CN106834248A

CN106834248A - One gene TaABC1 2 for having ABC1 like kinase domains and its application

Info

Publication number: CN106834248A
Application number: CN201611186721.1A
Authority: CN
Inventors: 曹爱忠; 邢莉萍; 杨文武; 周传玉; 徐杰飞; 胡平; 刘佳倩; 张瑞奇; 张守忠; 陈佩度
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2016-12-20
Filing date: 2016-12-20
Publication date: 2017-06-13
Anticipated expiration: 2036-12-20
Also published as: CN106834248B

Abstract

The invention belongs to genetic engineering field, a gene TaABC1 2 for having ABC1 like kinase domains and its application are disclosed.The cDNA sequence of tool ABC1 like kinase domain genes TaABC1 2 is SEQ ID NO.2 for the amino acid sequence of SEQ ID NO.1 and its coding.The gene comes from common wheat (Triticum asetivum L.) Yangmai No.158.TaABC1 2 is strengthened in powdery mildew wheat breed Yangmai No.158 is felt by white rust induced expression, and expression is far above the expression in the south agriculture 9918 of anti-disease wheat kind.Between the positive sequences of TaABC1 2 to be inserted into BamHI the and KpnI restriction enzyme sites of pWMB006, while reverse sequence is inserted into obtains interference expression vector between the SpeI of pWMB006 and SacI, and sense powdery mildew wheat breed Yangmai No.158 is converted, the mildew-resistance qualification result of positive transformants plant shows that the reduction expression of TaABC1 2 can improve resistance of the sense powdery mildew wheat breed to powdery mildew.

Description

One gene TaABC1-2 for having ABC1-like kinase domains and its application

Technical field

The invention belongs to genetic engineering field, a gene for tool ABC1-like kinase domains is disclosed TaABC1-2 and its application.

Background technology

Wheat is one of most important cereal crops of China or even the world, and it grows and but receives various abiotic and biology Stress.The wheat powdery mildew caused by wheat powdery mildew (Blumeria graminis f.sp tritici) is main wheat One of disease.It belongs to specialization parasitism, can infect leaf portion, stalk, fringe portion of wheat etc. in whole breeding time, wherein main danger Evil wheat leaf blade, influences wheat normal photosynthesis when serious, so as to influence its normal growth, reduce yield.General feelings Under condition, wheat powdery mildew can make wheat yield more than 30% under can causing wheat yield 5-19%, serious conditions.From 90 After age, the onset area of the annual wheat powdery mildew in the whole nation more than 6,000,000 hectares, serious harm Wheat Production safety, because The preventing and treating of this wheat powdery mildew is increasingly paid close attention to by people.

Seed selection powdery-mildew-resistance wheat kind is most efficient method.Wheat and powdery mildew are formed in long-term evolutionary process Complicated interaction system, one side Wheat Evolution has gone out a series of disease-resistant genes and the disease resistance mechanisms of complexity go to resist powdery mildew Infect and reach disease-resistant purpose, so disease-resistant gene is imported in wheat can improve resistance of the wheat to powdery mildew；The opposing party A series of mechanism of causing a disease that face powdery mildew has also evolved pathogenic effectors and complexity is gone to infect plant and reaches pathogenic purpose, disease The pathogenic performance of opportunistic pathogen not only needs the participation of the pathogenic effector of pathogen itself, in addition it is also necessary to activation or the sense using wheat Ospc gene goes to hit pay dirk the purpose for infecting, so the expression that susceptible gene is reduced in wheat can disturb invading for powdery mildew Dye, can equally reach the purpose for improving wheat to powder mildew resistance, but be available for the wheat sense that genetic engineering is utilized white at present Powder ospc gene lacks.

Southern agriculture 9918 is a wheat breed for wide spectrum mildew-resistance, and the parent Yangmai No.158 similar with its genetic background is One sense powdery mildew wheat breed.Using transcribing, spectral technology obtains disease-resistant southern agriculture 9918 and susceptible Yangmai No.158 is induced by powdery mildew Front and rear gene expression profiling, transcribes the difference of spectrum between two materials by comparing, and obtains one and is received in susceptible Yangmai No.158 The gene TaABC1-2 of powdery mildew induced expression, the gene may be played in powdery mildew infection processs assistance pathogen invasion and The effect of development, so as to cause Yangmai No.158 susceptible.So reducing the expression of TaABC1-2 in susceptible material, disease can be disturbed The production of opportunistic pathogen, plays the ability for improving susceptible material mildew-resistance.

The content of the invention

The purpose of the present invention is directed to the drawbacks described above of prior art, there is provided one kind tool ABC1-like kinase domains Gene TaABC1-2 restructuring interference carrier and application.

The purpose of the present invention can be achieved through the following technical solutions：

The gene TaABC1-2 for having ABC1-like kinase domains comes from common wheat (Triticum asetivum L.) Yangmai No.158, its nucleotides sequence is classified as SEQ ID NO.1.

The protein of the gene of tool ABC1-like kinase domains is TaABC1-2, and its amino acid sequence is SEQ ID NO.2。

The restructuring interference carrier of the gene TaABC1-2 containing described tool ABC1-like kinase domains.

Described restructuring interference carrier pWMB006:TaABC RNAi are the carrier that sets out preferably with pWMB006, by TaABC1- Between the positive sequence of 2 genes is inserted into BamHI the and KpnI restriction enzyme sites of pWMB006, while reverse sequence is inserted into pWMB006 SpeI and SacI between gained.

Applications of the described gene TaABC1-2 in powdery-mildew-resistance wheat kind is built；It is preferred that it is small to suppress susceptible powdery mildew The expression of the gene TaABC1-2 described in wheat variety, it is possible to increase the resistance to powdery mildew of susceptible powdery mildew wheat breed.

The expression vector of the described gene TaABC1-2 containing tool ABC1-like kinase domains is building anti-white powder Application in sick wheat kind；It is preferred that described restructuring interference expression vector is imported in susceptible powdery mildew wheat breed, can be with Improve resistance of the susceptible powdery mildew wheat breed to powdery mildew.

Beneficial effect

Present invention clone from wheat has obtained a gene TaABC1-2 for tool ABC1-like kinase domains, should Gene receives powdery mildew induced expression in the wheat Yangmai No.158 containing thoughts powdery mildew, and in the south agriculture 9918 of the wheat of mildew-resistance Do not receive powdery mildew induced expression.Expression vector pWMB006 is inserted into, the restructuring interference expression vector of the gene for obtaining pWMB006:TaABC RNAi are imported in susceptible wheat breed, can improve resistance of the sense powdery mildew wheat breed to powdery mildew. TaABC1-2 is used for genetic engineering breeding, is conducted into susceptible powdery mildew wheat breed, it is possible to increase the powdery mildew of wheat resists Property.

Brief description of the drawings

Expression of the Fig. 1 using Q-PCR analysis TaABC1-2 in mildew-resistance south agriculture 9918 and sense powdery mildew Yangmai No.158

0 hour：Relative expression quantities of the TaABC1-2 in non-induced samples；24 hours：TaABC1-2 is induced in powdery mildew Relative expression quantity in sample

Fig. 2 TaABC1-2 RNAi carriers pWMB006:The structure of TaABC1-2 RNAi

A：pWMB006；B：pWMB006:TaABC1-2 intermediate carriers；C：pWMB006:TaABC1-2 RNAi interference carriers；

Fig. 3 pBi220:TaABC1-2 transfer-gen plants T0 is for PCR Molecular Identifications

Marker：DL2000 DNA standard molecular weights；Plasmid：pWMB006:TaABC1-2 RNAi positive controls；Yang Mai 158：Negative control；T0-8, T0-12, T0-15, T0-16：Positive transgenic plant.

Fig. 4 TaABC1-2 convert the T of Yangmai No.158₁For the powder mildew resistance identification of positive plant

A：T1-8 strain Resistance Identifications；B：T1-12 strain Resistance Identifications；C：T1-15 strain Resistance Identifications；D：T1-16 plants It is Resistance Identification

CK：Susceptible Yangmai No.158；R：The disease-resistant individual plant isolated in positive transgenic strain；S：In positive transgenic strain The susceptible individual plant isolated.

Specific embodiment

By the tool ABC1-like kinase domain genes TaABC1- of powdery mildew induced expression in the Yangmai No.158 of embodiment 1 2 clone

Southern agriculture 9918 is that Agricultural University Of Nanjing's cytogenetics is combined with modern biotechnology with traditional breeding method, With Yangmai No.158/92R137//the disease-resistant of Yangmai No.158 selection cross, high yield, good quality wheat new varieties, (Chen Peidu opens and keeps Loyalty, Wang Xiue, Wang Suling, cycle, Feng's Yi is high, and Liu is big, and an ancient unit of weight mildew-resistances High-yield Wheat new varieties south agriculture 9918. Nanjing agriculture is big Learn journal, 2002,25 (4):1438-1444).Yangmai No.158 is the spread that the institute of agricultural sciences of Lixiahe region in Jiangsu cultivates Wheat breed, shows susceptible to powdery mildew.

Powdery mildew induced expression is received in order to screen Yangmai No.158 which gene during powdery mildew is felt, this laboratory is preceding Phase research in, using high-flux sequence method obtain mildew-resistance south agriculture 9918 with feel white powder sick wheat Yangmai No.158 in white Transcription spectrum before and after the induction of powder bacterium, and obtain the base expressed by powdery mildew inducible up regulation in sense powdery mildew Yangmai No.158 by comparing Cause.Idiographic flow is as follows：The seed of the seed of powdery-mildew-resistance wheat south agriculture 9918 and sense white powder sick wheat Yangmai No.158 is sowed at training Germination in ware is supported, basin alms bowl is transplanted to after showing money or valuables one carries unintentionally, a leaf phase is the powdery mildew spores inoculation collected from sense powdery mildew wheat lines Induced on to seedling, and in being sampled within 24 hours with inoculation before inoculation, RNA is extracted respectively (with Invitrogen companies Trizol reagents are extracted), form four sample R0 (Nan Nong 9918 induces the sample of 0 hour), (inductions 24 of Nan Nong 9918 are small for R24 When sample) and the Y0 sample of 0 hour (Yangmai No.158 induce), Y24 (Yangmai No.158 induces the sample of 24 hours), and deliver Hua Da Company carries out transcription spectrum sequencing.The transcription spectrum of R24 and R0 is compared, powdery mildew inducible up regulation is received in screening in southern agriculture 9918 The gene of expression forms database R-data, while the transcription spectrum of Y24 and Y0 is compared, screening is in Yangmai No.158 by white The gene of powder bacterium inducible up regulation expression forms database Y-data.Further Y-data is compared with R-data, screening is only The gene in Y-data is appeared in, this genoid is only is expressed in susceptible Yangmai No.158 by powdery mildew inducible up regulation, and in south The gene of expression is lowered in agriculture 9918 by powdery mildew induction.In gene of the Yangmai No.158 by powdery mildew induced expression, there is a base Because Ta#S58896846 has ABC1-like kinase domains, tentatively judge that the gene has with the susceptibility of Yangmai No.158 Correlation.

The RNA reverse transcriptions that the blade of 24 hours is extracted are induced into cDNA as template, with basis through powdery mildew with Yangmai No.158 The primer P1 (ATGTCCGTCGCGGCCGCGGC, SEQ ID NO.3) and P2 of chip probe Ta#S58896846 designs (GGCTATGCTACACCACCTCT, SEQ ID NO.4), for primer carries out RT-PCR, obtains the full-length gene of TaABC1-2； As shown in SEQ ID NO.1, the protein sequence of coding is as shown in SEQ ID NO.2 for its ORF sequence..

Expression analysis of the TaABC1-2 of embodiment 2 in disease-resistant southern agriculture 9918 and susceptible Yangmai No.158

In order to study expression patterns of the TaABC1-2 in anti-sense powdery mildew material, using the south agriculture 9918 of disease-resistant material and sense It is template that sick material Yangmai No.158 induces the RNA reverse transcriptions cDNA of 0,24 hours through powdery mildew, using P3 (TCCTCTCCGATAGCTGCAAG, SEQ ID NO.5) and P4 (GTTAGGCCGGTATGCTGTTG, SEQ ID NO.6) are to draw Thing carries out real-time fluorescence quantitative PCR (Q-PCR) analysis.PCR programs are：PCR reaction real-time fluorescence quantitative PCR instrument (MyIQ, Bio-Rad companies, the U.S.) on expand and detect fluorescence.The PCR containing 2 × SYBR Green in 20uL PCR reaction systems Master Mix 10uL, 0.5 μM of primer P3 and P4, reverse transcription cDNA templates 2uL.Amplification is：95 DEG C 10 minutes, then 95 DEG C 15 seconds, 60 DEG C 30 seconds, 72 DEG C 1 minute, totally 40 circulation.After reaction terminates, the measure of melting curve is carried out.Detection gene Expression is analyzed with MyiQ systems soft wares.Result shows, in 92R137, TaABC1-2 receives strip rust bacteria inducible up regulation table Reach, raise significantly within 12 hours, expression highest after 24h, expression in 48 and 72 hours has declined；In Yangmai No.158, TaABC1-2 Without the feature by strip rust bacteria induced expression, the expression quantity of each time period is below the expression quantity (Fig. 1) in 92R137.

The TaABC1-2 interference carriers pWMB006 of embodiment 3:The structure of TaABC RNAi

Interference TaABC1-2 gene expressions pWMB006:The TaABC RNAi carriers that set out are pWMB006 (Tingting Chen,Jin Xiao,Jun Xu,Wentao Wan,Bi Qin,Aizhong Cao,Wei Chen,Liping Xing,Chen Du,Xiquan Gao,Shouzhong Zhang,Ruiqi Zhang,Wenbiao Shen,Haiyan Wang and Xiue Wang.Two members of TaRLK family confer powdery mildew resistance in common wheat.BMC Plant Biology 201616:27 DOI:10.1186/s12870-016-0713-8).Build flow such as Under：1st, the gene order of the TaABC1-2 to have cloned is template, design primer P5 (TTGGATCCAGATCGACTGCACCC, SEQ ID NO.7) and P6 (TTGGTACCCACGAGTCACGACCT, SEQ ID NO.8), and digestion positions of the P5 with BamHI Point, restriction enzyme sites of the P6 with KpnI.2nd, it is template with the plasmid containing TaABC1-2 genes, is carried out using primer pair P5 and P6 PCR is expanded, and reclaims amplified fragments.3rd, double digestion is carried out to amplified production with BamHI and KpnI, digestion products is inserted into In carrier pWMB006 after BamHI and KpnI double digestions, the polyclonal position that TaABC1-2 forward directions are placed in behind 35S promoter At point.Thus target gene TaABC1-2 is cloned into the downstream of strong promoter 35S, expression vector pWMB006 is obtained: TaABC1-2.4th, the gene order of the TaABC1-2 to have cloned is template, design primer P7 (TTGAGCTCAGATCGACTGCACCC, SEQ ID NO.9) and P8 (TTACTAGTCACGAGTCACGACCT, SEQ ID NO.10), and P7 with SacI restriction enzyme site, P8 with SpeI restriction enzyme site.5th, with the plasmid containing TaABC1-2 genes pWMB006:TaABC1-2 is template, and entering performing PCR using primer pair P7 and P8 expands, and reclaims amplified fragments.6th, with SacI and SpeI carries out double digestion to amplified production, and digestion products are inserted into the carrier pWMB006 after SacI and SpeI double digestions: In TaABC1-2, at the MCS that TaABC1-2 is reversely placed in behind 35S promoter.Thus by target gene The hairpin structure of TaABC1-2 is cloned into the downstream of strong promoter 35S, obtains interference expression vector pWMB006 as shown in Figure 2: TaABC RNAi。

The pWMB006 of embodiment 4:TaABC RNAi convert the Molecular Identification of common wheat Yangmai No.158 and positive plant

Using gene gun conversion method by pWMB006:TaABC RNAi are transferred to the conversion side of sense powdery mildew acceptor Yangmai No.158 Method is as follows：1st, 7 days about 2000 pieces of Yangmai No.158 Immature embryo callis of picking preculture, in hypertonic culture medium (MS+ABA0.5mg/L+ Caseinhydrolysate 500mg/L+2,4-D2mg/L+ glucose 30g/L+0.4mol/L mannitol, pH5.8) on pretreatment it is 4-5 small When；2nd, the interference expression vector pWMB006 of genes of interest TaABC1-2 will be carried:TaABC RNAi are turned by particle bombardment Change to Yangmai No.158 callus, continue culture 16 hours after bombardment on hypertonic culture medium.3rd, callus is transferred to recovery Light culture 2 weeks on culture medium (1/2MS+ caseinhydrolysates 500mg/L+2,4-D2mg/L+ sucrose 30g/L, pH5.8)；4th, will be more Injured tissue is transferred on the screening and culturing medium containing herbicide (1/2MS+ABA0.5mg/L+ caseinhydrolysates 500mg/L+2,4- D1mg/L+ sucrose 30g/L+4mg/L Bialaphos, pH5.8) screening and culturing 2 weeks；5th, by the callus group with Herbicid resistant Knit and be transferred to (1/2MS+L- paddy ammonia phthalein amine l mmol/L+ caseinhydrolysate 200mg/L+KT 1mg/L+IAA in differential medium 0.5mg/L+ sucrose 30g/L+ agar 0.8%, pH5.8) broken up, whne Bud Differentiation it is long to 2-4cm when transfer them to and take root In culture medium (1/2MS+KT 1mg/L+ sucrose 30g/L+ agar 0.8%, pH5.8).6th, 8cm, root system is about to regrowth to be relatively good for When strong, you can open pipe hardening 1-2 day, the culture based draff for finally washing away root system carrying just can be transplanted into basin alms bowl.Regeneration is obtained to plant Strain totally 135.

All regeneration plant genomic DNAs are extracted, promoter internal primer P9 is utilized to transformed plant (GCCCCATATCTCCAGGTACC, SEQ ID NO.11) and gene internal primer P10 (ACTGCCGTGGAACTGTCATA, SEQ ID NO.12) enter performing PCR amplification, to identify positive plant.PCR programs：10-50ng genomic DNA templates, 10 μM of P9 and Each 0.5 μ l of P10；2.5μl 10×buffer；The dNTP of 2.5 μ l 2.5mM；The Mg of 1.5 μ l 25mM²⁺；0.25μl(5U/μl) Taq polymerase (TaKaRa), add water to 25 μ l.PCR reaction conditions are：94 DEG C of predegenerations 3 minutes；94 DEG C 45 seconds, 55 DEG C 45 seconds, 72 DEG C 2 minutes, 33 circulation；72 DEG C extend 10 minutes.PCR primer is detected through 1% agarose gel electrophoresis.Wherein 4 Strain can amplify purpose band, be accredited as positive plant.Fig. 3 show the screening of some positive plant, including T0-8, T0- 12、T0-15、T0-16。

The pWMB006 of embodiment 5:TaABC RNAi turn the powder mildew resistance identification of Yangmai No.158 positive plant

TaABC1-2 transgenosis T₀After being harvested for positive plant point individual plant, by the T of positive individual plant₁For seed kind in basin alms bowl, with Susceptible acceptor Yangmai No.158 is control, carries out the powder mildew resistance identification of excised leaf.Result shows：T₁- 8, T₁- 12, T₁-15, And T₁- 16 four strain performances are disease-resistant, and occur anti-sense segregation phenomenon between each strain.Susceptible adjoining tree Yangmai No.158 pair Powdery mildew performance sense high, powdery mildew spores heap is covered with without hypersensitive necrosis spot, on blade；Transgenosis T₁For positive plant with do not turn Change Yangmai No.158 to compare, powder mildew resistance level is significantly improved, there was only a small amount of spore on blade, and generated on blade Disease-resistant hypersensitive necrosis spot, this is the mark (Fig. 4) that blade produces resistance to pathogen.Above qualification result shows： After reduction expression quantity of the TaABC1-2 in susceptible material, the powder mildew resistance of susceptible material can be improved, the gene can be used for profit Powdery-mildew-resistance wheat is cultivated with genetic engineering means.

<110>Agricultural University Of Nanjing

<120>One gene TaABC1-2 for having ABC1-like kinase domains and its application

<160> 12

<210> 1

<211> 2265

<212> DNA

<213>Common wheat（Triticum asetivum L.）Yangmai No.158

<220>

<223>Has the gene TaABC1-2 of ABC1-like kinase domains

<400> 1

atgtccgtcg cggccgcggc cgcctccctc gtcgcctcct cttcgctctc cgttcccgac 60

cacctccgcc tccgccgccc cccgccaccg ctccgcttcc gccgccgatc aaaggaccgc 120

ctcgttcttg ctgttctcga ggagaaatcc tcctctgcgc ttactgagga ggaagcaagg 180

aagttcgggc tcaacgggag cgcgagcagg ctcgggtacg acgatgccgc ggtggaggcg 240

tacctcgggt ccaacggcaa cggaaacagc aacagcaaca ggagtgcgag taggagtggg 300

aacggcgcga gcgtgaagcc cgtgccatcc gggtctggca cttctgtggt atccggccgt 360

gggccgggtg aggatgagag gaggaggaag gagagagtgg aggagatagg cagggaggac 420

gcatggttta agcgaagcga cggagaggcc atgcccaagg tgtctgttgt tcctggtggt 480

cgttggaatc ggtttaaaac ctattcaacg attcaaagaa ccttggagat atggggctct 540

gtcttcgcat ttatattcaa ggtttggctc aacaaccaga agttcactta tcgagggggg 600

atgacggaag agaaaagggt aatgaggagg aaagttcttg ccaagtggct caaggagagt 660

attttgagat taggccccac atttattaaa ataggacagc aattctccac cagggtggat 720

attcttccaa aagaatatgt ggatcaatta tctgaattgc aggatcaggt ccctccattc 780

ccttcagaga cagctgtgtc aactattgaa gaagagctgg gagcatctgt aaatgagata 840

tttgaacgat ttgacgttga accattagct gctgctagcc tcggccaggt tcatcgggca 900

tgcctaaatg gccaagaagt tgtactcaag gtgcaaaggc ctggtctgaa agagctgttt 960

gatattgatc tgaagaattt aagggtaata gcagaatacc ttcagaaagt ggatcccaag 1020

tcagatggtg ccaagagaga ctgggttgct atttatgatg aatgtgcaaa tgtattatat 1080

caggaaatag actataccaa agaagcattt aatgctgaaa agtttgctga aaacttcaaa 1140

aatatggatt atgtgaaggt tccagaaatt tactgggagt atactacacc tcaggttcta 1200

acaatggagt atgtcccagg aatcaaaata aataggatac agcagataga taagttaggg 1260

cttgatcgga aaaggttagg ccggtatgct gttgagtcct accttgagca gattttatcg 1320

catggatttt tccacgccga cccgcatcca gggaacattg ctgttgatga tgccaatggt 1380

gggaggctta tcttctacga ctttgggatg atgggaagta ttagcccaaa tatccgcgaa 1440

ggactgcttg aagtatttta tggagtttat gaaaaagatc ctgataaagt gcttcaagca 1500

atggttcaaa tgggtgtcct tgttcctact ggagatatga cagccgtcag aagaacagct 1560

caatttttcc tggatagctt tgaagagcgt ctagctgcac aaaggaaaga gagagagatg 1620

gcaaccgtgg aacctggatt taaaaaacaa ttatctaagg aggaaaagtt tgaaaagaag 1680

aagcagagac ttgcagctat cggagaggat cttttggcaa ttgctgctga tcaaccattt 1740

cggtttcctg ccacctttac atttgtggtc agagcattct cagtactgga tggtattggg 1800

aaaggtttag atcctagatt tgatattaca gagattgcta agccttatgc catggagttg 1860

ctcagattta atgaagctgg tgttgaagta cttgttaagg atgcaaggaa gcgatgggac 1920

aggcagtctc gtgcattcta caatgtgttc cgtcaacctg acagagttga aaaacttgca 1980

cagatcattg agcgtttgga gcaaggtgat ctcaagcttc gtgtcagagc attagaatcg 2040

gaaagatcgt ttcaaagagt tgccgctgta cagaaaacaa ttggatatgg agtggctgcg 2100

ggcagtttgg taaacctcgc taccattctg cacctcaatt cgatccggat gccagcaacc 2160

atcggatact gtctttgtgc gttctttggg ctacaaatcc tgcttggcgt tctcaaggtg 2220

aagaagctgg accaacaaga gagattgata accggcactg cctga 2265

<210> 2

<211> 754

<212> PRT

<213>Common wheat（Triticum asetivum L.）Yangmai No.158

<220>

<223>Albumen TaABC1-2

<400> 2

Met Ser Val Ala Ala Ala Ala Ala Ser Leu Val Ala Ser Ser Ser Leu

1 5 10 15

Ser Val Pro Asp His Leu Arg Leu Arg Arg Pro Pro Pro Pro Leu Arg

20 25 30

Phe Arg Arg Arg Ser Lys Asp Arg Leu Val Leu Ala Val Leu Glu Glu

35 40 45

Lys Ser Ser Ser Ala Leu Thr Glu Glu Glu Ala Arg Lys Phe Gly Leu

50 55 60

Asn Gly Ser Ala Ser Arg Leu Gly Tyr Asp Asp Ala Ala Val Glu Ala

65 70 75 80

Tyr Leu Gly Ser Asn Gly Asn Gly Asn Ser Asn Ser Asn Arg Ser Ala

85 90 95

Ser Arg Ser Gly Asn Gly Ala Ser Val Lys Pro Val Pro Ser Gly Ser

100 105 110

Gly Thr Ser Val Val Ser Gly Arg Gly Pro Gly Glu Asp Glu Arg Arg

115 120 125

Arg Lys Glu Arg Val Glu Glu Ile Gly Arg Glu Asp Ala Trp Phe Lys

130 135 140

Arg Ser Asp Gly Glu Ala Met Pro Lys Val Ser Val Val Pro Gly Gly

145 150 155 160

Arg Trp Asn Arg Phe Lys Thr Tyr Ser Thr Ile Gln Arg Thr Leu Glu

165 170 175

Ile Trp Gly Ser Val Phe Ala Phe Ile Phe Lys Val Trp Leu Asn Asn

180 185 190

Gln Lys Phe Thr Tyr Arg Gly Gly Met Thr Glu Glu Lys Arg Val Met

195 200 205

Arg Arg Lys Val Leu Ala Lys Trp Leu Lys Glu Ser Ile Leu Arg Leu

210 215 220

Gly Pro Thr Phe Ile Lys Ile Gly Gln Gln Phe Ser Thr Arg Val Asp

225 230 235 240

Ile Leu Pro Lys Glu Tyr Val Asp Gln Leu Ser Glu Leu Gln Asp Gln

245 250 255

Val Pro Pro Phe Pro Ser Glu Thr Ala Val Ser Thr Ile Glu Glu Glu

260 265 270

Leu Gly Ala Ser Val Asn Glu Ile Phe Glu Arg Phe Asp Val Glu Pro

275 280 285

Leu Ala Ala Ala Ser Leu Gly Gln Val His Arg Ala Cys Leu Asn Gly

290 295 300

Gln Glu Val Val Leu Lys Val Gln Arg Pro Gly Leu Lys Glu Leu Phe

305 310 315 320

Asp Ile Asp Leu Lys Asn Leu Arg Val Ile Ala Glu Tyr Leu Gln Lys

325 330 335

Val Asp Pro Lys Ser Asp Gly Ala Lys Arg Asp Trp Val Ala Ile Tyr

340 345 350

Asp Glu Cys Ala Asn Val Leu Tyr Gln Glu Ile Asp Tyr Thr Lys Glu

355 360 365

Ala Phe Asn Ala Glu Lys Phe Ala Glu Asn Phe Lys Asn Met Asp Tyr

370 375 380

Val Lys Val Pro Glu Ile Tyr Trp Glu Tyr Thr Thr Pro Gln Val Leu

385 390 395 400

Thr Met Glu Tyr Val Pro Gly Ile Lys Ile Asn Arg Ile Gln Gln Ile

405 410 415

Asp Lys Leu Gly Leu Asp Arg Lys Arg Leu Gly Arg Tyr Ala Val Glu

420 425 430

Ser Tyr Leu Glu Gln Ile Leu Ser His Gly Phe Phe His Ala Asp Pro

435 440 445

His Pro Gly Asn Ile Ala Val Asp Asp Ala Asn Gly Gly Arg Leu Ile

450 455 460

Phe Tyr Asp Phe Gly Met Met Gly Ser Ile Ser Pro Asn Ile Arg Glu

465 470 475 480

Gly Leu Leu Glu Val Phe Tyr Gly Val Tyr Glu Lys Asp Pro Asp Lys

485 490 495

Val Leu Gln Ala Met Val Gln Met Gly Val Leu Val Pro Thr Gly Asp

500 505 510

Met Thr Ala Val Arg Arg Thr Ala Gln Phe Phe Leu Asp Ser Phe Glu

515 520 525

Glu Arg Leu Ala Ala Gln Arg Lys Glu Arg Glu Met Ala Thr Val Glu

530 535 540

Pro Gly Phe Lys Lys Gln Leu Ser Lys Glu Glu Lys Phe Glu Lys Lys

545 550 555 560

Lys Gln Arg Leu Ala Ala Ile Gly Glu Asp Leu Leu Ala Ile Ala Ala

565 570 575

Asp Gln Pro Phe Arg Phe Pro Ala Thr Phe Thr Phe Val Val Arg Ala

580 585 590

Phe Ser Val Leu Asp Gly Ile Gly Lys Gly Leu Asp Pro Arg Phe Asp

595 600 605

Ile Thr Glu Ile Ala Lys Pro Tyr Ala Met Glu Leu Leu Arg Phe Asn

610 615 620

Glu Ala Gly Val Glu Val Leu Val Lys Asp Ala Arg Lys Arg Trp Asp

625 630 635 640

Arg Gln Ser Arg Ala Phe Tyr Asn Val Phe Arg Gln Pro Asp Arg Val

645 650 655

Glu Lys Leu Ala Gln Ile Ile Glu Arg Leu Glu Gln Gly Asp Leu Lys

660 665 670

Leu Arg Val Arg Ala Leu Glu Ser Glu Arg Ser Phe Gln Arg Val Ala

675 680 685

Ala Val Gln Lys Thr Ile Gly Tyr Gly Val Ala Ala Gly Ser Leu Val

690 695 700

Asn Leu Ala Thr Ile Leu His Leu Asn Ser Ile Arg Met Pro Ala Thr

705 710 715 720

Ile Gly Tyr Cys Leu Cys Ala Phe Phe Gly Leu Gln Ile Leu Leu Gly

725 730 735

Val Leu Lys Val Lys Lys Leu Asp Gln Gln Glu Arg Leu Ile Thr Gly

740 745 750

Thr Ala

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P1

<400> 3

atgtccgtcg cggccgcggc 20

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P2

<400> 4

ggctatgcta caccacctct 20

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P3

<400> 5

tcctctccga tagctgcaag 20

<210> 6

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P4

<400> 6

gttaggccgg tatgctgttg 20

<210> 7

<211> 23

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P5

<400> 7

ttggatccag atcgactgca ccc 23

<210> 8

<211> 23

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P6

<400> 8

ttggtaccca cgagtcacga cct 23

<210> 9

<211> 23

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P7

<400> 9

ttgagctcag atcgactgca ccc 23

<210> 10

<211> 23

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P8

<400> 10

ttactagtca cgagtcacga cct 23

<210> 11

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P9

<400> 11

gccccatatc tccaggtacc 20

<210> 12

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P10

<400> 12

actgccgtgg aactgtcata 20

Claims

1. the gene TaABC1-2 of ABC1-like kinase domains had, from common wheat (Triticum asetivum L.) Yangmai No.158, its sequence is as shown in SEQ ID NO.1.

2. the protein that the gene TaABC1-2 described in claim 1 is encoded, its amino acid sequence is SEQ ID NO.2.

3. the restructuring interference carrier of the gene TaABC1-2 described in claim 1 is contained.

4. restructuring interference carrier according to claim 1, it is characterised in that with pWMB006 be the carrier that sets out, will be described Between gene TaABC1-2 forward direction sequences are inserted into BamHI the and KpnI restriction enzyme sites of pWMB006, while reverse sequence is inserted into Gained between the SpeI and SacI of pWMB006.

5. applications of the gene TaABC1-2 described in claim 1 in powdery-mildew-resistance wheat kind is built.

6. application according to claim 5, it is characterised in that in the susceptible powdery mildew wheat breed of suppression described in claim 1 Gene TaABC1-2 expression, it is possible to increase the resistance to powdery mildew of susceptible powdery mildew wheat breed.

7. application of the restructuring interference carrier described in claim 3 in powdery-mildew-resistance wheat kind is built.

8. application according to claim 7, it is characterised in that import the restructuring interference expression vector described in claim 3 In susceptible powdery mildew wheat breed, resistance of the susceptible powdery mildew wheat breed to powdery mildew can be improved.