A kind of preparation can the first method of the iPSCs of spike in real time sources nerve
Technical field
The invention belongs to field of biomedicine technology, and in particular to prepared by one kind can the iPSCs of spike in real time sources nerve unit
Method.
Background technology
Embryonic stem cell(Embryonicstemcells, ES cells)It is derived from mammal blastaea inner cell mass
(Innercellmass, ICM)Pluripotent stem cell, with unlimited self-renewing and Multidirectional Differentiation ability.ES cells are in disease
The great application value of aspect such as model foundation and study mechanism, cell therapy, drug discovery and evaluation.However, using mankind's embryo
Tire is related to ethics and immune rejection problems, and scientists were once attempted realizing reprogramming of somatic cells by different approaches thin to obtain ES
Born of the same parents' sample pluripotent stem cell, early stage approach mainly has body-cell neucleus transplanting, cell fusion and cell extract to induce, but also because of face
Limit the research and application of pluripotent stem cell the problems such as facing ethics, immunological rejection, technology, religion and law.And through specific
Transcription factor induction reprogramming of somatic cells overcome above-mentioned obstacle, undoubtedly obtain pluripotent stem cell desirable route it
One.2006, Japanese Yamanaka research groups were by Oct4, Sox2, Klf4 and c-Myc4 gene of retrovirus-mediated method
L cell is transferred to, it is the celliform pluripotent stem cells of ES first directly to reprogram body cell, and is named as and lures
Lead pluripotent stem cell(Inducedpluripotentstemcells, iPSCs), indicate that reprogramming of somatic cells is iPS cells
Technology is born.IPSCs is that one kind has the of self-replication capacity and can be divided into various target function cells under certain condition
Stem cell, be divided into all histiocytic potential in human body because iPSCs possesses, therefore, the use of pluripotent stem cell,
It has been increasingly becoming the new resources that people find beta Cell of islet substitute.So far, the iPS of rat, people, pig, monkey and rabbit is thin
Born of the same parents system has all set up, and confirms that mouse iPS cells have the totipotency of ES cells.IPS cells disease model set up with
Study mechanism, the discovery of medicine and evaluation aspect have been attended by the most momentous results, and are expected to be used for cell therapy.
In view of people iPSCs(hiPSCs)In the huge applications prospect of the aspect such as pathogenic mechanism exploration and regenerative medicine, iPSCs
Inventor wins 2012 annual physiology or the medical science Nobel Prize.And it is research nerve for neuron to induce hiPSCs directed differentiations
First development, the nervous system disease mechanism, screen drugs for nervous, the genetic-neural network toxicity of detection compound/environmental toxin, control
Treat the indispensable technology platform of the nervous system disease.The hiPSCs sources nerve unit for carrying reporter gene be realize it is above-mentioned
The powerful mean of research purpose.But how to stablize and obtain the difficulty that this hiPSCs sources nerve unit is still urgently to be resolved hurrily at present
Topic.
At present, the strategy for preparing reporter gene hiPSCs sources nerve unit mainly includes:(1)Exogenous neuron is opened
Mover control report gene expression, by retrovirus/slow virus carrier random integration in hiPSCs genomes, its shortcoming
It is the randomness due to integration site so that exogenous reporter gene is possible to influence the table of functional gene near integration site
Reach, also cause the repeatable somewhat limited of experiment;(2)With endogenous neural unit promoter by way of homologous recombination
Control report gene expression, but cause the efficiency of homologous recombination very low.Source nerve unit is prepared in the prior art generally
Using there is two ways:(A)Reporter gene is knocked in, is replaced the allele that neuron identifies albumen, this mode
Have the disadvantage to cause neuron to identify expressing quantity reduction so as to influence its normal physiological function;(B)Neuron identify albumen with
Reporter gene forms fusion protein, and the shortcoming of this mode is some functions that neuron may be influenceed to identify albumen, is also had
The inactivation of reporter gene may be caused.
The content of the invention
Therefore, the technical problems to be solved by the invention are to provide one kind prepare can the iPSCs of spike in real time sources nerve
The method of unit.
In order to solve the above technical problems, preparation of the present invention can the iPSCs of spike in real time sources nerves unit method, adopt
During reporter gene mRFP knocked in into TUBB3 allele with Crispr/Cas9 gene editings technology, make TUBB3 coded sequences
Be connected by 2A peptide chains with mRFP coded sequences, obtain TUBB3-2A-mRFP sequences, and and then be obtained contain TUBB3-2A-
The people iPSCs of mRFP sequences is designated as hiPSCs-TUBB3-mRFP;And by Induction of committed differentiation program, by obtained hiPSCs-
TUBB3-mRFP is efficiently divided into neuron, obtains final product.
Specifically, it is described prepare can the first method of the iPSCs of spike in real time sources nerve, comprise the following steps:
(1)Build targeting vector pSC-TUBB3-5HA-mRFP-3HA
As template, design Primer TUBB3-1-short and Primer TUBB3-2 are primer to genomic DNA with hiPSCs,
Reacted by PCR and obtain DNA fragmentation TUBB3-5HA;
Primer TUBB3-1-short:ggatgtggtgcggaaggagtg;
Primer TUBB3-2:cttggggccctgggcctccga;
With TUBB3-5HA as template, design Primer TUBB3-1-longnew and Primer TUBB3-2 are primer, are passed through
PCR reactions obtain the TUBB3-5HA-long for having overlap DNA fragmentation with carrier sequence;
Primer TUBB3-1-longnew:cgggctgcagcgaccaatgtggggatgtggtgcggaaggagtg;
Primer TUBB3-2:cttggggccctgggcctccga;
As template, design Primer TUBB3-5 and Primer TUBB3-6-short are primer to genomic DNA with hiPSCs,
Reacted by PCR and obtain DNA fragmentation TUBB3-3HA;
Primer TUBB3-5:agctgctcgcagctggagtg;
Primer TUBB3-6-short:actgtggagggctgggcagtc;
It is template with the TUBB3-3HA for obtaining, design Primer TUBB3-6-longnew and Primer TUBB3-5 are primer,
Reacted by PCR and obtain having overlap DNA fragmentation TUBB3-3HA-long with carrier sequence;
Primer TUBB3-6-longnew:gataagcttgatatccactgtggactgtggagggctgggcagtc;
Primer TUBB3-5:agctgctcgcagctggagtg;
With mRFP sequences as template, design Primer TUBB3-3 and Primer TUBB3-4 are primer, are reacted by PCR and obtained
There is overlap DNA fragmentation TagRFP with TUBB3-5HA-long;
Primer TUBB3-3:cggaggcccagggccccaagagggcaaagagggccacgaacttctctctgttaaagc;
Primer TUBB3-4:cactccagctgcgagcagctctatcaattaagtttgtgccccag;
Take the pSC linearized vectors of purifying, TUBB3-5HA-long, TagRFP and TUBB3-3HA-long fragment to mix, pass through
Gibson Cloning Kits prepare pSC-TUBB3-5HA-mRFP-3HA targeting vectors, its nucleotide sequence such as SEQ ID
Shown in No.1;
(2)Build sgRNA oriented carriers
The sequence 1 and sequence 2 for designing following structure are mixed, and high-temperature heating is connected after annealing with pBS-U6-sgRNA carriers, are prepared
PBS-U6-TUBB3-sgRNA oriented carriers are obtained, its nucleotide sequence is as shown in SEQ ID No.2;
Sequence 1:CACCGGTACATCTCGCCCTCTTCCT;
Sequence 2:AAACAGGAAG AGGGCGAGAT GTACC;
(3)Build the Cas9 expression vectors for carrying EGFP reporter genes
The IRES-EGFP sequences for taking the nucleotide sequence structure as shown in SEQ ID No.6 are subcloned into pCAG-Cas9-bpA carriers
In Cas9 fragments downstream, structure obtain pCAG-Cas9-IRES-EGFP-bpA expression vectors, its nucleotide sequence such as SEQ
Shown in ID No.3;
(4)Prepare hiPSCs single cell suspensions
Target vector, oriented carrier pBS-U6-TUBB3-sgRNA and pCAG-Cas9-IRES-EGFP-bpA is taken to mix,
Cotransfection prepares hiPSCs single cell suspensions to hiPSCs under the mediation of lipofectamine 3000;
(5)Expand the positive hiPSCs clones containing TUBB3-mRFP
The obtained hiPSCs single cell suspensions of sorting, the positive hiPSCs cells of EGFP are seeded in extra-low density and contain E8 bars
Part culture medium orifice plate, and picking single cell clone further cultivates, and obtains the positive hiPSCs clones containing TUBB3-mRFP, note
It is hiPSCs-TUBB3-mRFP;
(6)Prepare the Lentiviral for carrying Mash1, Neurogenin2
With Chinese human total rna as template, by RT-PCR method human cloning Mash1cDNA and Ngn2cDNA, then in subclone
On to the fortimicin induction type Lentiviral containing reporter gene EGFP, be obtained has SEQ ID No.4 institutes respectively
Show the carrier Tet-O-hMash1-IRES-EGFP and the carrier with nucleotide sequence shown in SEQ ID No.5 of nucleotide sequence
Tet-O-hNgn2-IRES-EGFP;
(7)Prepare slow virus supernatant
Respectively Tet-O-hMash1-IRES-EGFP, Tet-O-hNgn2-IRES-EGFP expression vector and slow virus packaging system
System is mixed, and is transfected under the mediation of lipofectamine2000 to 293FT cell lines, and viral supernatants Tet-O- is obtained respectively
hMash1-IRES-EGFP、Tet-O-hNgn2-IRES-EGFP;
(8)HiPSCs-TUBB3-mRFP slow-virus infections
Obtained hiPSCs-TUBB3-mRFP is cultivated, and is taken viral supernatants Tet-O-hMash1-IRES-EGFP, Tet-
O-hNgn2-IRES-EGFP, transcription activator rtTA2 infect hiPSCs-TUBB3-mRFP, and differential medium is replaced by after infection
Differentiation culture is oriented, is obtained final product.
The step(1)In, the pSC linearized vectors, TUBB3-5HA-long, TagRFP and TUBB3-3HA-long
For equimolar number mixes.
The step(2)In, the sequence 1 and sequence 2 are the mixing of equimolar number.
The step(2)In, the elevated temperature heating stage is 100 DEG C and heats 5 minutes.
The step(4)In, the Target vector, oriented carrier pBS-U6-TUBB3-sgRNA and Cas9-
IRES-EGF mixes for equimolar number.
The step(7)In, the slow virus packaging system includes pVSVG, pRSV-REV, pMDL g/p RRE.
The step(8)In, described Tet-O-hMash1-IRES-EGFP, Tet-O-hNgn2-IRES-EGFP and transcription
Sub- rtTA2 is activated to go to infect hiPSCs-TUBB3-mRFP according to MOI value=5.
The step(8)In, the differentiation step is carried out after the infection step 24 hour.
The step(8)In, the directed differentiation incubation step is specifically included:
D1-D5:Culture medium is the KSR differential mediums containing 10 μM of SB431542,100 nM LDN-193189;
D6-D11:Culture medium is the KSR/N2 differential mediums containing 100nM LDN-193189,3 μM of CHIR99021;
D12-D13:Culture medium is to contain 100nM LDN-193189,3 μM of CHIR99021,10ng/ml BDNF, 10ng/ml
The Neurobasal/B27 differential mediums of GDNF, 1ng/ml TGF3 and 0.1mMcAMP;
D14-D21:Culture medium is to contain 10ng/ml BDNF, 10ng/ml GDNF, 1ng/ml TGF3 and 0.1mMcAMP
Neurobasal/B27 differential mediums;
D22-D31:Culture medium be containing 10ng/ml BDNF, 10ng/ml GDNF, 0.2mM ascorbic acid and
The Neurobasal/B27 differential mediums of 0.1mMcAMP.
Preparation of the present invention can the iPSCs of spike in real time sources nerves unit method, by Crispr/Cas9 gene editings
Technology is knocked in reporter gene mRFP in TUBB3 allele, is prepared for expressing reporter gene in the case where TUBB3 promoters are controlled
HiPSCs cell lines;And cause that TUBB3 coded sequences are connected with mRFP coded sequences by 2A peptide chains, so that mRFP is expressed
Abundance can just be detected in the iPSCs Differentiating Into Neurons starting stages enables the gene expression abundance of mRFP to represent endogenous TUBB3
Expression;Also, the method for the invention, by specific Induction of committed differentiation program, we are hiPSCs-TUBB3-mRFP
Efficiently be divided into neuron, the expression of reporter gene RFP with the degree of fitting of neuronal marker more than 90% so that for streaming is thin
Born of the same parents' instrument high flux, specificity sorting neuron provide experiment basis, and are further screening drugs for nervous, detection chemical combination
The genetic-neural network toxicity of thing/environmental toxin provides technology platform.
Brief description of the drawings
In order that present disclosure is more likely to be clearly understood, below according to specific embodiment of the invention and combine
Accompanying drawing, the present invention is further detailed explanation, wherein
Fig. 1 is the schematic diagram that the present invention builds targeting vector pSC-TUBB3-5HA-mRFP-3HA;
Fig. 2 is the schematic diagram that the present invention builds pCAG-Cas9-IRES-EGFP-bpA expression vectors;
Fig. 3 is the schematic diagram of the induction type slow virus carrier that the present invention builds carrier Mash1cDNA;
Fig. 4 is the schematic diagram of the induction type slow virus carrier that the present invention builds carrier Ngn2cDNA;
Fig. 5 is hiPSCs of the present invention to neuron directed differentiation schematic diagram;
Fig. 6 is the iPSCs that the present invention is divided into neuron, wherein, A:Directed differentiation is the hiPSCs of neuron;B:Reporter gene
RFP is dyeed;C:Nuclear targeting;D:Scheme the overlay chart of A, B, C;
Fig. 7 is the expression in different differentiation periods RFP.
Specific embodiment
Preparing described in the following embodiments of the present invention can the first method of the iPSCs of spike in real time sources nerve, use
Crispr/Cas9 gene editings technology is knocked in reporter gene mRFP in TUBB3 allele, make TUBB3 coded sequences with
MRFP coded sequences are connected by 2A peptide chains, obtain TUBB3-2A-mRFP sequences, and and then be obtained contain TUBB3-2A-mRFP
The people iPSCs of sequence is designated as hiPSCs-TUBB3-mRFP;And by Induction of committed differentiation program, by obtained hiPSCs-
TUBB3-mRFP is efficiently divided into neuron.
Embodiment 1
Preparation of the present invention can the iPSCs of spike in real time sources nerves unit method specifically, methods described includes as follows
Step:
(1)Build targeting vector pSC-TUBB3-5HA-mRFP-3HA
As shown in figure 1, with the genomic DNA of hiPSCs as template, designing Primer TUBB3-1-short and Primer
TUBB3-2 is primer, is reacted by PCR and obtains DNA fragmentation TUBB3-5HA;
Primer TUBB3-1-short:ggatgtggtgcggaaggagtg;
Primer TUBB3-2:cttggggccctgggcctccga;
The PCR reactions are specially:50ul reaction systems, primer final concentration 10uM, template amount:0.5ug, 94 DEG C of denaturation temperature, 2
Minute, period is 1;94 DEG C of denaturation temperature continues 20 seconds, and 53 DEG C of annealing temperature continues 20 seconds, and 72 DEG C of elongating temperature continues 25
Second;Period is 35;72 DEG C of elongating temperature continues 10 minutes, and period is 1;
With TUBB3-5HA as template, design Primer TUBB3-1-longnew and Primer TUBB3-2 are primer, are passed through
PCR reactions obtain the TUBB3-5HA-long for having overlap DNA fragmentation with carrier sequence;
Primer TUBB3-1-longnew:cgggctgcagcgaccaatgtggggatgtggtgcggaaggagtg;
Primer TUBB3-2:cttggggccctgggcctccga;
The PCR reactions are specially:50ul reaction systems, primer final concentration 10uM, template amount:100ng, 94 DEG C of denaturation temperature, 2
Minute, period is 1;94 DEG C of denaturation temperature continues 20 seconds, and 53 DEG C of annealing temperature continues 20 seconds, and 72 DEG C of elongating temperature continues 25
Second;Period is 35;72 DEG C of elongating temperature continues 10 minutes, and period is 1;
As template, design Primer TUBB3-5 and Primer TUBB3-6-short are primer to genomic DNA with hiPSCs,
Reacted by PCR and obtain DNA fragmentation TUBB3-3HA;
Primer TUBB3-5:agctgctcgcagctggagtg;
Primer TUBB3-6-short:actgtggagggctgggcagtc;
The PCR reactions are specially:50ul reaction systems, primer final concentration 10uM, template amount:0.5ug, 94 DEG C of denaturation temperature, 2
Minute, period is 1;94 DEG C of denaturation temperature continues 20 seconds, and 52 DEG C of annealing temperature continues 20 seconds, and 72 DEG C of elongating temperature continues 25
Second;Period is 35;72 DEG C of elongating temperature continues 10 minutes, and period is 1;
It is template with the TUBB3-3HA for obtaining, design Primer TUBB3-6-longnew and Primer TUBB3-5 are primer,
Reacted by PCR and obtain having overlap DNA fragmentation TUBB3-3HA-long with carrier sequence;
Primer TUBB3-6-longnew:gataagcttgatatccactgtggactgtggagggctgggcagtc;
Primer TUBB3-5:agctgctcgcagctggagtg;
The PCR reactions are specially:550ul reaction systems, primer final concentration 10uM, template amount:100ng, 94 DEG C of denaturation temperature,
2 minutes, period was 1;94 DEG C of denaturation temperature continues 20 seconds, and 51 DEG C of annealing temperature continues 20 seconds, and 72 DEG C of elongating temperature continues 25
Second;Period is 35;72 DEG C of elongating temperature continues 10 minutes, and period is 1;
With mRFP sequences as template, design Primer TUBB3-3 and Primer TUBB3-4 are primer, are reacted by PCR and obtained
There is overlap DNA fragmentation TagRFP with TUBB3-5HA-long;
Primer TUBB3-3:cggaggcccagggccccaagagggcaaagagggccacgaacttctctctgttaaagc;
Primer TUBB3-4:cactccagctgcgagcagctctatcaattaagtttgtgccccag;
The PCR reactions are specially:50ul reaction systems, primer final concentration 10uM, template amount:100ng, 94 DEG C of denaturation temperature, 2
Minute, period is 1;94 DEG C of denaturation temperature continues 20 seconds, and 55 DEG C of annealing temperature continues 20 seconds, and 72 DEG C of elongating temperature continues 25
Second;Period is 35;72 DEG C of elongating temperature continues 10 minutes, and period is 1;
PSC linearized vectors, TUBB3-5HA-long, TagRFP and TUBB3-3HA-long fragment of purifying are taken according to equimolar
Number is mixed, and prepares pSC-TUBB3-5HA-mRFP-3HA targeting vectors by Gibson Cloning Kits, its nucleosides
Acid sequence is as shown in SEQ ID No.1(Wherein underscore is 5HA-mRFP-3HA sequences);
(2)Build sgRNA oriented carriers
The sequence 1 and sequence 2 of following structure are designed, is mixed according to equimolar number, in 5min is heated under 100 DEG C of high temperature, moved back
It is connected with known carrier pBS-U6-sgRNA carriers after fire, prepares pBS-U6-TUBB3-sgRNA oriented carriers, its nucleosides
Acid sequence is as shown in SEQ ID No.2(Underscore is shown TUBB3-sgRNA sequences, and it is then pBS- to remove underscore part
U6-sgRNA carrier sequences);
Sequence 1:CACCGGTACATCTCGCCCTCTTCCT;
Sequence 2:AAACAGGAAG AGGGCGAGAT GTACC;
(3)Build the Cas9 expression vectors for carrying EGFP reporter genes
As shown in Fig. 2 the IRES-EGFP sequences for taking the nucleotide sequence structure as shown in SEQ ID No.6 are subcloned into known load
The downstream of the Cas9 fragments in body pCAG-Cas9-bpA carriers, structure obtains pCAG-Cas9-IRES-EGFP-bpA expression and carries
Body, its nucleotide sequence is as shown in SEQ ID No.3(The part for removing nucleotide sequence structure shown in SEQ ID No.6 is
PCAG-Cas9-bpA carrier sequences);
(4)Prepare hiPSCs single cell suspensions
Take Target vector, oriented carrier pBS-U6-TUBB3-sgRNA and pCAG-Cas9-IRES-EGFP-bpA according to etc.
Mole mixed, cotransfection after transfection 6 hours, changes culture to hiPSCs under the mediation of lipofectamine 3000
Base, after 48 hours, prepares hiPSCs single cell suspensions;
(5)HiPSCs of the sorting containing EGFP, expands the positive hiPSCs clones containing TUBB3-mRFP
By hiPSCs single cell suspensions obtained in selected by flow cytometry apoptosis, by the positive hiPSCs cells of EGFP with extra-low density
It is seeded in 6 orifice plates containing E8 conditioned mediums, 80 single cell clones of picking to two 96 orifice plates are further trained after 4-5 days
Support, the cell of one of them 96 orifice plate is used to extract genomic DNA, and another identifies the sun containing TUBB3-mRFP by PCR
Property hiPSCs clone, be designated as hiPSCs-TUBB3-mRFP;
(6)Prepare the Lentiviral for carrying Mash1, Neurogenin2
As shown in Figures 3 and 4, with Chinese human total rna as template, cloned people Mash1cDNA by RT-PCR method(Its nucleotides sequence
Row are as shown in SEQ ID No.7)And Ngn2cDNA(Its nucleotide sequence is as shown in SEQ ID No.8), then in subclone extremely
On fortimicin induction type Lentiviral containing reporter gene EGFP, be obtained has shown in SEQ ID No.4 respectively
The carrier Tet-O-hMash1-IRES-EGFP of nucleotide sequence and the carrier with nucleotide sequence shown in SEQ ID No.5
Tet-O-hNgn2-IRES-EGFP;
(7)Prepare slow virus supernatant
Respectively obtained Tet-O-hMash1-IRES-EGFP, Tet-O-hNgn2-IRES-EGFP expression vector and slow virus
Packaging system(The slow virus packaging system includes pVSVG, pRSV-REV, pMDL g/p RRE)Mix,
Transfected under the mediation of lipofectamine2000 to 293FT cell lines, after being cultivated 6 hours in the DMEM without antibiotic more
DMEM complete mediums are changed to, transfection collects viral supernatants Tet-O-hMash1-IRES-EGFP, Tet-O- respectively after 72 hours
HNgn2-IRES-EGFP, and by after the cell residue during 3000g centrifugal force removes supernatant, with the membrane filtration of 0.45um
Supernatant, finally obtains virion under the centrifugal action of 50000g and precipitates using ultracentrifuge, uses aseptic PBS solution
Frozen in -80 DEG C of refrigerators after lytic virus particle precipitation, the viral supernatants of concentration infect HEK293 cells by gradient dilution method
It is to determine virus concentration;
(8)HiPSCs-TUBB3-mRFP slow-virus infections
HiPSCs-TUBB3-mRFP with 1.8x105The density of cell/ml is inoculated into coated 6 orifice plates of Matrigel, culture
Base is the E8 containing Y-27632ROCK inhibitor, is replaced by within second day normal E8 culture mediums;Viral supernatants Tet-O-
HMash1-IRES-EGFP, Tet-O-hNgn2-IRES-EGFP, transcription activator rtTA2 are according to MOI(multiplicity of
Infection, infection multiplicity)Value=5 are gone to infect hiPSCs-TUBB3-mRFP, are replaced by according to step shown in Fig. 5 after 24 hours
KSR differential mediums containing 10 μM of SB431542 and 100 nM LDN-193189, you can complete iPSCs sources nerve unit
Differentiation, the differentiation incubation step is specific as follows:
D1-D5(My god):Culture medium is the KSR differential mediums containing 10 μM of SB431542,100 nM LDN-193189;
D6-D11:Culture medium is the KSR/N2 differential mediums containing 100nM LDN-193189,3 μM of CHIR99021;
D12-D13:Culture medium is to contain 100nM LDN-193189,3 μM of CHIR99021,10ng/ml BDNF, 10ng/ml
The Neurobasal/B27 differential mediums of GDNF, 1ng/ml TGF3 and 0.1mMcAMP;
D14-D21:Culture medium is to contain 10ng/ml BDNF, 10ng/ml GDNF, 1ng/ml TGF3 and 0.1mMcAMP
Neurobasal/B27 differential mediums;
D22-D31:Culture medium be containing 10ng/ml BDNF, 10ng/ml GDNF, 0.2mM ascorbic acid and
The Neurobasal/B27 differential mediums of 0.1mMcAMP.
Embodiment 2
Take 4% PFA of neuron broken up in above-described embodiment 1(Paraformaldehyde)It is fixed, contaminated by standard cell lines immunofluorescence
Color is dyeed to RFP/TUBB3, and carrying out core by DAPI redyes to facilitate counting, using intension Image analysis system high to knot
Fruit is analyzed.Result is as shown in fig. 6, reporter gene hiPSCs more than 90%(B in Fig. 6)Expressed in differentiated system
Neuronal marker TUBB3.
Meanwhile, the method for the invention is also observed the differentiation situation in point differentiation step is carried out, and is tied
Fruit is as shown in Figure 7:Wherein, A figures result display differentiation has expression of the weaker mRFP in live body iPSCs after 2 days;B figures result shows
Show the expression of EGFP after breaking up 2 days, point out exogenous hMash1 and hNgn2 to express, and promote iPSCs positive to TUBB3
(MRFP is positive)Neuron direction breaks up;C figures result display differentiation has expression of the stronger mRFP in live body iPSCs after 4 days;D
Figure result shows the expression of EGFP after breaking up 4 days, points out exogenous hMash1 and hNgn2 expression high, and promote iPSCs tables
Up to stronger neuron marker TUBB3(The expression of mRFP represents the expression of endogenous TUBB3).It can be seen that, it is of the present invention
Method can effectively be obtained iPSCs sources nerve unit, and further be capable of achieving real-time spike.
Obviously, above-described embodiment is only intended to clearly illustrate example, and not to the restriction of implementation method.It is right
For those of ordinary skill in the art, can also make on the basis of the above description other multi-forms change or
Change.There is no need and unable to be exhaustive to all of implementation method.And the obvious change thus extended out or
Among changing still in the protection domain of the invention.