of chamber planting, stop pouring water after two months in nutrient growth, carry out continuous drought and to observe plant long
Gesture and phenotype.
Test result indicate that, transgenic line energy continued growth enters generative growth phase, and non-transgenic material cannot
Gradually dried up into generative growth phase dead, the drought resistance of transgenic line is significantly stronger than non-transgenic reference material（Figure
4）.
（3）Growth phenotype under low temperature stress
First in the controlled environment chamber 16/8 light dark, 25 DEG C, under relative air humidity 35-40% normal conditions, the life of nutritive cube seedling
It is long to choose the consistent K15 seedling of upgrowth situation and process 12 h under WT seedling is placed in 0 DEG C of low temperature to four leaf stage, people is moved into afterwards
Work climatic chamber continues to cultivate under normal operation, observes the extent of injury and phenotype of plant.
Test result indicate that, after low temperature stress treatment, relative to K15, WT seedling wilting degree is more serious, K15 plant
Chilling resistance is substantially better than WT, shows absolute growth vigor（Fig. 5）.
The comprehensive analysis of material resistance
（1）Germination rate
Program request K15 and the WT seed on containing 100 mM NaCl, 200 mM mannitol, the MS solid mediums of 5 μM of ABA respectively,
Dark treatment carries out germination rate statistical experiment two days later.Sprouted respectively at the 3rd day, the 4th day, the 5th day and the 9th day statistics seed after dibbling
Hair number, timing statisticses are fixed on every morning 8:00 point.
The statistics of different time points seed germination rate is as shown in the table under Stress treatment：
Note：Germination rate duplicate measurements average value is represented.
To upper table data analysis it can be found that for relative to WT, K15 seeds have obvious sprouting advantage, to adverse circumstance
The sensitiveness of stress is substantially less than WT.Under 100 mM NaCl, 200 mM mannitol, 5 μM of ABA treatment conditions, K15 seeds
Highest germination rate, respectively 100%, 99%, 98% are reached respectively at the 5th day, the 7th day, the 9th day.And WT seeds are in NaCl, sweet dew
Under the conditions of alcohol Stress treatment, germination rate is relatively low all the time, and to the 9th day, its germination rate was respectively 81%, 77%；Under ABA treatment conditions, WT
Seed reaches highest germination rate (97%) to the 9th talent.
（2）Seedling root is long and plant height
Seed in being tested to above-mentioned germination rate proceeds to cultivate, and the 10th day after dibbling, seedling root is long and plant height for measurement, with
The all plant roots of every interior certain sample of culture dish are long, plant height average represents a valid data (cm/ plants).
Result shows (Fig. 8), and under the conditions of 3 kinds of Stress treatments, the root of K15 seedling is long to be all remarkably higher than WT.In 100 mM
Under the conditions of NaCl, 200 mM treatment with mannitol, the plant height of K15 seedling is slightly above WT seedling, and significant difference is not reached；5
Under μM ABA treatment conditions, the plant height of K15 seedling is significantly higher than WT.
（3）Seedling dry weight and fresh weight
After seedling root is long, plant height is measured, fresh weight is weighed, removed with all total fresh weights of plant in certain sample number into spectrum in every culture dish
One valid data (mg/ plants) are represented with the average after numbering plant sum, 5 wares of often numbering measurement there are 5 effectively
Data, every group of experiment is repeated 3 times.After the completion of seedling fresh weight is weighed, it is fitted into the strong kraft paper bag of reference numeral gas permeability.In
15 min de-enzymes are bakeed in 105 DEG C of baking ovens；After in 75 DEG C of electric drying oven with forced convections, the h of freeze-day with constant temperature 24.Dry weight is weighed, is had
The effect same fresh weight of method for computing data (mg/ plants).Relative fresh weight or relative dry weight with seedling fresh weight under Stress treatment or dry weight with not
The ratio of seedling fresh weight or dry weight is represented during Stress treatment.Statistics is as shown in the table：
Note：* two average of samplestThere is significant difference in inspection.
After upper table analysis of statistical data, it can be seen that under the conditions of three kinds of Stress treatments, the relative dry weight of K15 seedling and
Relative fresh weight is above WT.But the Relative fresh weight of K15 seedling is significantly higher than WT (P under the conditions of only 200 mM treatment with mannitol
=0.027), remaining is not reaching to significant difference.Compared with normal growth seedling, K15 seedling dry weight and fresh after Stress treatment
The fall of weight is below WT seedling, illustrates under equal stress conditions, and K15 is influenceed smaller by stress, its moisture holding capacity and life
Thing amount accumulation is above WT.
To sum up result, from the point of view of the growth indexes of seedling after seed is sprouted and sprouts, K15 is notable to the resistance of environment stress
Higher than WT.
（4）Blade face temperature survey
K15 and WT materials are planted in greenhouse respectively, in growth of seedling to four leaf stage, respectively at soil moisture content be 35% and 5%
Shi Liyong far infrareds thermal imaging system measures the blade face temperature of the in vitro true leaf of seedling second and the 3rd.
Result is as shown in Figure 9.Measurement result shows, when soil moisture content is 35% or so, two kinds of materials second and
The blade face temperature difference of the 3rd in vitro true leaf is little；When soil moisture content is down to 5% or so, K15 seedling second and
Apparently higher than WT, mean temperature is higher by 2 DEG C, 1.5 DEG C or so to three in vitro true leaf blade face temperature respectively.This result shows, does
After drought stress, because K15 seedling blade face temperature is higher than WT, illustrate K15 transpiration rate-of-losss of coolant and fluid loss less than WT, plant water holding
Ability is higher than WT, and the tolerance to drought stress is higher than WT.
（5）Stomatal aperture and percentage of water loss are determined
K15 and WT materials are planted in greenhouse respectively, in growth of seedling to four leaf stage, observe the same day 8:00 point or so sampling, chooses
Second true leaf is equally divided into two parts with vein as axis：
A part be placed in rape stomata buffer solution (60 mM KCl, 10 mM, solid Tris adjust PH to 6.15), in 285 μ
mol/m2Light induction stomatal opening under/s light intensity, Induction Process Leaf lower epidermis is towards illumination；Careful tearing takes blade after 5 h
Lower epidermis, writing brush gently brushes away mesophyll cell, and film-making carries out stomatic observation and stomata after observation photograph under stereomicroscope
Aperture measurement；
Another half vane continued growth in same blade, in the observation same day 10:00 point or so, it is placed in vitro in stomata buffer solution,
Blade treatment, observation photograph are ibid；
Stomatal aperture is represented (%) with surveying stomatal width with the percentage of actual measurement stomata lenth ratio.
Result such as Figure 10.Figure 10 A show that the stomatal frequency of two kinds of materials does not have notable difference.Further measure stomata
(Figure 10 B) is found after aperture, no matter whetheing there is photo-irradiation treatment, stomatal aperture all pole of WT blades is noticeably greater than K15.Photo-irradiation treatment
Afterwards, the stomatal aperture of WT blades increases sharply, and (t inspection P values are 1.34 × 10-8)；Although K15 Stoma of Leaves is also lured by illumination
Lead, but compared with WT, its stomatal aperture only slightly has increase, and (t inspection P values are 4.8 × 10-4)。
Stomatal aperture directly influences the moisture holding capacity of plant, using dehydration measuring system further measure K15 and WT from
The percentage of water loss of body blade (second true leaf).During measurement, in the measurement same day 10:00 point or so beginning, time of measuring continue to
22:, last 12 h at 00 point.
Result shows (Figure 10 C), and K15 blades have stronger moisture holding capacity.From Figure 10 C, dehydration measurement experiment
After carrying out 30 min, the excised leaf percentage of water loss of K15 and WT starts notable difference occur.When Therapy lasted is to 350 min, K15
The percentage of water loss of excised leaf only has 20% or so, and now WT excised leafs percentage of water loss has been up to more than 50%.700 min
Afterwards, the percentage of water loss of K15 excised leafs is close to 35%, and WT excised leaf percentages of water loss are up to 80% or so.
These results suggest that, under the conditions of environment stress, compared with WT, K15 can with significantly more efficient control stomatal aperture,
And then leaf transpiration dehydration is reduced, and strengthen plant water holding capacity, effectively improve the resistance to drought stress.
（6）ABA and MDA assays
Due to containing 2 ABA synthesis related genes (NCED3, LOS5) and 1 ABA signal pathway in 5 functional genes of conversion
Related gene (ABAR), to verify the effect after these functional genes overexpression, inventor further determines K15 and WT and plants
ABA in strain（Abscisic acid）Content and MDA（MDA）Content.
MDA contents are determined using thiobarbituricacidα- (TBA) method, and ABA contents use ELISA（Elisa）Determine.
In plant during ABA assays, there are two parts in plant material source：The children of 7 days is cultivated in Hoagland nutrient solutions
Seedling is sampled after pouring the h of 15% PEG6000 Stress treatments 12；Cultivated in greenhouse nutritive cube to the seedling of four leaf stage, after stopping is poured water
Use soil nmoisture content analyser（Delta-T companies of Britain, WET-2）Measurement soil moisture content, respectively at soil moisture content 35%, 0%
When take the 3rd true leaf；
In plant during MDA assays, cultivated in greenhouse nutritive cube to the normal growth seedling of four leaf stage, use 20% PEG6000
The 3rd true leaf is taken to measure sample after processing 12 h.
Measurement result shows：
Under the conditions of non-Stress treatment, the ABA contents in K15 seedling are respectively 357.8 ng/g and 299.3 ng/g, divide in blade
Not Wei 168.3 ng/g and 130.5 ng/g, the ABA contents in seedling and blade are significantly higher than WT；
After Stress treatment, the ABA contents in K15 and WT seedling are respectively 507.7 ng/g, 380.6 ng/g, are respectively in blade
267.9 ng/g、190.9 ng/g；
ABA contents after Stress treatment in K15 seedling and blade increase sharply, reached compared with WT pole significant difference (Figure 11 A,
B)。
MDA is Lipid peroxidation metabolism product, and MDA contents can direct reaction plant interior free yl level and stress in plant
Under the conditions of in plant cell physiological damage level.
MDA assay results show：
During non-Stress treatment, the MDA average contents in K15 and WT blades be respectively 5.73 μM/g, 3.20 μM/g；
After Stress treatment, the MDA contents in K15 and WT blades are sharply increased, respectively up to 11.16 μM/g, 7.37 μM/
g；Now the MDA contents pole in K15 is substantially less than WT, and it increases multiple, and also significantly lower than WT, (K15 is 1.9 times, and WT is 2.3
Times) (Figure 11 C).
Summary ABA and MDA assay result shows that ABA contents pole is significantly higher than WT in K15 bodies, while MDA contains
Amount pole is substantially less than WT, and this result can accurately explain a series of phenotypic differences and degeneration-resistant sex differernce between K15 and WT.
Gene expression analysis
Above-mentioned experiment is all based on the analysis in terms of the phenotype of plant, physical signs, and inventor in K15 materials further with regard to turning
Expression quantity situation of change of the related gene of change when Different stress is processed is determined analysis, and related experiment is briefly introduced such as
Under.
It should be noted that the expression pattern of 5 kinds of functional gene expression cassettes is not quite similar in constructed conversion carrier, its
In, for pSuper composing types overexpress promoter in ICE1 and LOS5 expression casettes；Tri- genes of CBF3, ABAR and NCED3
Expression cassette is stress induced promoter pRD29A, is expressed by stress-inducing.
When being measured to gene expression amount, it is analyzed using qRT-PCR technologies, when qRT-PCR is analyzed, primer sequence
Design is as follows：
。
Plant K15 and WT in greenhouse in nutritive cube respectively, the seedling to growing to the 7th day carries out Stress treatment.At stress
Reason is divided to two kinds：The treatment of 15% PEG6000 Drought stress simulations and the treatment of 150 mM NaCl salt stresses.
Drought stress simulation treatment
After 15% PEG6000 Stress treatments, the qRT-PCR expression analysis of 5 kinds of functional genes show, 5 kinds of function bases in K15 plant
Because having different expression patterns.
Before Stress treatment, expression quantity of the ICE1 and LOS5 that pSuper drives in K15 plant has been significantly higher than WT (3
Times or so)；After PEG6000 Stress treatments, ICE1 and LOS5 gene expression amounts are raised in two kinds of materials, gene in K15 plant
Modulation is bigger on expression quantity.When processing 12 h, the gene expression abundance of LOS5 genes reaches in ICE1, LOS5 gene and WT in K15
To peak, begin to decline afterwards.
Inducible promoter pRD29A drives tri- expression patterns of gene of CBF3, ABAR and NCED3 extremely phase of expression
Seemingly.Before Stress treatment, 3 kinds of gene expression abundances of gene are almost without difference in two kinds of materials.And after PEG6000 Stress treatments,
The gene expression abundance of 3 kinds of genes is raised rapidly in K15, and is peaked in 12 h or so, now in K15 on NCED3 expression quantity
75 times or so of tune, ABAR expression quantity raise 45 times or so, 35 times or so of CBF3 expression quantity rise, 3 kinds of expression of gene in WT
Modulation is very small in abundance.PEG6000 Stress treatments more than 12 h, under 3 kinds of expression quantity of gene are rapid in two kinds of materials
Drop (Fig. 6).
Salt stress treatment
After 150 mM NaCl treatment, K15 shows the gene expression difference similar with 15% PEG6000 treatment with WT seedling
(Fig. 7).Salt stress processes 12 h, and NCED3 expression quantity raises 20 times or so, 25 times of left sides of ABAR expression quantity rise in K15 plant
Right, CBF3 expression quantity raises 30 times or so, and relative expression's abundance of 3 kinds of expression profiles reaches peak value, but relative to
The maximum of 3 kinds of gene expression amounts is substantially relatively low after PEG6000 treatment.
Claims (4)
1. a kind of method that polygenes superposition cotransformation improves rape synthesis resistance, it is characterised in that comprise the following steps：
（1）The structure of plant expression vectors containing multiple genes,
PABA-oriT carriers are built, the clone gene expression cassette in the T-DNA of the carrier includes 5 kinds of degeneration-resistant work(being sequentially connected in series
Can gene and 3 kinds of selectable marker genes；
5 kinds of degeneration-resistant functional genes include：2 ABA synthesis related genes NCED3, LOS5,1 ABA signal pathway dependency basis
Because of ABAR, 2 freeze proof regulatory gene ICE1, CBF3；
3 kinds of selectable marker genes include hygromycin gene HYG, GUS and glufosinate resistance gene BAR；
5 kinds of degeneration-resistant functional genes and 3 kinds of selectable marker genes pABA-oriT carrier T-DNA areas specifically put in order for：
LB-HYG–GUS-BAR-ICE1-LOS5-CBF3-ABAR-NCED3-RB；
（2）To step（1）In constructed recombinant expression carrier identification, it is ensured that 5 kinds of functional genes coexist in same expression and carry
In body；
（3）To step（2）The middle correct recombinant expression carrier conversion Agrobacterium of identification, prepares conversion fluid；
（4）Rape is converted using agriculture bacillus mediated flower-dipping method, after conversion, continues to cultivate to maturation, seed is harvested by individual plant；
（5）The screening and identification of transformant, by step（4）Middle harvested rape seed sowing, carries out Basta resistances, tide successively
Chloramphenicol resistance is screened, and enters performing PCR identification to Double plant；
（6）Transformant selfing obtains homozygote, to step（5）Middle screening, the correct transformant of identification continue to cultivate, when the florescence
Bagging, makes its selfing, harvests single-strain seed；
Seed to harvesting continues to plant, same to step（5）Operation, proceeds Basta resistances, hygromycin resistance, PCR identifications,
And to identifying that correct transformant continues selfing, and conversion homozygote is finally obtained, as turn base with comprehensive adverse-resistant characteristic
Because of rape.
2. the method that polygenes superposition cotransformation as claimed in claim 1 improves rape synthesis resistance, it is characterised in that step
（2）In, when recombinant expression carrier is identified, using PCR identification methods, when PCR is identified, primer sequence design is as follows：
NCED –F：5'AACTTAGTGAGACCCTCCTCTGTT 3',
NCED-R：5' TAGTGTTGGATTCTTTGGCTTTGG 3'；
ABAR-F：5'AACTTAGTGAGACCCTCCTCTGTT 3',
ABAR-R：5’ ACTTTAATCGCCAATTCCTCGACG 3’；
CBF–F：5'AACTTAGTGAGACCCTCCTCTGTT 3',
CBF-R： 5’ TTGAAATGTTCCGAGCCAAATCCT 3’；
LOS5-F：5 ' ATAGATACGCTGACACGCCAAGCC 3 ',
LOS5-R：5’ CTATAAGGTCACTGGTGGCCGAAC 3’；
ICE1-F：5 ' ATAGATACGCTGACACGCCAAGCC 3 ',
ICE1-R：5’ CTCTTCCCTTTCTCCACCACCACC 3’.
3. the method that polygenes superposition cotransformation as claimed in claim 1 improves rape synthesis resistance, it is characterised in that step
（4）In, during conversion rape, inflorescence soaks 90 ~ 120 seconds every time in conversion fluid；During conversion operation, convert 1 time every other day, it is continuous to turn
Change 3 times.
4. the method that polygenes superposition cotransformation as claimed in claim 1 improves rape synthesis resistance, it is characterised in that step
（6）In, the identification to transformant need to be identified through the continuous selfing no less than 4 generations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611225064.7A CN106834345B (en) | 2016-12-27 | 2016-12-27 | Method for improving comprehensive stress resistance of rape by multi-gene superposition cotransformation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611225064.7A CN106834345B (en) | 2016-12-27 | 2016-12-27 | Method for improving comprehensive stress resistance of rape by multi-gene superposition cotransformation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106834345A true CN106834345A (en) | 2017-06-13 |
| CN106834345B CN106834345B (en) | 2020-09-04 |
Family
ID=59136432
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611225064.7A Active CN106834345B (en) | 2016-12-27 | 2016-12-27 | Method for improving comprehensive stress resistance of rape by multi-gene superposition cotransformation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106834345B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517839A (en) * | 2018-12-05 | 2019-03-26 | 江苏省农业科学院 | A kind of penetrating fluid and a kind of Agrobacterium tumefaciens mediated fast simple stable genetic transforming method of strawberry |
| CN110257444A (en) * | 2019-03-08 | 2019-09-20 | 海南大学 | A method of producing medium chain fatty acid in plant cell |
| CN111154773A (en) * | 2020-02-19 | 2020-05-15 | 黑龙江省林业科学研究所 | Application of populus tremuloides PsnICE1 gene |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101001958A (en) * | 2004-06-07 | 2007-07-18 | 巴斯福植物科学有限公司 | Improved transformation of soybean |
| CN101173287A (en) * | 2007-10-16 | 2008-05-07 | 北京未名凯拓农业生物技术有限公司 | Clone and application of a gene improving rice drought tolerance and relative with ABA synthesis |
| CN101979596A (en) * | 2010-02-03 | 2011-02-23 | 中国农业大学 | Method for constructing recombinant expression vector simultaneously expressing a plurality of genes |
| CN102559673A (en) * | 2010-12-16 | 2012-07-11 | 华中农业大学 | Promoter specifically induced and expressed under condition of lack of phosphorus in cabbage type rape |
| CN104845979A (en) * | 2015-06-11 | 2015-08-19 | 西南大学 | Brassica napus SKIP gene family as well as recombinant vector and application thereof |
| CN105519427A (en) * | 2015-12-25 | 2016-04-27 | 重庆市农业科学院 | High-oil routine rape variety recurrent selection method |
-
2016
- 2016-12-27 CN CN201611225064.7A patent/CN106834345B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101001958A (en) * | 2004-06-07 | 2007-07-18 | 巴斯福植物科学有限公司 | Improved transformation of soybean |
| CN101173287A (en) * | 2007-10-16 | 2008-05-07 | 北京未名凯拓农业生物技术有限公司 | Clone and application of a gene improving rice drought tolerance and relative with ABA synthesis |
| CN101979596A (en) * | 2010-02-03 | 2011-02-23 | 中国农业大学 | Method for constructing recombinant expression vector simultaneously expressing a plurality of genes |
| CN102559673A (en) * | 2010-12-16 | 2012-07-11 | 华中农业大学 | Promoter specifically induced and expressed under condition of lack of phosphorus in cabbage type rape |
| CN104845979A (en) * | 2015-06-11 | 2015-08-19 | 西南大学 | Brassica napus SKIP gene family as well as recombinant vector and application thereof |
| CN105519427A (en) * | 2015-12-25 | 2016-04-27 | 重庆市农业科学院 | High-oil routine rape variety recurrent selection method |
Non-Patent Citations (4)
| Title |
|---|
| ZAIQINGWANG等: "Multi-gene co-expression can improve comprehensive resistance to multiple abiotic stresses in Brassica napus L.", 《PLANT SCIENCE》 * |
| 刘晓等: "转基因油菜研究进展", 《农艺学》 * |
| 徐呈祥: "提高植物抗寒性的机理研究进展", 《生态学报》 * |
| 魏睿等: "转多基因草坪草的耐盐性鉴定", 《北方园艺》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517839A (en) * | 2018-12-05 | 2019-03-26 | 江苏省农业科学院 | A kind of penetrating fluid and a kind of Agrobacterium tumefaciens mediated fast simple stable genetic transforming method of strawberry |
| CN110257444A (en) * | 2019-03-08 | 2019-09-20 | 海南大学 | A method of producing medium chain fatty acid in plant cell |
| CN110257444B (en) * | 2019-03-08 | 2023-04-25 | 海南大学 | Method for producing medium-chain fatty acid in plant cells |
| CN111154773A (en) * | 2020-02-19 | 2020-05-15 | 黑龙江省林业科学研究所 | Application of populus tremuloides PsnICE1 gene |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106834345B (en) | 2020-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100355897C (en) | Method for promoting salt and drought tolerance of maize and wheat by combining betA,NHX1,PPase gene and transgene technology | |
| CN102599052B (en) | Plant in-situ regeneration method and application thereof in genetic transformation | |
| CN105873940A (en) | Plants with enhanced photosynthesis and methods of manufacture thereof | |
| CN107987141B (en) | Application of corn nuclear factor gene ZmNF-YA1 in plant stress resistance modification | |
| CN104004781A (en) | Preparation method of glyphosate resistant transgenic rice | |
| CN110100723A (en) | A kind of hybrid selection method and its application of fast period cabbage type rape | |
| CN107840872A (en) | Albumen and the application of wax plum CpWOX13 genes and its coding | |
| CN106834345A (en) | A kind of method that polygenes superposition cotransformation improves rape synthesis resistance | |
| CN102174568B (en) | Method for in-situ transgenosis of corn mature embryo | |
| CN101643745B (en) | Thellungiella V-pyrophosphatase gene (TsVPI) promoter sequence and application of deletion mutant thereof | |
| CN105349551B (en) | A kind of corn mZmDEP gene and its application of expression inhibiting structure in corn breeding for stress tolerance | |
| CN110358772A (en) | The OsEBP89 gene and preparation method of raising rice abiotic stress resistance and application | |
| CN105671058B (en) | The gene of coding sweet potato ERF transcription and application | |
| CN104450742B (en) | Maize kernel factor gene ZmNF YB3 and its homologous gene application | |
| CN1768575A (en) | Method for improving beet salt-resistance, draught-resistance and anti-herbicide chlorsulfuron characteristics by multi-gene transformation and application | |
| CN102286522A (en) | Method for cultivating transgenic rice without foreign gene in white rice through molecular deletion strategy | |
| CN104871972B (en) | The high frequency regenerating system method for building up that effectively control watermelon adventitious bud water stainization phenomenon occurs | |
| CN107858370A (en) | A kind of method for preparing fertility-lowered plant | |
| CN102181436B (en) | Botanic vegetative growth maintenance gene system and establishment of vegetative growth maintenance plant and method for utilizing infinite growth capacity of seed plants | |
| CN105420272A (en) | Method for culturing selectable-marker-free herbicide-resistant transgenic plant and carrier special for method | |
| CN109837298A (en) | A kind of degeneration-resistant genetic conversion system of sweet cherry roots and its construction method | |
| Matthews et al. | Agrobacterium rhizogenes-based transformation of soybean roots to form composite plants | |
| CN108165553A (en) | A kind of rubber tree floral organ characterization factor gene and its coded product and application | |
| CN103320468B (en) | UCH320 protein and application of coding gene thereof in adjusting and controlling plant growth and development | |
| CN104098661B (en) | The albumen relevant to rice stress-tolerance and chlorophyll content of rice and encoding gene thereof and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |