CN109097400A - Method based on chromatin remodeling activation endogenous Pdx1 gene expression - Google Patents
Method based on chromatin remodeling activation endogenous Pdx1 gene expression Download PDFInfo
- Publication number
- CN109097400A CN109097400A CN201810947480.0A CN201810947480A CN109097400A CN 109097400 A CN109097400 A CN 109097400A CN 201810947480 A CN201810947480 A CN 201810947480A CN 109097400 A CN109097400 A CN 109097400A
- Authority
- CN
- China
- Prior art keywords
- cell
- sgrna
- carrier
- gene expression
- pdx1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0676—Pancreatic cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/45—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the methods based on chromatin remodeling activation endogenous Pdx1 gene expression.The present invention provides a kind of methods of endogenous Pdx1 gene expression in activation target cell, are the methods that the SAM system based on CRISPR-on establishes endogenous Pdx1 gene expression in activation target cell.The SAM system includes the sgRNA for targeting -400 to+1bp position of Pdx1 gene transcription start site upstream, and the target sequence of the sgRNA is SEQ ID No.3 and/or SEQ ID No.4.Present invention application CRISPR-on technology can efficiently activate the Pdx1 of 293T cell to express by chromatin remodeling.This research will play a significant role gene induction PSCs directed differentiation for the embryonic development research of β cell and pancreas.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to based on chromatin remodeling activation endogenous Pdx1 gene expression
Method.
Background technique
The disease incidence of diabetes dramatically increases year by year.WHO report is shown within 2017, at present the morbidity of whole world diabetes
Rate is about 8.5%, about 4.22 hundred million diabetics.Type 1 diabetes are to be attacked due to beta Cell of islet by autoimmune response
Caused by hitting.When the beta Cell of islet quantity of remaining will show clinical symptoms less than the 10-20% of islet cells sum
[Gillespie,K.M.Type 1diabetes:pathogenesis and prevention.CMAJ 175,165-170,
doi:10.1503/cmaj.060244(2006).].Diabetes B is since ability of cell proliferation decline and Apoptosis increase
And cause β cell function abnormal and the reduction of progressive cell quantity [Joost, H.G.Pathogenesis, risk
assessment and prevention of type 2diabetes mellitus.Obes Facts 1,128-137,
doi:10.1159/000137673(2008).].Currently, beta Cell of islet transplanting is considered as that diabetes are most effective does for treatment
One of method.However, the application of extensive beta Cell of islet transplanting is but by cell origin shortage and throughout one's life using immunosuppressor etc.
Limit [Atkinson, M.A.&Eisenbarth, G.S.Type 1diabetes:new perspectives on disease
pathogenesis and treatment.Lancet 358,221-229,doi:10.1016/S0140-6736(01)
05415-0(2001).].Multipotential stem cell (pluripotent stem cells, PSCs) includes embryonic stem cell
(embryonic stem cells, ESCs) and induce multi-potent stem cell (induced pluripotent stem cells,
IPSCs), there is self-renewing and multi-lineage potential.Therefore, the ideal cell that PSCs becomes the cell therapy of diabetes comes
Source.In recent years, PSCs directed differentiation is that the research of beta Cell of islet and non-beta Cell of islet transdifferentiation makes great progress
[Miyazaki,S.,Yamato,E.&Miyazaki,J.Regulated expression of pdx-1promotes in
vitro differentiation of insulin-producing cells from embryonic stem
cells.Diabetes 53,1030-1037(2004).].Cell differentiation inducing activity is the method master of insulin secretory cell at present
It to include two classes: first is that idiosyncratic transcription factor method occurs using regulation beta Cell of islet；Another is growth factor and small molecule
Close object combined method.Gene abductive approach is mainly the transcription factors critical inducing cell point used in islet cells generating process
Change and transdifferentiation.Miyazaki etc. constructs the ES cell line of inducing expression Pdx1 using Tet off system, as the result is shown Pdx1
It can be improved growth factor and small molecule compound method induction efficiency of the ESCs to β cell differentiation, enhance noble cells dependency basis
The expression of cause, such as insulin 2, somatostatin, Kir6.2, glucokinase, neurogenin3, p48, Pax6, PC2
With HNF6 [Miyazaki, S., Yamato, E.&Miyazaki, J.Regulated expression of pdx-1promotes
in vitro differentiation of insulin-producing cells from embryonic stem
cells.Diabetes 53,1030-1037(2004).].The result of study of Kubo etc. shows that overexpression Pdx1 and Ngn3 can
Significant up-regulation endoderm cell expresses insulin and islet related gene [Kubo, A.et al.Pdx1and Ngn3
overexpression enhances pancreatic differentiation of mouse ES cell-derived
endoderm population.PLoS One 6,e24058,doi:10.1371/journal.pone.0024058
(2011).].The adenovirus infection application on human skin horn cell of Pdx1 is expressed, it can the relevant specificity turn of acute activation pancreas generation
The factor is recorded, cell is induced to differentiate into insulin secretory cell.These transdifferentiated cells glucose stimulation under have synthesis and
Function [Mauda-Havakuk, M.et al.Ectopic the PDX-1expression directly of excreting insulin
reprograms human keratinocytes along pancreatic insulin-producing cells
fate.PLoS One 6,e26298,doi:10.1371/journal.pone.0026298(2011).].The discovery such as Zhou
