A method of preparing can the real-time source tracer iPSCs nerve member
Technical field
The invention belongs to field of biomedicine technology, and in particular to a kind of prepare can the real-time source tracer iPSCs nerve member
Method.
Background technique
Embryonic stem cell (embryonicstemcells, ES cells) is derived from mammal blastaea inner cell mass
The pluripotent stem cell of (innercellmass, ICM) has unlimited self-renewing and Multidirectional Differentiation ability.ES cell is in disease
The great application value of model foundation and mechanism study, cell therapy, drug discovery and evaluation etc..However, using mankind's embryo
Tire is related to ethics and immune rejection problems, and scientists were once attempted to realize that reprogramming of somatic cells is thin to obtain ES by different approaches
Born of the same parents' sample pluripotent stem cell, early stage approach mainly have body-cell neucleus transplanting, cell fusion and cell extract induction, but also because of face
Limit the research and application of pluripotent stem cell the problems such as facing ethics, immunological rejection, technology, religion and law.And through specific
Transcription factor induction reprogramming of somatic cells overcome above-mentioned obstacle, undoubtedly obtain pluripotent stem cell desirable route it
One.2006, Japanese Yamanaka research group was by Oct4, Sox2, Klf4 and c-Myc4 genes of retrovirus-mediated method
It is transferred to l cell, is for the first time directly reprogrammed body cell as the celliform pluripotent stem cell of ES, and be named as and lure
Pluripotent stem cell (inducedpluripotentstemcells, iPSCs) is led, indicates that reprogramming of somatic cells is iPS cell
Technology is born.IPSCs is that one kind has the of self-replication capacity and can be divided into a variety of target function cells under certain condition
Stem cell, be divided into all histiocytic potential in human body since iPSCs has, the use of pluripotent stem cell,
It has been increasingly becoming the new resources that people find beta Cell of islet substitute.So far, the iPS of rat, people, pig, monkey and rabbit is thin
Born of the same parents system all has been established, and confirms that mouse iPS cell has the totipotency of ES cell.IPS cell disease model establish with
Mechanism study, the discovery of drug and evaluation aspect have been attended by the most momentous results, and are expected to be used for cell therapy.
In view of people iPSCs(hiPSCs) pathogenic mechanism explore and in terms of huge applications prospect, iPSCs
Inventor wins 2012 annual physiology or the medicine Nobel Prize.And induce hiPSCs directed differentiation be neuron be research nerve
First development, screening drugs for nervous, detection compound/environmental toxin genetic-neural network toxicity, is controlled the nervous system disease mechanism
Treat the indispensable technology platform of the nervous system disease.The source the hiPSCs nerve member for carrying reporter gene is that realization is above-mentioned
The powerful mean of research purpose.However how the stable this source hiPSCs nerve member of acquisition is still difficulty urgently to be resolved at present
Topic.
Currently, the strategy for preparing the source reporter gene hiPSCs nerve member specifically includes that (1) exogenous neuron opens
Mover control report gene expression, through retrovirus/slow virus carrier random integration in hiPSCs genome, disadvantage
It is the randomness due to integration site, so that exogenous reporter gene is possible to influence the table of functional gene near integration site
It reaches, the repeatability of experiment is also caused to be somewhat limited;(2) with endogenous neural member promoter by way of homologous recombination
Control report gene expression, but under causing the efficiency of homologous recombination very low.Source nerve member is prepared in the prior art usually
Using there are two types of modes: an allele of neuron mark albumen is knocked in, replaced to (A) reporter gene, this mode
The disadvantage is that neuron mark expressing quantity is caused to reduce to influence its normal physiological function;(B) neuron mark albumen with
The shortcomings that reporter gene formation fusion protein, this mode is the certain functions that possible will affect neuron mark albumen, is also had
It may cause the inactivation of reporter gene.
Summary of the invention
For this purpose, can the real-time source tracer iPSCs nerve technical problem to be solved by the present invention lies in a kind of prepare is provided
The method of member.
In order to solve the above technical problems, preparation of the present invention can the source tracer iPSCs nerve member in real time method, adopt
Reporter gene mRFP is knocked in TUBB3 allele with Crispr/Cas9 gene editing technology, makes TUBB3 coded sequence
TUBB3-2A-mRFP sequence is obtained by 2A peptide chain link with mRFP coded sequence, and is made contains TUBB3-2A- in turn
The people iPSCs of mRFP sequence is denoted as hiPSCs-TUBB3-mRFP;And by Induction of committed differentiation program, by hiPSCs- obtained
TUBB3-mRFP be efficiently divided into neuron to get.
Specifically, the described preparation can the source tracer iPSCs nerve member in real time method, include the following steps:
(1) targeting vector pSC-TUBB3-5HA-mRFP-3HA is constructed
Using the genomic DNA of hiPSCs as template, design Primer TUBB3-1-short and Primer TUBB3-2 is
Primer reacts to obtain DNA fragmentation TUBB3-5HA by PCR;
Primer TUBB3-1-short:ggatgtggtgcggaaggagtg;
Primer TUBB3-2:cttggggccctgggcctccga;
Using TUBB3-5HA as template, design Primer TUBB3-1-longnew and Primer TUBB3-2 is primer, is led to
PCR is crossed to react to obtain the TUBB3-5HA-long for having overlapping DNA fragmentation with carrier sequence;
Primer TUBB3-1-longnew:cgggctgcagcgaccaatgtggggatgtggtgcggaagga gtg;
Primer TUBB3-2:cttggggccctgggcctccga;
Using the genomic DNA of hiPSCs as template, design Primer TUBB3-5 and Primer TUBB3-6-short is
Primer reacts to obtain DNA fragmentation TUBB3-3HA by PCR;
Primer TUBB3-5:agctgctcgcagctggagtg;
Primer TUBB3-6-short:actgtggagggctgggcagtc;
Using obtained TUBB3-3HA as template, design Primer TUBB3-6-longnew and Primer TUBB3-5 is
Primer, reacting to obtain by PCR has overlapping DNA fragmentation TUBB3-3HA-long with carrier sequence;
Primer TUBB3-6-longnew:gataagcttgatatccactgtggactgtggagggctgggc agtc;
Primer TUBB3-5:agctgctcgcagctggagtg;
Using mRFP sequence as template, design Primer TUBB3-3 and Primer TUBB3-4 is primer, is reacted by PCR
Obtain having overlapping DNA fragmentation TagRFP with TUBB3-5HA-long;
Primer TUBB3-3:cggaggcccagggccccaagagggcaaagagggccacgaacttctctc tgtta
aagc;
Primer TUBB3-4:cactccagctgcgagcagctctatcaattaagtttgtgccccag;
The pSC linearized vector of purifying, TUBB3-5HA-long, TagRFP and TUBB3-3HA-long segment is taken to mix,
PSC-TUBB3-5HA-mRFP-3HA targeting vector, nucleotide sequence such as SEQ is prepared by Gibson Cloning Kit
Shown in ID No.1;
(2) sgRNA oriented carrier is constructed
The design such as sequence 1 of flowering structure and sequence 2 mix, and high-temperature heating is connect after annealing with pBS-U6-sgRNA carrier,
PBS-U6-TUBB3-sgRNA oriented carrier is prepared, nucleotide sequence is as shown in SEQ ID No.2;
Sequence 1:CACCGGTACATCTCGCCCTCTTCCT;
Sequence 2:AAACAGGAAG AGGGCGAGAT GTACC;
(3) building carries the Cas9 expression vector of EGFP reporter gene
The IRES-EGFP sequence of the nucleotide sequence structure as shown in SEQ ID No.6 is taken to be subcloned into pCAG-Cas9-bpA
The downstream of Cas9 segment in carrier, building obtain pCAG-Cas9-IRES-EGFP-bpA expression vector, and nucleotide sequence is such as
Shown in SEQ ID No.3;
(4) hiPSCs single cell suspension is prepared
Take Target vector, oriented carrier pBS-U6-TUBB3-sgRNA and pCAG-Cas9-IRES-EGFP-bpA mixed
Even, hiPSCs single cell suspension is prepared to hiPSCs in cotransfection under the mediation of lipofectamine 3000;
(5) positive hiPSCs clone of the amplification containing TUBB3-mRFP
Sort hiPSCs single cell suspension obtained, by the positive hiPSCs cell of EGFP with extra-low density be seeded in containing
E8 conditioned medium orifice plate, and picking single cell clone is further cultivated, and positive hiPSCs grams containing TUBB3-mRFP is obtained
It is grand, it is denoted as hiPSCs-TUBB3-mRFP;
(6) preparation carries the Lentiviral of Mash1, Neurogenin2
Using Chinese human total rna as template, by RT-PCR method human cloning Mash1cDNA and Ngn2cDNA, then in Asia
It is cloned on the fortimicin induction type Lentiviral containing reporter gene EGFP, be made has SEQ ID respectively
The carrier Tet-O-hMash1-IRES-EGFP of nucleotide sequence shown in No.4 and have SEQ ID No.5 shown in nucleotide sequence
Carrier Tet-O-hNgn2-IRES-EGFP;
(7) slow virus supernatant is prepared
Respectively Tet-O-hMash1-IRES-EGFP, Tet-O-hNgn2-IRES-EGFP expression vector and slow virus packet
Dress system mixes, and viral supernatants Tet- is made to 293FT cell line in transfection respectively under the mediation of lipofectamine2000
O-hMash1-IRES-EGFP,Tet-O-hNgn2-IRES-EGFP;
(8) hiPSCs-TUBB3-mRFP slow-virus infection
HiPSCs-TUBB3-mRFP obtained is cultivated, and take viral supernatants Tet-O-hMash1-IRES-EGFP,
Tet-O-hNgn2-IRES-EGFP, transcription activator rtTA2 infect hiPSCs-TUBB3-mRFP, and differentiation training is changed to after infection
Feeding base be oriented differentiation culture to get.
In the step (1), the pSC linearized vector, TUBB3-5HA-long, TagRFP and TUBB3-3HA-long
For the mixing of equimolar number.
In the step (2), the sequence 1 and sequence 2 are the mixing of equimolar number.
In the step (2), the elevated temperature heating stage is 100 DEG C and heats 5 minutes.
In the step (4), Target vector, oriented carrier pBS-U6-TUBB3-sgRNA and Cas9-
IRES-EGF is the mixing of equimolar number.
In the step (7), the slow virus packaging system includes pVSVG, pRSV-REV, pMDL g/p RRE.
In the step (8), described Tet-O-hMash1-IRES-EGFP, Tet-O-hNgn2-IRES-EGFP and transcription
Sub- rtTA2 is activated to remove infection hiPSCs-TUBB3-mRFP according to value=5 MOI.
In the step (8), the differentiation step is carried out after the infection step 24 hour.
In the step (8), the directed differentiation incubation step is specifically included:
D1-D5: culture medium is the KSR differential medium containing 10 μM of SB431542,100 nM LDN-193189;
D6-D11: culture medium is the KSR/N2 differential medium containing 100nM LDN-193189,3 μM of CHIR99021;
D12-D13: culture medium is to contain 100nM LDN-193189,3 μM of CHIR99021,10ng/ml BDNF, 10ng/
The Neurobasal/B27 differential medium of ml GDNF, 1ng/ml TGF3 and 0.1mMcAMP;
D14-D21: culture medium is to contain 10ng/ml BDNF, 10ng/ml GDNF, 1ng/ml TGF3 and 0.1mMcAMP
Neurobasal/B27 differential medium;
D22-D31: culture medium be containing 10ng/ml BDNF, 10ng/ml GDNF, 0.2mM ascorbic acid and
The Neurobasal/B27 differential medium of 0.1mMcAMP.
Preparation of the present invention can the source tracer iPSCs nerve member in real time method, pass through Crispr/Cas9 gene editing
Technology knocks in reporter gene mRFP in TUBB3 allele, is prepared for expressing reporter gene in the case where TUBB3 promoter controls
HiPSCs cell line;And make TUBB3 coded sequence and mRFP coded sequence by 2A peptide chain link, so that mRFP be made to express
Abundance can be detected in the iPSCs Differentiating Into Neurons initial stage enables the gene expression abundance of mRFP to represent endogenous TUBB3
Expression;Also, the method for the invention, by specific Induction of committed differentiation program, we are hiPSCs-TUBB3-mRFP
It efficiently is divided into neuron, the expression of reporter gene RFP and the degree of fitting of neuronal marker are more than 90%, thus thin for streaming
Born of the same parents' instrument is high-throughput, specificity sorting neuron provides experiment basis, and is further screening drugs for nervous, detection chemical combination
Object/environmental toxin genetic-neural network toxicity provides technology platform.
Detailed description of the invention
In order to make the content of the present invention more clearly understood, it below according to specific embodiments of the present invention and combines
Attached drawing, the present invention is described in further detail, wherein
Fig. 1 is the schematic diagram of present invention building targeting vector pSC-TUBB3-5HA-mRFP-3HA;
Fig. 2 is the schematic diagram of present invention building pCAG-Cas9-IRES-EGFP-bpA expression vector;
Fig. 3 is the schematic diagram of the induction type slow virus carrier of present invention building carrier Mash1cDNA;
Fig. 4 is the schematic diagram of the induction type slow virus carrier of present invention building carrier Ngn2cDNA;
Fig. 5 is hiPSCs of the present invention to neuron directed differentiation schematic diagram;
Fig. 6 is the iPSCs that the present invention is divided into neuron, wherein A: directed differentiation is the hiPSCs of neuron;B: report
Gene RFP dyeing;C: nuclear targeting;D: the overlay chart of figure A, B, C;
Fig. 7 is the expression of different differentiation period RFP.
Specific embodiment
The following preparations as described in the examples of the present invention can the source tracer iPSCs nerve member in real time method, use
Crispr/Cas9 gene editing technology knocks in reporter gene mRFP in TUBB3 allele, make TUBB3 coded sequence with
MRFP coded sequence obtains TUBB3-2A-mRFP sequence by 2A peptide chain link, and is made contains TUBB3-2A-mRFP in turn
The people iPSCs of sequence is denoted as hiPSCs-TUBB3-mRFP;And by Induction of committed differentiation program, by hiPSCs- obtained
TUBB3-mRFP is efficiently divided into neuron.
Embodiment 1
Preparation of the present invention can in real time the source tracer iPSCs nerve member method specifically, the method includes
Following steps:
(1) targeting vector pSC-TUBB3-5HA-mRFP-3HA is constructed
As shown in Figure 1, designing Primer TUBB3-1-short and Primer using the genomic DNA of hiPSCs as template
TUBB3-2 is primer, reacts to obtain DNA fragmentation TUBB3-5HA by PCR;
Primer TUBB3-1-short:ggatgtggtgcggaaggagtg;
Primer TUBB3-2:cttggggccctgggcctccga;
The PCR reaction specifically: 50ul reaction system, primer final concentration 10uM, template quantity: 0.5ug, denaturation temperature 94
DEG C, 2 minutes, recurring number 1;94 DEG C of denaturation temperature for 20 seconds, and 53 DEG C of annealing temperature for 20 seconds, and 72 DEG C of elongating temperature continue
25 seconds;Recurring number is 35;72 DEG C of elongating temperature continue 10 minutes, recurring number 1;
Using TUBB3-5HA as template, design Primer TUBB3-1-longnew and Primer TUBB3-2 is primer, is led to
PCR is crossed to react to obtain the TUBB3-5HA-long for having overlapping DNA fragmentation with carrier sequence;
Primer TUBB3-1-longnew:cgggctgcagcgaccaatgtggggatgtggtgcggaagga gtg;
Primer TUBB3-2:cttggggccctgggcctccga;
The PCR reaction specifically: 50ul reaction system, primer final concentration 10uM, template quantity: 100ng, denaturation temperature 94
DEG C, 2 minutes, recurring number 1;94 DEG C of denaturation temperature for 20 seconds, and 53 DEG C of annealing temperature for 20 seconds, and 72 DEG C of elongating temperature continue
25 seconds;Recurring number is 35;72 DEG C of elongating temperature continue 10 minutes, recurring number 1;
Using the genomic DNA of hiPSCs as template, design Primer TUBB3-5 and Primer TUBB3-6-short is
Primer reacts to obtain DNA fragmentation TUBB3-3HA by PCR;
Primer TUBB3-5:agctgctcgcagctggagtg;
Primer TUBB3-6-short:actgtggagggctgggcagtc;
The PCR reaction specifically: 50ul reaction system, primer final concentration 10uM, template quantity: 0.5ug, denaturation temperature 94
DEG C, 2 minutes, recurring number 1;94 DEG C of denaturation temperature for 20 seconds, and 52 DEG C of annealing temperature for 20 seconds, and 72 DEG C of elongating temperature continue
25 seconds;Recurring number is 35;72 DEG C of elongating temperature continue 10 minutes, recurring number 1;
Using obtained TUBB3-3HA as template, design Primer TUBB3-6-longnew and Primer TUBB3-5 is
Primer, reacting to obtain by PCR has overlapping DNA fragmentation TUBB3-3HA-long with carrier sequence;
Primer TUBB3-6-longnew:gataagcttgatatccactgtggactgtggagggctgggc agtc;
Primer TUBB3-5:agctgctcgcagctggagtg;
The PCR reaction specifically: 550ul reaction system, primer final concentration 10uM, template quantity: 100ng, denaturation temperature
94 DEG C, 2 minutes, recurring number 1;94 DEG C of denaturation temperature for 20 seconds, and 51 DEG C of annealing temperature for 20 seconds, and 72 DEG C of elongating temperature are held
It is 25 seconds continuous;Recurring number is 35;72 DEG C of elongating temperature continue 10 minutes, recurring number 1;
Using mRFP sequence as template, design Primer TUBB3-3 and Primer TUBB3-4 is primer, is reacted by PCR
Obtain having overlapping DNA fragmentation TagRFP with TUBB3-5HA-long;
Primer TUBB3-3:cggaggcccagggccccaagagggcaaagagggccacgaacttctctc tgtta
aagc;
Primer TUBB3-4:cactccagctgcgagcagctctatcaattaagtttgtgccccag;
The PCR reaction specifically: 50ul reaction system, primer final concentration 10uM, template quantity: 100ng, denaturation temperature 94
DEG C, 2 minutes, recurring number 1;94 DEG C of denaturation temperature for 20 seconds, and 55 DEG C of annealing temperature for 20 seconds, and 72 DEG C of elongating temperature continue
25 seconds;Recurring number is 35;72 DEG C of elongating temperature continue 10 minutes, recurring number 1;
Take the pSC linearized vector of purifying, TUBB3-5HA-long, TagRFP and TUBB3-3HA-long segment according to etc.
Molal quantity is mixed, and pSC-TUBB3-5HA-mRFP-3HA targeting vector is prepared by Gibson Cloning Kit,
Nucleotide sequence (wherein underscore is 5HA-mRFP-3HA sequence) as shown in SEQ ID No.1;
(2) sgRNA oriented carrier is constructed
The sequence 1 and sequence 2 of design such as flowering structure, are mixed according to equimolar number, are heated under 100 DEG C of high temperature
5min connect with known carrier pBS-U6-sgRNA carrier after annealing, pBS-U6-TUBB3-sgRNA oriented carrier is prepared,
(TUBB3-sgRNA sequence is shown in underscore to its nucleotide sequence, removes underscore part then as shown in SEQ ID No.2
For pBS-U6-sgRNA carrier sequence);
Sequence 1:CACCGGTACATCTCGCCCTCTTCCT;
Sequence 2:AAACAGGAAG AGGGCGAGAT GTACC;
(3) building carries the Cas9 expression vector of EGFP reporter gene
As shown in Fig. 2, the IRES-EGFP sequence of the nucleotide sequence structure as shown in SEQ ID No.6 is taken to be subcloned into
Know the downstream of the Cas9 segment in carrier pCAG-Cas9-bpA carrier, building obtains pCAG-Cas9-IRES-EGFP-bpA expression
Carrier, (part for removing nucleotide sequence structure shown in SEQ ID No.6 is nucleotide sequence as shown in SEQ ID No.3
For pCAG-Cas9-bpA carrier sequence);
(4) hiPSCs single cell suspension is prepared
Take Target vector, oriented carrier pBS-U6-TUBB3-sgRNA and pCAG-Cas9-IRES-EGFP-bpA by
It is mixed according to equimolar, cotransfection is replaced after transfection 6 hours to hiPSCs under the mediation of lipofectamine 3000
After 48 hours, hiPSCs single cell suspension is prepared in culture medium;
(5) hiPSCs containing EGFP is sorted, the positive hiPSCs clone containing TUBB3-mRFP is expanded
The hiPSCs single cell suspension as made from selected by flow cytometry apoptosis, by the positive hiPSCs cell of EGFP with extremely low
Density is seeded in the 6 orifice plates containing E8 conditioned medium, and 80 single cell clones of picking are to two 96 orifice plates into one after 4-5 days
Step culture, for the cell of one of them 96 orifice plate for extracting genomic DNA, another contains TUBB3-mRFP by PCR identification
Positive hiPSCs clone, be denoted as hiPSCs-TUBB3-mRFP;
(6) preparation carries the Lentiviral of Mash1, Neurogenin2
As shown in Figures 3 and 4, using Chinese human total rna as template, pass through RT-PCR method human cloning its nucleosides of Mash1cDNA(
Acid sequence is as shown in SEQ ID No.7) and its nucleotide sequence of Ngn2cDNA(as shown in SEQ ID No.8), then at sub- gram
On the grand extremely fortimicin induction type Lentiviral containing reporter gene EGFP, be made has SEQ ID No.4 respectively
The carrier Tet-O-hMash1-IRES-EGFP of shown nucleotide sequence and load with nucleotide sequence shown in SEQ ID No.5
Body Tet-O-hNgn2-IRES-EGFP;
(7) slow virus supernatant is prepared
Respectively Tet-O-hMash1-IRES-EGFP, Tet-O-hNgn2-IRES-EGFP expression vector obtained and slowly
Viral Packaging System (the slow virus packaging system includes pVSVG, pRSV-REV, pMDL g/p RRE) mixes,
Transfection is to 293FT cell line under the mediation of lipofectamine2000, after cultivating 6 hours in not antibiotic DMEM more
It is changed to DMEM complete medium, transfection collected viral supernatants Tet-O-hMash1-IRES-EGFP, Tet-O- after 72 hours respectively
HNgn2-IRES-EGFP, and by 3000g centrifugal force remove supernatant in cell residue after, with the membrane filtration of 0.45um
Supernatant finally obtains virion under the centrifugal force effect of 50000g using ultracentrifuge and precipitates, with sterile PBS solution
It is frozen after lytic virus particle precipitating in -80 DEG C of refrigerators, the viral supernatants of concentration infect HEK293 cell by gradient dilution method
System is to measure virus concentration;
(8) hiPSCs-TUBB3-mRFP slow-virus infection
HiPSCs-TUBB3-mRFP with 1.8x105Cell/ml density is inoculated into the coated 6 orifice plates of Matrigel,
Culture medium is the E8 containing Y-27632ROCK inhibitor, is changed within second day normal E8 culture medium;Viral supernatants Tet-
O-hMash1-IRES-EGFP, Tet-O-hNgn2-IRES-EGFP, transcription activator rtTA2 are according to MOI(multiplicity
Of infection, infection multiplicity) value=5 go infection hiPSCs-TUBB3-mRFP, replaced after 24 hours according to step shown in Fig. 5
For the KSR differential medium containing 10 μM of SB431542 and 100 nM LDN-193189, the source iPSCs nerve can be completed
The differentiation of member, the differentiation incubation step are specific as follows:
D1-D5(days): culture medium is that the KSR containing 10 μM of SB431542,100 nM LDN-193189 breaks up culture
Base;
D6-D11: culture medium is the KSR/N2 differential medium containing 100nM LDN-193189,3 μM of CHIR99021;
D12-D13: culture medium is to contain 100nM LDN-193189,3 μM of CHIR99021,10ng/ml BDNF, 10ng/
The Neurobasal/B27 differential medium of ml GDNF, 1ng/ml TGF3 and 0.1mMcAMP;
D14-D21: culture medium is to contain 10ng/ml BDNF, 10ng/ml GDNF, 1ng/ml TGF3 and 0.1mMcAMP
Neurobasal/B27 differential medium;
D22-D31: culture medium be containing 10ng/ml BDNF, 10ng/ml GDNF, 0.2mM ascorbic acid and
The Neurobasal/B27 differential medium of 0.1mMcAMP.
Embodiment 2
Take the 4% PFA(paraformaldehyde of neuron broken up in above-described embodiment 1) it is fixed, it is immunized by standard cell glimmering
RFP/TUBB3 is dyed in light dyeing, is carried out core by DAPI and is redyed to facilitate and count, using high intension Image analysis system
Result is analyzed.As a result as shown in fig. 6, be more than 90% reporter gene hiPSCs(Fig. 6 in B) in differentiated system
Express neuronal marker TUBB3.
Meanwhile the method for the invention also observes the differentiation situation in point differentiation step carries out, and ties
Fruit is as shown in Figure 7: where A figure has weaker mRFP in the expression of living body iPSCs after breaking up 2 days as the result is shown;B figure result is aobvious
The expression of EGFP, prompts exogenous hMash1 and hNgn2 to express after showing differentiation 2 days, and promotes iPSCs to the TUBB3 positive
(mRFP is positive) neuron direction differentiation;C figure has stronger mRFP in the expression of living body iPSCs after breaking up 4 days as the result is shown;D
The expression of EGFP, prompts exogenous hMash1 and hNgn2 high expression, and promote iPSCs table after figure breaks up 4 days as the result is shown
The expression of endogenous TUBB3 is represented up to the expression of stronger neuron marker TUBB3(mRFP).As it can be seen that of the present invention
The source iPSCs nerve member can be effectively made in method, and real-time tracer further can be achieved.
Obviously, the above embodiments are merely examples for clarifying the description, and does not limit the embodiments.It is right
For those of ordinary skill in the art, can also make on the basis of the above description it is other it is various forms of variation or
It changes.There is no necessity and possibility to exhaust all the enbodiments.And it is extended from this it is obvious variation or
It changes still within the protection scope of the invention.