Pars exocrina pancreatis cell transformation can be beta Cell of islet in Mice Body by Pdx1, Ngn3 and MafA.These conversion cells with
Endogenic beta Cell of islet is closely similar, express islet beta cell function related gene, can excreting insulin, reduce mouse
Blood glucose [Zhou, Q., Brown, J., Kanarek, A., Rajagopal, J.&Melton, D.A.In vivo
reprogramming of adult pancreatic exocrine cells to beta-cells.Nature 455,
627-632,doi:10.1038/nature07314(2008).].Akinci etc. uses same method, observes external
The transdifferentiation of Pdx1, Ngn3 and MafA to pancreas in rat exocrine cell system AR42j-B13.Although transdifferentiation is obtained
Cell expresses insulin reduces the blood glucose level of diabetic mice；But Pdx1, Ngn3 and the MafA of endogenous cellular are not swashed
It is living, and the relevant some genes of islet beta cell function are not expressed.Therefore, the transdifferentiation of these cells is incomplete
[Akinci,E.,Banga,A.,Greder,L.V.,Dutton,J.R.&Slack,J.M.Reprogramming of
pancreatic exocrine cells towards a beta(beta)cell character using Pdx1,
Ngn3and MafA.Biochem J442,539-550,doi:10.1042/BJ20111678(2012).].Gene induction differentiation
Method there is high specificity, operation is relatively easy, and cost is relatively low.However, the method that foreign gene is overexpressed at present is difficult to swash
The expression of endogenous related gene living, therefore, the cell of differentiation do not have mature physiological function.Each pedigree in embryonic development
Cell differentiation is finally to be divided into the terminally differentiated cells of each germinal layer by lineagespecific transcription factor accuracy controlling.It is same with this
When, the activation of various transcription factors is controlled by the various regulatory mechanisms of epigenetics in cell differentiation procedure.Epigenetic
Factor and the mutually coordinated effect of various transcription factors form the microenvironment for being suitable for particular lineage differentiation, can just be effectively ensured
The normal differentiation of the various cells of body.During important function of the epigenetics in cell function can be reprogrammed from cell
To evidence.It is reprogrammed by fibroblast to the process of iPSCs, a key factor for influencing reprogramming efficiency is exactly apparent loses
It passes and learns obstacle.The studies have shown that dnmt rna and histon deacetylase (HDAC) inhibitor of Huangfu etc. can be mentioned significantly
The efficiency of high cell reprogramming.Especially histon deacetylase (HDAC) inhibitor valproic acid (VPA) can will be reprogrammed
Efficiency improves 100 times of [Huangfu, D.et al.Induction of pluripotent stem cells by defined
factors is greatly improved by small-molecule compounds.Nat Biotechnol26,795-
797,doi:10.1038/nbt1418(2008).].In the recent period, Ding group passes through CRISPR (clustered regularly
Interspaced short palindromic repeats) technology resetting the site chromatin Oct4 and Sox2 epigenetic
State, activate endogenous Oct4 and Sox2 expression, successfully reprogram fibroblast to iPSCs [Liu, P., Chen, M.,
Liu,Y.,Qi,L.S.&Ding,S.CRISPR-Based Chromatin Remodeling of the Endogenous
Oct4 or Sox2 Locus Enables Reprogramming to Pluripotency.Cell Stem Cell 22,
252-261e254, doi:10.1016/j.stem.2017.12.001 (2018)], this shows further epigenetic thin
Important function in born of the same parents' function.
Pdx1 is a kind of homologous structure domain transcription factor, in body early embryo pancreas development, the formation of endocrine cell and after
Plays a significant role [Pan, F.C.&Wright, C.Pancreas organogenesis:from bud in phase β cell maturation
to plexus to gland.Dev Dyn 240,530-565,doi:10.1002/dvdy.22584(2011).].Mouse
Pdx1 is expressed earliest in embryo 8.5 days (E8.5) [Miki, R.et al.Fate maps of ventral and dorsal
pancreatic progenitor cells in early somite stage mouse embryos.Mech Dev 128,
597-609, doi:10.1016/j.mod.2011.12.004 (2012)], people Pdx1 is expressed earliest at pregnant 4 weeks (G4w)
[Jennings,R.E.et al.Development of the human pancreas from foregut to
endocrine commitment.Diabetes62,3514-3522,doi:10.2337/db12-1479(2013).].Grinding tooth
The body early embryo pancreas development of class needs the expression of Pdx1, and Pdx1 deficient mice cannot form pancreas, will in several days after birth
Death [Jonsson, J., Carlsson, L., Edlund, T.&Edlund, H.Insulin-promoter-factor 1is
required for pancreas development in mice.Nature 371,606-609,doi:10.1038/
371606a0(1994).].There is still a need for the continuous expressions of Pdx1 for the development of each pedigree of subsequent pancreas.In the shape of endocrine cell
Cheng Zhong, height expression Pdx1 play a significant role [Pan, F.C.&Wright, C.Pancreas in the directed differentiation of cell
organogenesis:from bud to plexus to gland.Dev Dyn 240,530-565,doi:10.1002/
dvdy.22584(2011).].When adult, Pdx1 is only expressed in the β and delta cell of pancreas islet, related by adjusting glucose homeostasis
Gene maintain β cell feature and function [Gao, T.et al.Pdx1maintains beta cell identity and
function by repressing an alpha cell program.Cell Metab 19,259-271,doi:
10.1016/j.cmet.2013.12.002(2014).].In conclusion Pdx1 is in embryonic pancreatic development and external evoked cell
Directed differentiation is to play a significant role in β cell.Therefore, external efficient endogenous Pdx1 Activiation method is established, gene is lured
PSCs directed differentiation is led to play a significant role for the embryonic development research of β cell and pancreas.
CRISPR technology is after Zinc finger nuclease (ZFN, zinc finger nulceases) and TALENs
Another powerful genome is compiled after (transcription activator-like effector nucleases)
The technology of collecting.The CRISPR/Cas9 of engineering is made of sgRNA (tracrRNA:crRNA) and Cas9.There are two function for Cas9 tool
Energy structural domain HNH and RuvC, have endonuclease activity.Two structural domains of simultaneous mutation (H840A and D10A mutation), Cas9
Lose endonuclease activity (deactivated Cas9, dCas9), be transformed into sgRNA guiding DNA binding protein [Doudna,
J.A.&Charpentier,E.Genome editing.The new frontier of genome engineering with
CRISPR-Cas9.Science 346,1258096,doi:10.1126/science.1258096(2014).].By dCas9 with
Activating transcription factor fusion combines the promoter region in gene under sgRNA guidance, so that it may strength activation endogenous gene
Expression, effectively overcomes deficiency [Konermann, S.et that endogenous gene in Primary structure is difficult to activate
al.Genome-scale transcriptional activation by an engineered CRISPR-Cas9
complex.Nature 517,583-588,doi:10.1038/nature14136(2015).]。
Summary of the invention
For effective solution above-mentioned technical problem, the object of the present invention is to provide one kind based in chromatin remodeling activation
The method of source property Pdx1 gene expression.The present invention applies SAM (the synergistic activation based on CRISPR-on
Mediator) system establishes efficient endogenous Pdx1 Activiation method.SAM system is made of three parts, sgRNA, NLS-
DCas9-VP64 and MS2-P65-HSF1.When SAM system is expressed in the cell, three components form transcription activation complex,
It is incorporated in the specific promoter region of sgRNA targeting, the expression of activated gene.
In a first aspect, a kind of claimed method for activating endogenous Pdx1 gene expression in target cell.
The method of endogenous Pdx1 gene expression, is based on CRISPR-on in activation target cell provided by the present invention
The method that the SAM system of (CRISPR activation) establishes endogenous Pdx1 gene expression in activation target cell.
Further, the SAM system includes targeting Pdx1 gene transcription start site (transcription start
Site, TSS) upstream -400 to the position+1bp sgRNA, the target sequence of the sgRNA is SEQ ID No.3 (the corresponding present invention
SgRNA3 in embodiment) and/or SEQ ID No.4 (sgRNA4 in the corresponding embodiment of the present invention).
Further, the method may include following steps: make target cell expression dCAS-VP64 fusion protein,
MS2-P65-HSF1 fusion protein and the sgRNA (dCAS-VP64 fusion protein, MS2-P65-HSF1 fusion protein and described
SgRNA forms SAM complex), to activate endogenous Pdx1 gene expression in the target cell.
More specifically, the method may include following steps:
(1) packaging can express the recombinant slow virus A of the dCAS-VP64 fusion protein；Packaging can be expressed described
The recombinant slow virus B of MS2-P65-HSF1 fusion protein；Then together by the recombinant slow virus A and the recombinant slow virus B
The target cell is infected, positive cell line is obtained；
(2) carrier that can express the sgRNA is imported into positive cell line obtained by step (1), and then realizes activation
Endogenous Pdx1 gene expression in the target cell.
In step (1), when packing the recombinant slow virus A, the purpose plasmid used can be lenti dCAS-VP64_
Blast carrier；When packing the recombinant slow virus B, the purpose plasmid used can be MS2-P65-HSF1_Hygro carrier.Packaging
When the recombinant slow virus A and recombinant slow virus B, the helper plasmid used can be PMD2.G plasmid and PsPax2 matter
Grain；The incasing cells used can be 293T cell.
In step (2), the carrier that can express the sgRNA is carrier A and/or carrier B.The carrier A is specially will
DNA fragmentation shown in SEQ ID No.3 is inserted into lenti sgRNA (MS2) _ zeo backbone by BsmB I restriction enzyme site
The recombinant vector obtained afterwards.The carrier B is specially will be by BsmB I restriction enzyme site to lenti sgRNA (MS2) _ zeo
The recombinant vector obtained after DNA fragmentation shown in SEQ ID No.4 is inserted into backbone.
In specific embodiments of the present invention mode, the carrier that can express the sgRNA is the carrier A and the load
The quality proportioning of body B, the carrier A and the carrier B be 1:1 (such as two kinds of carriers respectively import 0.8 μ g into the target cell,
The target cell is inoculated in the previous day, and inoculum concentration is 3 × 105)。
In specific embodiments of the present invention mode, described method includes following steps: (1) by lenti dCAS-VP64_
Blast carrier, that PMD2.G plasmid and PsPax2 plasmid (quality proportioning of three concretely 1:0.25:0.75) import 293T is thin
Born of the same parents are packaged to be the recombinant slow virus A；By MS2-P65-HSF1_Hygro carrier, PMD2.G plasmid and PsPax2 plasmid (three
The quality proportioning of person concretely 1:0.25:0.75) 293T cell is imported, it is packaged to be the recombinant slow virus B；Then by institute
It states recombinant slow virus A and the recombinant slow virus B infects the target cell together, obtain positive cell line.(2) to step (1)
The carrier A and the carrier B (quality proportioning 1:1, further, as two kinds of carriers are respectively led are imported in gained positive cell line
Enter 0.8 μ g, the target cell is inoculated in the previous day, and inoculum concentration is 3 × 105), and then realize and activate endogenous in the target cell
Pdx1 gene expression.
In specific embodiments of the present invention mode, the target cell is specially 293T cell.Certainly as needed, described
Target cell can also be multipotential stem cell (pluripotent stem cells, PSCs), such as embryonic stem cell (embryonic
Stem cells, ESCs) or induce multi-potent stem cell (induced pluripotent stem cells, iPSCs).
Second aspect, a kind of claimed method for preparing the cell that endogenous Pdx1 gene expression is activated.
The method provided by the present invention for preparing the cell that endogenous Pdx1 gene expression is activated, it may include following step
It is rapid: the cell that endogenous Pdx1 gene expression is activated is prepared using method described in first aspect above.
The third aspect, claimed following any biomaterials:
(I) it is activated using the endogenous Pdx1 gene expression that method described in second aspect is prepared above thin
Born of the same parents.
(II) sgRNA, for sgRNA described in first aspect above.
(III) carrier or complete carrier；
The carrier be above " carrier that the sgRNA can be expressed " described in first aspect (the carrier A and/
Or the carrier B).
The complete carrier " carrier that the sgRNA can be expressed ", lenti as described in first aspect above
DCAS-VP64_Blast carrier, MS2-P65-HSF1_Hygro carrier composition.Certainly PMD2.G plasmid and PsPax2 be may also comprise
Plasmid.
In second aspect and the third aspect above, it can also be multipotential stem cell (such as embryo that the cell, which can be 293T cell,
Tire stem cell induces multi-potent stem cell).
Fourth aspect, the present invention be also claimed it is following it is any in application:
(A1) method described in first aspect is inducing multi-potent stem cell directed differentiation as answering in beta Cell of islet above
With；
(A2) above method described in first aspect or above cell described in second aspect promote pancreas embryo
Developmental application.
Wherein, the multipotential stem cell can be embryonic stem cell or induce multi-potent stem cell.
Present invention application CRISPR-on technology can efficiently activate the Pdx1 table of 293T cell by chromatin remodeling
It reaches.The present invention will play a significant role gene induction PSCs directed differentiation for the embryonic development research of β cell and pancreas.
Detailed description of the invention
Fig. 1 is that Pdx1 promoter and sgRNA are designed.TSS is transcripting start point.Black arrow is sgRNA in promoter region
The relative position in domain, number represent position of the sgRNA relative to TSS.SgRNA1, sgRNA4 and sgRNA5 target Pdx1 gene
Positive-sense strand, the antisense strand of sgRNA2 and sgRNA3 targeting Pdx1 gene.
Fig. 2 is Pdx1 expression analysis.A is that RT-PCR detects Pdx1 gene expression.SgRNA is transfected after 293T cell 3 days, is mentioned
Total serum IgE is taken, and is analyzed.B is that qPCR detects Pdx1 gene expression.3 days Pdx1 are expressed after analyzing sgRNA transfection 293T cell
Level variation.Gene expression data is standardized on the basis of GAPDH transcriptional level.Experimental result is through independent biochemical three times
Duplicate acknowledgment, p < 0.05 *；**p<0.01；***P<0.001.
Fig. 3 is sgRNA synergistic effect analysis.A is that RT-PCR detects Pdx1 gene expression.SgRNA is transfected 3 after 293T cell
It, extracts total serum IgE, and analyzed.B is that qPCR detects Pdx1 gene expression.SgRNA is analyzed to transfect after 293T cell 3 days
The variation of Pdx1 expression.Gene expression data is standardized on the basis of GAPDH transcriptional level.Experimental result is through only three times
Vertical biology duplicate acknowledgment, p < 0.05 *；**p<0.01；***P<0.001.
Fig. 4 is immunofluorescence analysis.The cell for collecting 3 days after sgRNAM (sgRNA3+4) is transfected, prepares cell rejection tablet, into
Row anti-Pdx1 (1:100) dyeing, INS-1 cell is as positive controls.Nucleus is redyed with DAPI.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Embodiment 1 activates endogenous Pdx1 gene expression based on chromatin remodeling
One, materials and methods
(1) CRISPR carrier
Lenti dCAS-VP64_Blast (hereinafter referred dCAS-VP64), lenti MS2-P65- are bought from Addgene
HSF1_Hygro (hereinafter referred MPH) and lenti sgRNA (MS2) _ zeo backbone.The Addgene ID of three carriers points
It Wei 61425,61426 and 61427.
(2) slow virus packaging plasmid PMD2.G and PsPax2 (Addgene) and 293T cell (Invitrogen), big
Mouse insulinoma cell INS-1 cell (AddexBio).
(3) design and vector construction of the sgRNA of promoter specific binding
1, sgRNA is designed
In upstream -400 to the position+1bp Pdx1 gene transcription start site (transcription start site, TSS),
5 sgRNA are designed using the online software CRISPR-ERA (crispr-era.stanford.edu) that the laboratory Lei Qi provides
(Fig. 1).The target sequence of sgRNA is shown in Table 1.The target sequence oligonucleotides of sgRNA is by Hua Da gene chemical synthesis.
Targeting sequence and position of 1 sgRNA of table in Pdx1 promoter
| sgRNA | Target sequence (5 ' -3 ') | PAM | Place chain | The position of distance TSS |
| 1 | GCGGAGCTGTCAAAGCGAGC(SEQ ID No.1) | AGG | + | -22/-3 |
| 2 | GTTCAGCCGGGGGCCGTGAT(SEQ ID No.2) | TGG | - | -103/-122 |
| 3 | GCCTGGCTGGCCGCACTAAG(SEQ ID No.3) | AGG | - | -125/-144 |
| 4 | GCAGGTGCTCGCGGGTACCT(SEQ ID No.4) | GGG | + | -175/-156 |
| 5 | GTTTTCGTGAGCGCCCATTT(SEQ ID No.5) | TGG | + | -266/-247 |
2, sgRNA vector construction
(1) sgRNA oligonucleotide chain makes annealing treatment
By two complementations of synthesis, sgRNA oligonucleotides is single-stranded uses ddH2O is diluted to 100 μM.Then, by following reaction item
Part made annealing treatment with synthesize double-strand sgRNA (sequence of double stranded section is the target sequence in table 1, in addition, both ends be with
The cohesive end that BsmB I notch is consistent).
Reaction system: 1 μ l of sgRNA-Forward (100 μM)；sgRNA-Reverse(100μM)1μl；10×T4DNA
ligase buffer(NEB)1μl；ddH2O 7μl。
Reaction condition: 37 DEG C, 30min；95 DEG C, 5min；90 DEG C, 1min；Hereafter, 5 DEG C/min of Gradient annealing, until 4 DEG C.
After reaction, by product ddH2O dilutes 200 times, connects reaction for subsequent carrier.
(2) carrier connection reaction
Lenti sgRNA (MS2) _ zeo backbone carrier is attached reaction after digestion, glue recovery purifying.
Endonuclease reaction system: lenti sgRNA (MS2) _ 2 μ l of zeo backbone carrier；10×Buffer 3.1(NEB)
5μl；BsmB I(NEB)2μl；ddH2O 41μl.Reaction condition: 55 DEG C, 2hrs.
Connection reaction: 1 μ l of double-strand sgRNA；Lenti sgRNA (MS2) _ 1 μ l of zeo backbone carrier digestion products；
ddH2O 3μl；2×solution I(Takara)5μl.Reaction condition: 22 DEG C, 2hrs.
(3) it converts
Connection product is inverted, coated plate, and picking positive colony carries out sequencing identification.
(4) building of dCAS-VP64/MPH cell line and screening
1, prepared by slow virus
DCAS-VP64 and MPH slow virus packaging process is summarized as follows: the previous day of virus preparation, according to 4-5 × 106/
The density of 10cm culture dish is inoculated with 293T cell.The viral same day is prepared, by target gene carrier dCAS-VP64 or MPH and slow disease
Malicious packaging plasmid PMD2.G and PsPax2 uses liposome according to the ratio (mass ratio) of 1:0.25:0.75
Lipofectamine2000 (Invitrogen) cotransfection 293T cell.48-72hrs collection contains virion after transfection
Culture medium supernatant, 1500rpm centrifugation remove the cell and fragment to suspend in supernatant.Then again with 20000rpm, 4 DEG C of centrifugation 2hrs
Concentrating virus.Supernatant is discarded after centrifugation, it is spare that virion is resuspended with 4ml culture medium.Two kinds of recombinant lentiviral diseases are obtained through this step
Poison.
2, the 293T cell line of building expression dCAS-VP64/MPH
When 293T cell grows into 60-70% fusion, (walked with expressing two kinds of slow virus of dCAS-VP64/MPH carrier
Rapid 1 two kinds of obtained recombinant slow virus) while infecting 293T cell.2 days after virus infection, cell is containing 10 μ g/ml first
Pressurization screening 7 days in the culture medium of Blasticidin S (Selleck).Then, cell is containing 300 μ g/ml
Continue pressurization screening 7 days in the culture medium of Hygromycin B (Selleck).Obtained positive cell clone is containing 5 μ g/ml
It is cultivated in the culture medium of Blasticidin S and 150 μ g/ml Hygromycin B, to maintain the expression of transgenosis.
(5) sgRNA activates endogenous Pdx1 gene expression
The 293T cell of dCAS-VP64/MPH is expressed with 3 × 105The density of/ml is inoculated in 12 orifice plates, every hole inoculation
1ml cell.Second day, with liposome, by step (3) building, simultaneously the correct sgRNA carrier of sequence verification was transferred to cell.Cell turns
Dye is divided into 6 groups, and respectively sgRNA 1-5 and sgRNA M (the mass ratioes mixing such as 5 sgRNA group), the dosage of every group of carrier is
0.8 μ g (quality such as 5 kinds of sgRNA carriers, respectively 0.16 μ g in sgRNA M group).Using 293T cell as transfection control group.
When detecting sgRNA synergistic effect, cell transfecting is divided into 5 groups, respectively sgRNA3 carrier 0.8 μ g and 1.6 μ g,
1.6 μ g of 4 carrier of sgRNA 0.8 μ g and 1.6 μ g and sgRNA M (4 carrier of sgRNA 3 carrier, 0.8 μ g+sgRNA, 0.8 μ g)
Group.3 days after cell transfecting, using the variation of RT-PCR and qRCR detection Pdx1 gene expression dose, and through immunofluorescence analysis
Confirm the expression of Pdx1 albumen.
(6) RT-PCR and qPCR
Total serum IgE is handled by separating total serum IgE, DNase in cell to remove contaminating genomic DNA using TRIzol reagent.It adopts
With Superscript IV first-strand synthesis system (Invitrogen) using 1 μ g total serum IgE as template into
Row reverse transcription.PCR amplification is carried out using Taq DNA polymerase (Invitrogen), reaction condition is as follows: initial denaturation 94
DEG C, 3min；94 DEG C, 30s of denaturation is annealed 56 DEG C, 30s, extends 72 DEG C, 1min, totally 30 circulations；Extend 72 DEG C eventually, 10min.
QPCR reaction is carried out using SYBR Green PCR Master Mix (AB), and each reaction is in triplicate.Gene expression data with
It is standardized on the basis of GAPDH transcriptional level.Changes in gene expression uses 2-ΔΔCtCalculation method.Experimental result is through only three times
Vertical biology duplicate acknowledgment.QPCR reaction condition is as follows: 95 DEG C of initial denaturation, 1min；95 DEG C, 5s of denaturation is annealed 60 DEG C, and 10s prolongs
72 DEG C, 15s are stretched, totally 40 circulations.
Pdx1 primer:
5'-ATGAAGTCTACCAAAGCTCACGC-3'；
5’-TCTCTCGGTCAAGTTCAACATGA-3’。
GAPDH primer:
5'-CGAGATCCCTCCAAAATCAAGT-3'；
5’-TGAGGCTGTTGTCATACT TCTCAT-3’。
(7) immunofluorescence analysis
Cell fixes 30min in paraformaldehyde first, and 4 DEG C.Then in X-100 containing 0.1%Triton and 10% ox blood
Rupture of membranes and Seal treatment are carried out in clear PBS.Subsequent 4 DEG C of primary antibody is incubated overnight, and is finally incubated at room temperature with the secondary antibody of fluorescent marker
1hr.Primary antibody used is anti-Pdx1 (R&D Systems)；Secondary antibody is donkey anti-goat AF594
(Invitrogen).Rat insulin oncocyte INS-1 cell is as positive controls.Nucleus is redyed with DAPI.
(8) statistical analysis
All experiments are at least repeated 3 times.It as a result is mean ± standard deviation.Statistical analysis uses the Student ' of non-matching
S t test, p < 0.05 are with significant difference.
Two, result
1, sgRNA vector construction
Complementary oligonucleotides double-strand is formed after the single-stranded annealed processing of sgRNA oligonucleotides.It is reacted after through connection, it will
Double-strand sgRNA is inserted into the restriction enzyme site of the BsmB I of lenti sgRNA (MS2) _ zeo backbone carrier.Connection product is through thin
After bacterium conversion, picking positive colony carries out sequencing identification, is finally obtained the plasmid vector for being correctly inserted into 5 kinds of sgRNA.
2, dCAS-VP64/MPH cell line
For efficiently easily for research sgRNA to the activation of endogenous Pdx1, the present invention, which constructs, expresses dCAS-
The 293T cell line of VP64/MPH.DCAS-VP64 and MPH carrier is respectively provided with Blasticidin and Hygromycin resistance base
Cause.2 days after slow virus infected cell to express dCAS-VP64/MPH carrier, cell is containing 10 μ g/ml first
It pressurizes and screens in the culture medium of Blasticidin S.It was screened through 3-4 days, cellular control unit (the 293T cell of uninfecting virus)
It is all dead.After 5-7 days, there is Blasticidin resistance clone in infection group and viral infection group cell.Then, cell is containing
Continue pressurization screening in the culture medium of Hygromycin.It was screened through 3-4 days, cellular control unit is all dead.Infection group and viral infection group is thin
For born of the same parents in the initial stage also visible part cell death of screening, these dead cells are mainly dCAS-VP64-Cell.Institute after 5-7 days
The positive cell clone of formation is dCAS-VP64+/MPH+Cell.Screen the Endogenous Gene Activation that obtained cell is used for next step
Expression study.
3, sgRNA activates the expression of Pdx1
After sgRNA is transfected cell 3 days, the total serum IgE of group of cells is collected, RT-PCR detects Pdx1 expression conditions.Knot
Fruit shows that control group 293T cell itself inherently expresses a certain amount of Pdx1；Compared with 293T cell controls group, sgRNA 1-5
And the obvious up-regulation of sgRNA M group Pdx1 expression, but (A in Fig. 2) cannot be distinguished in the differential expression of Pdx1 between each group.For into one
The differential expression of Pdx1 between step analysis each group, using the differential expression of qPCR detection Pdx1.The result shows that with control group phase
Than the expression of each group Pdx1 is obviously raised, wherein most significant with sgRNA 3 and 4 groups of up-regulation.Collaboration between sgRNA 1-5 is made
With (sgRNA M) unobvious (B in Fig. 2).
To advanced optimize the expression that sgRNA activates Pdx1, chooses sgRNA 3 and sgRNA4 and observe it to gene activation
Effect.After sgRNA is transfected cell 3 days, RT-PCR is the results show that the obvious up-regulation of each group Pdx1 expression is (in Fig. 3 compared with the control group
A).QPCR has certain dose dependent the results show that 1.6 μ g group activation effect of sgRNA is better than 0.8 μ g group of sgRNA；
1.6 μ g group activation effect of sgRNA M is better than 4 1.6 μ g of sgRNA, prompts between sgRNA 3 and sgRNA 4 activation Pdx1's
There is synergistic effect (B in Fig. 3) when expression.
Confirm that cell expresses Pdx1 on protein level for further, have collected 3 days sgRNA M group cells after transfection,
It prepares cell rejection tablet and carries out immunofluorescence analysis.The results show that 293T groups of cells Pdx1 is tied in weakly positive reaction (Fig. 4) with PCR
Fruit is consistent (A and B in Fig. 3).INS-1 cell positive control group Pdx1 is in strong positive reaction；SgRNA M group cell is also in strong positive
It reacts (Fig. 4).The above results show that sgRNA can efficiently activate the Pdx1 of 293T cell to express.
The present invention the result shows that, can efficiently activate 293T thin by chromatin remodeling using CRISPR-on technology
The Pdx1 of born of the same parents is expressed.The present invention will have gene induction PSCs directed differentiation for the embryonic development research of β cell and pancreas
Important function.
<110>PLA Academy of Military Sciences's military medical research institute
<120>method based on chromatin remodeling activation endogenous Pdx1 gene expression
<130> GNCLN181726
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
gcggagctgt caaagcgagc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
gttcagccgg gggccgtgat 20
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
gcctggctgg ccgcactaag 20
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
gcaggtgctc gcgggtacct 20
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence
<400> 5
gttttcgtga gcgcccattt 20
Claims (10)
1. a kind of method of endogenous Pdx1 gene expression in activation target cell is that the SAM system foundation based on CRISPR-on swashs
The method of endogenous Pdx1 gene expression in maneuvering target cell.
2. according to the method described in claim 1, it is characterized by: the SAM system includes targeting Pdx1 genetic transcription starting
The sgRNA of point upstream -400 to the position+1bp；The target sequence of the sgRNA is SEQ ID No.3 and/or SEQ ID No.4.
3. method according to claim 1 or 2, it is characterised in that: described method includes following steps: making the target cell
DCAS-VP64 fusion protein, MS2-P65-HSF1 fusion protein and the sgRNA are expressed, to activate in the target cell
The Pdx1 gene expression of source property.
4. according to the method described in claim 3, it is characterized by: described method includes following steps:
(1) packaging can express the recombinant slow virus A of the dCAS-VP64 fusion protein；Packaging can express the MS2-
The recombinant slow virus B of P65-HSF1 fusion protein；Then the recombinant slow virus A and the recombinant slow virus B are infected together
The target cell, obtains positive cell line；
(2) carrier that can express the sgRNA is imported into positive cell line obtained by step (1), and then is realized described in activation
Endogenous Pdx1 gene expression in target cell.
5. according to the method described in claim 4, it is characterized by: when packing the recombinant slow virus A, being used in step (1)
Purpose plasmid be lenti dCAS-VP64_Blast carrier；When packing the recombinant slow virus B, the purpose plasmid of use is
MS2-P65-HSF1_Hygro carrier；
And/or
When packing the recombinant slow virus A and recombinant slow virus B, the incasing cells of use is 293T cell；
And/or
In step (2), the carrier that can express the sgRNA is carrier A and/or carrier B；
The carrier A is that will be inserted into SEQ into lenti sgRNA (MS2) _ zeo backbone by BsmB I restriction enzyme site
The recombinant vector obtained after DNA fragmentation shown in ID No.3；
The carrier B is that will be inserted into SEQ into lenti sgRNA (MS2) _ zeo backbone by BsmB I restriction enzyme site
The recombinant vector obtained after DNA fragmentation shown in ID No.4.
6. any method in -5 according to claim 1, it is characterised in that: the target cell is that 293T cell or multipotency are dry
Cell.
7. a kind of method for preparing the cell that endogenous Pdx1 gene expression is activated includes the following steps: to utilize claim
The cell that endogenous Pdx1 gene expression is activated is prepared in any method in 1-6.
8. following any biomaterials:
(I) cell that the endogenous Pdx1 gene expression being prepared using claim 7 the method is activated；
(II) sgRNA is sgRNA as stated in claim 2；
(III) carrier or complete carrier；
The carrier is described in claim 4 or 5 " carrier that can express the sgRNA "；
The complete carrier " carrier that the sgRNA can be expressed ", lenti dCAS- as described in claim 4 or 5
VP64_Blast carrier, MS2-P65-HSF1_Hygro carrier composition.
9. the method according to claim 11 or cell according to any one of claims 8, it is characterised in that: the cell is 293T
Cell or multipotential stem cell.
10. it is following it is any in application:
(A1) method as claimed in any one of claims 1 to 6 is answering in beta Cell of islet inducing multi-potent stem cell directed differentiation
With；
(A2) cell described in method or claim 8 or 9 as claimed in any one of claims 1 to 6 is promoting pancreas embryonic development
In application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810947480.0A CN109097400B (en) | 2018-08-20 | 2018-08-20 | Method for activating expression of endogenous Pdx1 gene based on chromatin remodeling |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810947480.0A CN109097400B (en) | 2018-08-20 | 2018-08-20 | Method for activating expression of endogenous Pdx1 gene based on chromatin remodeling |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109097400A true CN109097400A (en) | 2018-12-28 |
| CN109097400B CN109097400B (en) | 2022-01-04 |
Family
ID=64850443
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810947480.0A Active CN109097400B (en) | 2018-08-20 | 2018-08-20 | Method for activating expression of endogenous Pdx1 gene based on chromatin remodeling |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109097400B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110218741A (en) * | 2019-05-31 | 2019-09-10 | 华中农业大学 | Multiple active methods of pig endogenous retinal stem cells factor transcription are activated using series connection sgRNA is synchronous |
| CN110305902A (en) * | 2019-07-12 | 2019-10-08 | 和元生物技术（上海）股份有限公司 | A kind of method and its application activating hSyn promoter in vehicles cells |
| CN113621652A (en) * | 2021-08-31 | 2021-11-09 | 中国科学院动物研究所 | Method for obtaining high-temperature-resistant cells based on CDC20 and high-temperature-resistant cells obtained by same |
| CN114875032A (en) * | 2022-06-30 | 2022-08-09 | 浙江省肿瘤医院 | Overexpression AURKA gene plasmid and construction method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107142247A (en) * | 2017-04-26 | 2017-09-08 | 天津医科大学 | Derivable CRISPRon or CRISPRi mouse embryo stem cells and its application |
| CN107614678A (en) * | 2014-12-18 | 2018-01-19 | 哈佛学院校长同事会 | The production method and its application method of the β cells of source of human stem cell |
-
2018
- 2018-08-20 CN CN201810947480.0A patent/CN109097400B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107614678A (en) * | 2014-12-18 | 2018-01-19 | 哈佛学院校长同事会 | The production method and its application method of the β cells of source of human stem cell |
| CN107142247A (en) * | 2017-04-26 | 2017-09-08 | 天津医科大学 | Derivable CRISPRon or CRISPRi mouse embryo stem cells and its application |
Non-Patent Citations (4)
| Title |
|---|
| HSIN-KAI LIAO ET AL.: "In Vivo Target Gene Activation via CRISPR/Cas9-Mediated Trans-epigenetic Modulation", 《CELL》 * |
| SILVANA KONERMANN ET AL.: "Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex", 《NATURE》 * |
| 王加强等: "干细胞与再生医学", 《中国科学:生命科学》 * |
| 高勇等: "Ngn3基因及其转录调控网络在胰腺内分泌发育与功能调控中的作用", 《中国细胞生物学学报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110218741A (en) * | 2019-05-31 | 2019-09-10 | 华中农业大学 | Multiple active methods of pig endogenous retinal stem cells factor transcription are activated using series connection sgRNA is synchronous |
| CN110305902A (en) * | 2019-07-12 | 2019-10-08 | 和元生物技术（上海）股份有限公司 | A kind of method and its application activating hSyn promoter in vehicles cells |
| CN110305902B (en) * | 2019-07-12 | 2020-08-21 | 和元生物技术（上海）股份有限公司 | Method for activating hSyn promoter in tool cell and application thereof |
| CN113621652A (en) * | 2021-08-31 | 2021-11-09 | 中国科学院动物研究所 | Method for obtaining high-temperature-resistant cells based on CDC20 and high-temperature-resistant cells obtained by same |
| CN114875032A (en) * | 2022-06-30 | 2022-08-09 | 浙江省肿瘤医院 | Overexpression AURKA gene plasmid and construction method and application thereof |
| CN114875032B (en) * | 2022-06-30 | 2022-11-11 | 浙江省肿瘤医院 | Overexpression AURKA gene plasmid and construction method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109097400B (en) | 2022-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109097400A (en) | Method based on chromatin remodeling activation endogenous Pdx1 gene expression | |
| Kizil et al. | Adult neurogenesis and brain regeneration in zebrafish | |
| Jee et al. | Silencing of miR20a is crucial for Ngn1-mediated neuroprotection in injured spinal cord | |
| Shahbazi et al. | Conversion of human fibroblasts to stably self-renewing neural stem cells with a single zinc-finger transcription factor | |
| Golas et al. | Use of human stem cells in Huntington disease modeling and translational research | |
| Vasanthan et al. | Differential expression of basal micro RNA s’ patterns in human dental pulp stem cells | |
| Perri et al. | A focus on regulatory networks linking MicroRNAs, transcription factors and target genes in neuroblastoma | |
| Zainal Ariffin et al. | Differentiation of Dental Pulp Stem Cells into Neuron‐Like Cells in Serum‐Free Medium | |
| JP2024042096A (en) | Neural stem cell compositions and methods for treating neurodegenerative disorders | |
| Fantuzzi et al. | In depth functional characterization of human induced pluripotent stem cell-derived beta cells in vitro and in vivo | |
| CN106834233B (en) | A method of preparing can the real-time source tracer iPSCs nerve member | |
| Kehler et al. | RNA‐generated and gene‐edited induced pluripotent stem cells for disease modeling and therapy | |
| KR20160063066A (en) | Graphene oxide-polyethylenimine complex for gene delivery and uses thereof | |
| Jee et al. | DHP-derivative and low oxygen tension effectively induces human adipose stromal cell reprogramming | |
| Hejrati et al. | How can clinical safety and efficacy concerns in stem cell therapy for spinal cord injury be overcome? | |
| Yeon et al. | NFIB induces functional astrocytes from human pluripotent stem cell‐derived neural precursor cells mimicking in vivo astrogliogenesis | |
| CN109055433A (en) | A method of activation endogenous Ngn3 and MAFA gene expression | |
| JP2010046019A (en) | Human amnion-derived mesenchymal cell and diabetic medicine using the same | |
| Chohan | Deconstructing neurogenesis, transplantation and genome-editing as neural repair strategies in brain disease | |
| Clark et al. | Cell reprogramming for regeneration and repair of the nervous system | |
| Laywell et al. | Astrocytic stem cells in the adult brain | |
| Gao et al. | Wireless Electrical Signals Induce Functional Neuronal Differentiation of BMSCs on 3D Graphene Framework Driven by Magnetic Field | |
| CN104630221B (en) | Suppress shRNA and its recombinant vector and the application of growth of tumour cell | |
| JP5888852B2 (en) | Cell production using immunodeficient animals | |
| Al-Ani | Microscale Tissue Engineering and Contributors of the Cellular Niche |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |