CN106755584A - A kind of ebb virus's detection kit and detection method - Google Patents
A kind of ebb virus's detection kit and detection method Download PDFInfo
- Publication number
- CN106755584A CN106755584A CN201710021612.2A CN201710021612A CN106755584A CN 106755584 A CN106755584 A CN 106755584A CN 201710021612 A CN201710021612 A CN 201710021612A CN 106755584 A CN106755584 A CN 106755584A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- magnetic bead
- kit
- ebv
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to biological technical field, specifically related to a kind of ebb virus's detection kit and detection method, nucleic acid extraction liquid and PCR reaction solutions including nucleic acid releasing agent, containing magnetic bead, the nucleic acid releasing agent include surfactant peptides, chlorhexidine acetate, the hydrophilic Graphene of 2~6% potassium chloride sums；The nucleic acid extraction liquid containing magnetic bead includes 4 HEPESs, sodium chloride and magnetic bead；The PCR reaction solutions include the sense primer for target polynucleotide amplification, anti-sense primer and the probe for target polynucleotide detection.Kit of the present invention has simple to operate, and detection sensitivity, the degree of accuracy are high, specific good, detection range advantage wide, for clinical diagnosis EBV infection provides reliable experimental basis.
Description
Technical field
The invention belongs to biological technical field, and in particular to a kind of ebb virus's detection kit and detection side
Method.
Background technology
The type of nerpes vinrus hominis the 4th is Epstein-Barr virus (EBV), and EBV is a kind of herpes-like virus for being prevalent in human body,
People is Yi Dan after infection, it is possible to lifelong to carry.EBV infection can mainly cause children's infectious mononucleosis and with many
Tumour has substantial connection, seriously threatens the health of the mankind particularly children, thus receives much attention always.
At present, epstein barr virus dna detection is main in blood uses PCR (PCR) technology.Quantitative fluorescent PCR is again
Claim real-time quantitative PCR, be the brand-new round pcr for developing in recent years, can be with whole, dynamic, optical monitoring be glimmering incessantly
The PCR reactions of signal, the DNA content in detected sample is evaluated with this, can reflect that PCR expands dynamic variation, is realized
Real_time quantitative detection, have the advantages that it is quick, accurate, be difficult it is contaminated.
As Chinese patent application CN103866046A discloses a kind of herpes virus hominis EBV and VZV detection kits, by fixed
Amount PCR reaction solutions, EBV standard items, VZV standard items, EBV positive reference substances, VZV positive reference substances, negative controls, specification
Constituted with box body.The invention kit uses Real-Time Fluorescent Quantitative PCR Technique and Two Colour Fluorescence probe, can one-step method detection people's blister
Exanthema virus EBV and VZV, realize the synchronous diagnosis of EBV and VZV infection, to the real-time accurate quantitative analysis of positive-virus energy, can meet and face
Bed early stage, Accurate Diagnosis EBV and VZV infection in the urgent need to for the timely immunotherapy targeted autoantibody that EBV and VZV infect provides foundation.
Mainly include that the extraction of Epstein-Barr virus nucleic acid and the PCR of nucleic acid are expanded with round pcr detection epstein barr virus dna, but the kit
Be not directed to Epstein-Barr virus nucleic acid extraction aspect, and in practice, except PCR in itself in addition to, nucleic acid extraction efficiency and anti-interference energy
Power detection Epstein-Barr virus nucleic acid content accurate to PCR has a significant impact.
At present, it is domestic clinically mainly using direct boiling method, phenol-chloroform extraction process to the EB in blood plasma or serum sample
Viral nucleic acid is extracted, and direct boiling method extraction process is more complicated, and when sample is processed by boiling lysis, high speed centrifugation
There is loss in the multiple steps such as enrichment DNA, DNA in sample, at the same snead process extract it is nucleic acid-templated in containing more
Impurity, the impurity that these are present can Interference Detection carrying out, such as protein, heparin, so generally requiring nucleic acid extraction
Liquid is further purified, and purification procedures are tediously long and often fall flat.And foreign countries clinically mainly use DNA extracts reagents
Box extracts Epstein-Barr virus nucleic acid, its extraction effect preferably, but due to expensive, it is difficult to apply at home.
Regarding to the issue above, Chinese patent application CN103060473A discloses a kind of herpes-like virus EBV detection reagents
Box, it includes nucleic acid releasing agent and PCR reaction solutions, and the nucleic acid releasing agent includes Sha graceful 0.01~0.5mM/L of ancient India, potassium chloride 20
~300mM/L, dodecyl sodium sulfate 0.01~2% and ethanol 0.05~1%.The nucleic acid releasing agent uses strong when extracting nucleic acid
Strong protein denaturant, rapid damage pathogen coat protein structure, discharges pathogen nucleic acid, can be completed without heating
The release and extraction of DNA.Although with nucleic acid releasing agent extract nucleic acid have the advantages that quickly, simplicity, nucleic acid samples contain it is miscellaneous
Matter is more, and the extraction efficiency of entirety is not high, have impact on the accuracy in detection of kit.
Therefore, it is necessary to improve on this basis, so provide it is a kind of can be to the reagent of the EBV accurate quantitative analysis in sample
Box.
The content of the invention
In order to solve technical problem present in prior art, it is an object of the invention to provide a kind of nerpes vinrus hominis
4 type detection kits and detection method, to solve disadvantages described above.
The invention provides a kind of ebb virus's detection kit, including nucleic acid releasing agent, the nucleic acid containing magnetic bead
Extract solution and PCR reaction solutions, the nucleic acid releasing agent include 0.1~0.3mg/ml surfactant peptides, 0.01~0.05mg/ml vinegar
Sour Chlorhexidine, 2~6% potassium chloride (w/v) and 0.1~2% hydrophilic Graphene (w/v)；The nucleic acid extraction liquid containing magnetic bead
Including 100~300mmol/L4- HEPESs, 100~300mmol/L sodium chloride and 100~400 μ g/ml magnetic beads；
The PCR reaction solutions are comprising the sense primer for target polynucleotide amplification, anti-sense primer and for target polynucleotide detection
Probe.
Further, the nucleic acid releasing agent include 0.2mg/ml surfactant peptides, 0.03mg/ml chlorhexidine acetates,
4.5% potassium chloride (w/v) and 1.2% hydrophilic Graphene (w/v), the nucleic acid extraction liquid containing magnetic bead include 200mmol/
L4- HEPESs, 200mmol/L sodium chloride and 250 μ g/ml magnetic beads.Need what deserves to be explained is, the present invention first use
Nucleic acid releasing agent discharges nucleic acid, then adsorbs nucleic acid by magnetic bead, so as to the height reached to nucleic acid is extracted.Wherein, in the present invention
The solvent of nucleic acid releasing agent can be sterilized water or TE buffer solutions.In nucleic acid releasing agent of the present invention in hydrophilic Graphene and sample
Impurity such as protein, lipid etc. have strong affinity, can be combined with the impurity such as protein, lipid so that the impurity such as protein
There is no unnecessary binding site to be combined with magnetic bead, so as to improve the recovery rate of nucleic acid, and then it is accurate to improve the detection of kit
Exactness.On the other hand, hydrophilic Graphene has strong protective effect to nucleic acid.Nucleic acid releasing agent of the present invention with it is direct in the prior art
The testing result of boiling method has the uniformity of height, and extracting nucleic acid heating using nucleic acid releasing agent of the present invention can make nucleic acid fast
Quick-release is released.Magnetic bead is recycled to catch nucleic acid, by obtaining final product nucleic acid samples after Magneto separate cleaning, due to the absorption of hydrophilic Graphene
The impurity of the overwhelming majority, cleans that the nucleic acid samples impurity content for obtaining is less after Magneto separate, and it is saved without repurity
Program, reduces production cost.
Further, sense primer, anti-sense primer, probe, internal standard, the use for target polynucleotide amplification of the present invention
Sense primer, anti-sense primer and probe in internal standard detection are quoted from a kind of bleb classes of Chinese patent application CN103060473A
Viral EBV detection kits, wherein, for target polynucleotide amplification upstream primer sequence for 5 '-
TGCAGCTTTGACGATGGAGTAG-3 ', downstream primer sequence is 5 '-TCACTCCTGCCCTTCCTCAC-3, and probe sequence is
5 '-FAM-TTTGCCTCCCTGGTTTCCACCTATG-BHQ1-3 ', the interior target sequence is 5-
CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACCTATTCGTAGCCAATCTTCTGGAGG
TGCAATCTCAATTATGTCATCAG-3, the PCR reaction solutions also include sense primer, the anti-sense primer for internal standard detection
And probe；The internal standard upstream primer sequence is 5 '-CACCACTTAAATCCTAAGGTTCCAG-3 ', the internal standard anti-sense primer
Sequence is 5 '-CTGATGACATAATTGAGATTGCACC-3 ', and the sequence of the internal standard probe is 5 '-HEX-
TTTGCTGACTCACGTATTCGTAGCCAA–BHQl-3’.Further, the hydrophilic Graphene is obtained by following steps：
Learnt from else's experience dialysis treatment, removed graphite oxide prepared by the Hummers methods of residual ion, it is configured to 0.2~
The aqueous solution of 0.8mg/ml, by graphite oxide：Hexamethylenetetramine is 2: 1~1: 2 mass ratio addition hexamethylenetetramine,
100 DEG C are stirred at reflux 8~12h of reaction, obtain finely dispersed hydrophilic graphene dispersion system.
Further, the kit also includes internal standard, nucleic acid eluents, magnetic bead cleaning solution, EBV negative controls, EBV eventually
Positive control, EBV qualitative references product, magnetic bead dispersant and enzyme mixation.
Further, the magnetic bead dispersant includes 0.06~2 part of amino acid, 0.5~2 part of acetic acid and Sensor Chip CM 5
2~5 parts.
Although can preferably adsorb nucleic acid using nucleic acid releasing agent and magnetic bead absorption, in later stage Nucleic Acid Elution mistake
Cheng Zhong, because magnetic bead is attached on centrifugation tube wall, increased the difficulty of elution program, it is necessary to repeated multiple times eluted, repeatedly
Wash-out on the one hand increased operation, on the other hand easily lose nucleic acid, so as to have impact on the degree of accuracy of kit.Then,
Inventor is found that a kind of magnetic bead dispersant, and it can disperse magnetic bead, and it will not reduce immune response.What deserves to be explained is,
Dispersant can be added with any concentration, as long as they are added with such concentration, can play foregoing effect.
Specifically, when dispersant is added in sample, added according to the concentration of 0.01~5 μ g/ μ l, preferably 0.6~2 μ g/ μ l.
Wherein, dispersant includes 2~5 parts of 0.06~2 part of amino acid, 0.5~2 part of acetic acid and Sensor Chip CM 5.It is highly preferred that described
Dispersant includes 3.5 parts of 0.15 part of amino acid, 0.8 part of acetic acid and Sensor Chip CM 5.Preferably, the amino acid is selected from sweet ammonia
One kind in acid, lysine, histidine and arginine.It is highly preferred that amino acid is selected from glycine.
Further, the nucleic acid eluents contain 0.8~1.2mol/LTris-HCl, 0.1~1.0mol/LEDTA；Institute
State magnetic bead cleaning solution and lead to (v/v), 100~300mmol/L sodium chloride comprising 0.1~1.0% Qula；Included in the enzyme mixation
The UNG enzymes of Taq polymerase and 0.5~2U/ μ l.Wherein, the function of UNG enzymes is PCR primer of the degraded containing dU, using UNG enzymes
Prevention PCR primer pollution can be played a part of with the dUTP in PCR reaction solutions, so as to prevent pattern detection false positive.
Correspondingly, present invention also offers a kind of method that ebb virus is detected using above-mentioned kit, bag
Include following steps：
A) lytic virus：Four centrifuge tubes are taken, 5~10 μ l nucleic acid releasing agents and 10~15 μ l samples to be tested, 5 are separately added into
~10 μ l nucleic acid releasing agents and 6~10 μ l EBV negative controls, 5~10 μ l nucleic acid releasing agents and 6~10 μ l EBV positive controls
And 5~10 μ l nucleic acid releasing agents and 6~10 μ l EBV qualitative reference product, mark is carried out, it is sufficiently mixed uniform, put at room temperature
3~5min is put, it is standby；
B) magnetic bead absorption：Nucleic acid extraction liquid and internal standard containing magnetic bead are added toward above-mentioned 4 centrifuge tubes, magnetic is used in centrifugation
Pearl separator carries out separation of solid and liquid, now be centrifuged tube wall on solid contain magnetic bead and nucleic acid, add magnetic bead cleaning solution, again from
The heart, separation of solid and liquid is carried out with Beads enrichment device, and the solid being now centrifuged on tube wall contains magnetic bead and nucleic acid；
C) Nucleic Acid Elution：Nucleic acid eluents and dispersant are added toward above-mentioned centrifuge tube so that magnetic bead and nucleic acid are separated, from
The heart, separates magnetic bead, retains the liquid in centrifuge tube；
D) PCR fluorescence analyses：According to sample to be tested, EBV negative controls, EBV positive controls, EBV qualitative reference product number
Amount prepares PCR reaction solutions, by through step C) sample to be tested after treatment, EBV negative controls, EBV positive controls and EBV quantitatively join
Examine after product mix with PCR reaction solutions and enzyme mixation respectively and be added in each hole of PCR reaction plates, go bubble removing bonnet to seal well
Film, 1000~3000rpm/min centrifugation 30s, for fluorescence analysis.
Compared with prior art, kit of the present invention has the advantage that：
1) kit of the present invention has simple to operate, and detection sensitivity, the degree of accuracy are high, and specificity is good, and detection range is wide
Advantage, for clinical diagnosis EBV infection provides reliable experimental basis.
2) kit amplifying nucleic acid releasing agent of the present invention can rapidly destroy EBV virus particle shell protein structures, discharge EBV
Nucleic acid, further by magnetic bead catch nucleic acid, both combine significantly improve nucleic acid extraction rate, extraction process become simply, consume
When it is short, and subsequently without being purified again, reduce production cost, achieve positive effect.
Specific embodiment：
Below by way of the description of specific embodiment, the invention will be further described, but this is not to limit of the invention
System, those skilled in the art's basic thought of the invention, various modifications may be made or improves, but without departing from this
The basic thought of invention, within the scope of the present invention.
Surfactant peptides of the present invention are purchased from Sigma companies.
Embodiment 1, a kind of ebb virus's detection kit
The embodiment of the present invention 1 includes following components：
1. nucleic acid releasing agent：Surfactant peptides are added in sterilized water makes final concentration reach 0.2mg/ml, add acetic acid chlorine
Oneself makes final concentration reach 0.03mg/ml, addition potassium chloride surely makes final concentration reach 4.5% (w/v) and adds hydrophilic Graphene
Final concentration is set to reach 1.2% (w/v).
The preparation method of hydrophilic Graphene：Learnt from else's experience dialysis treatment, removed oxygen prepared by the Hummers methods of residual ion
Graphite, is configured to the aqueous solution of 0.5mg/ml, by graphite oxide：Hexamethylenetetramine is 2: 1 mass ratio six first of addition
Urotropine, 100 DEG C are stirred at reflux reaction 12h, obtain finely dispersed hydrophilic graphene dispersion system.
2. the nucleic acid extraction liquid of magnetic bead is contained：200mmol/L 4- HEPESs, 200mmol/L sodium chloride and
250 μ g/ml magnetic beads, 1L is settled to sterilized water.
3. internal standard：For insert pUC18T carriers one section of length be 100 base-pairs DNA artificial sequence synthetic recombinant,
That is plasmid, concentration is 2.00E+05copies/ml, and the sequence of 100 base-pairs is：5’-
CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTATTCGTAGCCAATCTTCTGGAGG
TGCAATCTCAATTATGTCATCAG-3’。
4. PCR reaction solutions：Deoxyribonucleoside triphosphate including 10 × PCR reaction buffers 5 μ l, 0.2mmol/L,
0.3 μm of ol/L is used for the upstream and downstream primer of target polynucleotide amplification, and 0.3 μm of ol/L is used for the probe of target polynucleotide detection,
0.3 μm of ol/L is used for the upstream and downstream primer of internal standard fragment amplification, and 0.1 μm of ol/L is used to detect that interior target probe is.Wherein, it is described
10 × PCR reaction buffers are to include 200mmol/L Tri(Hydroxymethyl) Amino Methane Hydrochlorides solution, the 30mmol/L chlorine of pH7.5
Change magnesium solution, 500mmol/L Klorvess Liquids, 0.2% Qula logical solution and 10% formamide solution；The deoxyribose
Ribonucleoside triphosphote includes dATP, dCTP, dUTP and dGTP；It is described for target polynucleotide amplification upstream and downstream primer and for target
The probe of polynucleotides detection is derived from the primer and probe of the conservative region of Epstein-Barr virus nucleic acid, and its base sequence is respectively：On
Trip primer：5’-TGCAGCTTTGACGATGGAGTAG-3’；Anti-sense primer：5’-TCACTCCTGCCCTTCCTCAC-3’；Probe：
5’-FAM-TTTGCCTCCCTGGTTTCCACCTATG-BHQ1-3’；It is described for detecting interior target primer probe sequence difference
For：Sense primer：5 '-CACCACTTAAATCCTAAGGTTCCAG-3 ', anti-sense primer：5’-
CTGATGACATAATTGAGATTGCACC-3 ', probe：5’-HEX-TTTGCTGACTCACGTATTCGTAGCCAA-BHQl-3’.
5. magnetic bead dispersant：Containing 3.5 parts of 0.15 part of amino acid, 0.8 part of acetic acid and Sensor Chip CM 5.
6. nucleic acid eluents：Sterilized water containing 1.2mol/LTris-HCl, 0.5mol/LEDTA.
7. magnetic bead cleaning solution：Sterilized water comprising 0.5% Qula logical (v/v), 200mmol/L sodium chloride.
8. enzyme mixation：UNG enzymes comprising Taq polymerase and 0.5~2U/ μ l.
9. EBV negative controls：It is negative serum.
10. EBV positive controls：It is the supernatant of the culture of the B958 cells of negative serum dilution, concentration is 4.00E+
05copies/ml。
EBV qualitative reference product：By concentration be 4.00E+08copies/ml standard items according to 10 times of doubling dilutions extremely
4.00E+01copies/ml, dilutes eight gradients, and using this eight standard items as EBV qualitative reference product.
Embodiment 2, the method that EBV is detected with kit described in embodiment 1
First, sample to be tested is prepared
Prepare serum sample：From the new venous blood for extracting, after 25~35min of room temperature, in 2000rpm/min centrifugations
2~4min, draws supernatant, and move to stand-by in clean EP pipes.
2nd, nucleic acid extraction
A) lytic virus：Take four centrifuge tubes, be separately added into 6 μ l nucleic acid releasing agents and 12 μ l steps one) in prepare treat
Test sample sheet, 6 μ l nucleic acid releasing agents and 8 μ l EBV negative controls, 6 μ l nucleic acid releasing agents and 8 μ l EBV positive controls and 6 μ l cores
Sour releasing agent and 8 μ l EBV qualitative reference product, carry out mark, are sufficiently mixed uniformly, and 3min is placed at room temperature, standby；
B) magnetic bead absorption：Nucleic acid extraction liquid and 4 μ l internal standards of the 100 μ l containing magnetic bead are added toward above-mentioned 4 centrifuge tubes, from
The heart, separation of solid and liquid is carried out with Beads enrichment device, and the solid being now centrifuged on tube wall contains magnetic bead and nucleic acid, adds 100 μ l magnetic beads to wash
Liquid is washed, is centrifuged again, separation of solid and liquid is carried out with Beads enrichment device, the solid being now centrifuged on tube wall contains magnetic bead and nucleic acid；
C) Nucleic Acid Elution：50 μ l nucleic acid eluents and 25 μ g dispersants are added toward above-mentioned centrifuge tube so that magnetic bead and core
Acid is separated, centrifugation, separates magnetic bead, retains the liquid in centrifuge tube；
D) PCR fluorescence analyses：According to sample to be tested, EBV negative controls, EBV positive controls, EBV qualitative reference product number
Amount prepares PCR reaction solutions, by through step C) sample to be tested after treatment, EBV negative controls, EBV positive controls and EBV quantitatively join
Examine product to be added in each hole of PCR reaction plates with PCR reaction solutions and enzyme mixation respectively, go the good sealer of bubble removing bonnet, 1000
~3000rpm/min is centrifuged 30s, for fluorescence analysis.
3rd, Fluorescence PCR and interpretation of result
Above-mentioned PCR reaction tubes are put into amplification instrument sample cell first, qualitative reference product concentration is set by correspondence order；Choosing
Select FAM Air conduct measurements EBV；Selection HEX or VIX Air conduct measurement internal standards；Reference fluorescent is set to none, quantitative fluorescent PCR reaction
Condition is as shown in table 1 below.
The quantitative fluorescent PCR reaction condition of table 1
Interpretation of result：After reaction terminates, the software carried using instrument is automatically analyzed, amplification curve and threshold line
Intersection point is Ct values, and software draws standard curve according to the size of the Ct values of sample by eight qualitative reference product of concentration gradient,
The quantitative determination result of sample can automatically be tried to achieve.As long as obtaining the Ct values of unknown sample, you can calculated from standard curve
The initial carrying capacity of the sample.If determining Ct value≤39 (Ct values ＞ 0) and the amplification curve of sample to be tested being S-type, it can be determined that
EBV-DNA is positive；If shown without Ct values, sample to be tested amplification curve is straight, and internal standard test positive (Ct value≤39), can
To judge that EBV-DNA is negative；If determining sample to be tested Ct values ＞ 39, while internal standard test positive (Ct value≤39), can be with
It is judged as less than Monitoring lower-cut；If internal standard Ct values ＞ 39 or internal standard are shown without Ct values, the detection knot of the sample to be tested is judged
It is really invalid.
Test example one, kit of the present invention and Chinese patent application CN103060473A kit Performance comparisions
1.1 degrees of accuracy test takes kit described in the embodiment of the present invention 1 and control group (Chinese patent application
CN103060473A kits) standard items 1 and standard items 2 are measured respectively, concentration is 4.00E+ wherein in standard items 1
08copies/ml, concentration is 4.00E+01copies/ml standard items in standard items 2, and each kit is repeated three times, and is surveyed
Determine result as shown in table 2 and table 3.
Measurement result of the kit of the present invention of table 2 to standard items 1
| Group | 1st time (copies/ml) | 2nd time (copies/ml) | 3rd time (copies/ml) | Average value (copies/ml) | Deviation (%) |
| Embodiment 1 | 4.05E+08 | 4.08E+08 | 3.97E+08 | 4.03E+08 | 0.75% |
| Control group | 4.22E+08 | 4.08E+08 | 4.56E+08 | 4.28E+08 | 7% |
Measurement result of the kit of the present invention of table 3 to standard items 2
| Group | 1st time (copies/ml) | 2nd time (copies/ml) | 3rd time (copies/ml) | Average value (copies/ml) | Deviation (%) |
| Embodiment 1 | 4.02E+01 | 4.01E+01 | 4.20E+01 | 4.07E+01 | 1.75% |
| Control group | 4.24E+01 | 4.08E+01 | 4.32E+01 | 4.21E+01 | 5.25% |
From table 2 and table 3, kit of the present invention compared with control group, with the degree of accuracy higher, to the He of standard items 1
The detection error of standard items 2 is smaller.
The test of 1.2 precision takes kit described in the embodiment of the present invention 1 and control group (Chinese patent application
CN103060473A kits) same sample to be tested is repeatedly repeatedly measured, the result to gained carries out standard deviation S D
Calculated with coefficient of variation CV.Result shows that kit of the present invention has precision higher, and its variation within batch coefficient is
3.82%, interassay coefficient of variation is 5.68%, and control group variation within batch coefficient is 8.53%, and interassay coefficient of variation is 23.42%.
1.3 specific tests
1.3.1 it is specific：With the embodiment of the present invention 1 and control group (Chinese patent application CN103060473A kits)
The kit detects 206 parts of healthy blood donor serum respectively, and testing result is as shown in table 4.
The testing result of table 4
As shown in Table 4, healthy serum 206 is detected with kit described in the embodiment of the present invention 1, detection is positive 0, positive
Rate is 0%, and without conspicuousness, the specificity of kit is 100% to result difference.
What deserves to be explained is, healthy serum 206 is detected with kit described in control group, detection is positive 8, and positive rate is
2.9%, this explanation, compared with control group, kit of the present invention has preferably specificity.
The influence of test example two, different nucleic acid nucleic acid releasing agents to serum EBV nucleic acid extractions
1.1 test kits：In addition to the composition difference of nucleic acid releasing agent, 4 kinds of kits are set, are respectively：Kit is 1.
(nucleic acid releasing agent is 0.2mg/ml containing surfactant peptides, chlorhexidine acetate 0.03mg/ml, potassium chloride 4.5% (w/v), hydrophilic stone
The sterilized water of (w/v) of black alkene 1.2%), 2. (the nucleic acid releasing agent is 0.2mg/ml containing surfactant peptides, chlorination to kit
3. (the nucleic acid releasing agent is containing surface to (sterilized water of w/v), the kit of potassium 4.5% (w/v) and hydrophilic Graphene 1.2%
Active peptide 0.2mg/ml, chlorhexidine acetate 0.03mg/ml, the sterilized water of potassium chloride 4.5% (w/v)) and kit 4. (China
Nucleic acid releasing agent described in patent application CN103060473A, containing Sha graceful 0.1mM/L, potassium chloride 100mM/L, dodecyl sodium sulfonate of ancient India
The TE buffer solutions of sodium 0.1 and ethanol 0.1%).
1.2 detections：Using above-mentioned 4 kinds of kits according to the methods described of the embodiment of the present invention 2 to 5 EBV positive serums (mark
It is designated as A, BC, D, E) nucleic acid extraction and detection are carried out, 4 kinds of kits are to 5 EBV positive serum quantitative determinations result such as institutes of table 5
Show.
54 kinds of kits of table are to 5 quantitative determination results of EBV positive serums
Interpretation of result：As shown in Table 5, compared with nucleic acid releasing agent described in Chinese patent CN103060473A, containing this hair
The kit of bright nucleic acid releasing agent can be quantified more accurately；In addition, changing the composition of nucleic acid releasing agent of the present invention, it is to examination
The quantitative result influence of agent box is larger, adds chlorhexidine acetate and hydrophilic Graphene to be more beneficial for the accurate quantitative analysis of kit.
The influence of test example three, different dispersant compositions to magnetic bead clustering phenomena
In addition to dispersant composition difference, 4 kinds of kits are set, using each kit according to detection method described in embodiment 2
Serum sample is detected, magnetic bead sticking on centrifuge tube and clustering phenomena is estimated, result such as table 6 is recorded.
Influence of the different dispersant compositions of table 6 to magnetic bead clustering phenomena
| Dispersant is constituted | Magnetic bead grain sticks on centrifuge tube | The aggregation of magnetic bead |
| 3.5 parts of 0.15 part of amino acid, 0.8 part of acetic acid and Sensor Chip CM 5 | No | No |
| Without dispersant | In the presence of | In the presence of |
| 0.8 part of 0.15 part of amino acid and acetic acid | In the presence of | In the presence of |
| 3.5 parts of 0.2 part of amino acid and Sensor Chip CM 5 | In the presence of | No |
As seen from the above table, when there is dispersant, magnetic bead does not appear in and sticks on reaction vessel inwall and mutually assemble
Phenomenon, subsequently without repeating to elute, saves operational sequence and cost.When dispersant is added without, magnetic bead is in centrifuge tube
Have very serious sticking phenomenon on wall, and mutually assemble between magnetic bead, cannot smoothly be carried out in follow-up elution process, it is necessary to
Carry out that wash-out is repeated several times.What deserves to be explained is, even the consumption of the composition or change each component for changing dispersant also can
Cause the aggregation of magnetic bead, such as when Sensor Chip CM 5 is removed, magnetic bead has and significantly sticks and clustering phenomena, when removing acetic acid
When, easily cause that magnetic bead sticks on centrifugation inside pipe wall.
Claims (10)
1. a kind of ebb virus's detection kit, including nucleic acid releasing agent, the nucleic acid extraction liquid containing magnetic bead and PCR are anti-
Answer liquid, it is characterised in that the nucleic acid releasing agent includes 0.1~0.3mg/ml surfactant peptides, 0.01~0.05mg/ml acetic acid
Chlorhexidine, 2~6% potassium chloride (w/v) and 0.1~2% hydrophilic Graphene (w/v)；The nucleic acid extraction liquid bag containing magnetic bead
Include 100~300mmol/L4- HEPESs, 100~300mmol/L sodium chloride and 100~400 μ g/ml magnetic beads；Institute
State PCR reaction solutions and include the sense primer for target polynucleotide amplification, anti-sense primer and the spy for target polynucleotide detection
Pin.
2. kit as claimed in claim 1, it is characterised in that the nucleic acid releasing agent includes 0.2mg/ml surface-actives
Peptide, 0.03mg/ml chlorhexidine acetates, 4.5% potassium chloride (w/v) and 1.2% hydrophilic Graphene (w/v), it is described containing magnetic bead
Nucleic acid extraction liquid includes 200mmol/L4- HEPESs, 200mmol/L sodium chloride and 250 μ g/ml magnetic beads.
3. kit as claimed in claim 1, it is characterised in that the upstream primer sequence for target polynucleotide amplification
It is 5 '-TGCAGCTTTGACGATGGAGTAG-3 ', downstream primer sequence is 5 '-TCACTCCTGCCCTTCCTCAC-3, the use
The probe sequence detected in target polynucleotide is 5 '-FAM-TTTGCCTCCCTGGTTTCCACCTATG-BHQ1-3 '.
4. kit as claimed in claim 1, it is characterised in that the hydrophilic Graphene is obtained by following steps：
Learnt from else's experience dialysis treatment, removed graphite oxide prepared by the Hummers methods of residual ion, be configured to 0.2~0.8mg/
The aqueous solution of ml, by graphite oxide：Hexamethylenetetramine is 2: 1~1: 2 mass ratio addition hexamethylenetetramine, and 100 DEG C are stirred
8~12h of back flow reaction is mixed, finely dispersed hydrophilic graphene dispersion system is obtained.
5. kit as claimed in claim 1, it is characterised in that the kit also includes internal standard, nucleic acid eluents, magnetic bead
Cleaning solution, EBV negative controls, EBV positive controls, EBV qualitative references product, magnetic bead dispersant and enzyme mixation.
6. kit as claimed in claim 5, it is characterised in that the magnetic bead dispersant includes 0.06~2 part of amino acid, second
2~5 parts of 0.5~2 part of acid and Sensor Chip CM 5.
7. kit as claimed in claim 5, it is characterised in that the nucleic acid eluents contain 0.8~1.2mol/LTris-
HCl, 0.1~1.0mol/LEDTA；The magnetic bead cleaning solution leads to (v/v), 100~300mmol/L comprising 0.1~1.0% Qula
Sodium chloride；UNG enzymes comprising Taq polymerase and 0.5~2U/ μ l in the enzyme mixation.
8. kit as claimed in claim 5, it is characterised in that the interior target sequence is 5-
CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACCTATTCGTAGCCAATCTTCTGGAGG
TGCAATCTCAATTATGTCATCAG-3。
9. kit as claimed in claim 5, it is characterised in that the PCR reaction solutions are also included for internal standard detection
Trip primer, anti-sense primer and probe；The internal standard upstream primer sequence is 5 '-CACCACTTAAATCCTAAGGTTCCAG-3 ',
The internal standard downstream primer sequence is 5 '-CTGATGACATAATTGAGATTGCACC-3 ', the sequence of the internal standard probe for 5 '-
HEX-TTTGCTGACTCACGTATTCGTAGCCAA–BHQl-3’。
10. a kind of method that kit using as described in claim 1~9 is any detects ebb virus, its feature
It is to comprise the following steps：
A) lytic virus：Four centrifuge tubes are taken, 5~10 μ l nucleic acid releasing agents and 10~15 μ l samples to be tested, 5~10 are separately added into
μ l nucleic acid releasing agents and 6~10 μ l EBV negative controls, 5~10 μ l nucleic acid releasing agents and 6~10 μ l EBV positive controls and 5
~10 μ l nucleic acid releasing agents and 6~10 μ l EBV qualitative reference product, carry out mark, are sufficiently mixed uniform, place 3 at room temperature~
5min, it is standby；
B) magnetic bead absorption：Nucleic acid extraction liquid and internal standard containing magnetic bead, centrifugation, with magnetic bead point are added toward above-mentioned 4 centrifuge tubes
Separation of solid and liquid is carried out from device, the solid being now centrifuged on tube wall contains magnetic bead and nucleic acid, adds magnetic bead cleaning solution, is centrifuged again, uses
Beads enrichment device carries out separation of solid and liquid, and the solid being now centrifuged on tube wall contains magnetic bead and nucleic acid；
C) Nucleic Acid Elution：Nucleic acid eluents and dispersant are added toward above-mentioned centrifuge tube so that magnetic bead and nucleic acid are separated, centrifugation,
Magnetic bead is separated, retains the liquid in centrifuge tube；
D) PCR fluorescence analyses：Quantity according to sample to be tested, EBV negative controls, EBV positive controls, EBV qualitative reference product is matched somebody with somebody
PCR reaction solutions processed, will be through step C) sample to be tested, EBV negative controls, EBV positive controls and EBV qualitative reference product after treatment
It is added to after mixing with PCR reaction solutions and enzyme mixation respectively in each hole of PCR reaction plates, goes the good sealer of bubble removing bonnet,
1000~3000rpm/min is centrifuged 30s, for fluorescence analysis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710021612.2A CN106755584B (en) | 2017-01-12 | 2017-01-12 | A kind of ebb virus's detection kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710021612.2A CN106755584B (en) | 2017-01-12 | 2017-01-12 | A kind of ebb virus's detection kit and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106755584A true CN106755584A (en) | 2017-05-31 |
| CN106755584B CN106755584B (en) | 2019-07-09 |
Family
ID=58947768
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710021612.2A Active CN106755584B (en) | 2017-01-12 | 2017-01-12 | A kind of ebb virus's detection kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755584B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164561A (en) * | 2017-06-08 | 2017-09-15 | 江苏默乐生物科技股份有限公司 | A kind of primer and probe group and kit for Epstein-Barr virus fluorescence quantitative PCR detection |
| CN108220484A (en) * | 2017-03-03 | 2018-06-29 | 绍兴迅敏康生物科技有限公司 | One-step method detects EBV, CMV, the kit and detection method of HSV-6 herpesvirals simultaneously |
| CN112195174A (en) * | 2019-07-08 | 2021-01-08 | 浙江智扬生物科技有限公司 | Cell lysis reagent containing graphene oxide |
| CN112195175A (en) * | 2019-07-08 | 2021-01-08 | 浙江智扬生物科技有限公司 | Nucleic acid extraction method based on graphene oxide |
| CN118240982A (en) * | 2024-05-22 | 2024-06-25 | 深圳市明鉴检测专业技术有限公司 | Herpesvirus detection kit and detection method |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101701267A (en) * | 2009-11-26 | 2010-05-05 | 戴立忠 | Fluorescence quantitative PCR detection kit of hepatitis B virus and application thereof |
| CN102978201A (en) * | 2012-12-24 | 2013-03-20 | 厦门大学 | Application of graphene in polymerase chain reaction as reinforcing agent |
| CN103060473A (en) * | 2013-01-10 | 2013-04-24 | 湖南圣湘生物科技有限公司 | Herpes virus EBV (Epstein-Barr Virus) detection kit |
| CN104977194A (en) * | 2014-04-10 | 2015-10-14 | 北京雷根生物技术有限公司 | Method of accelerating sample treatment with addition of graphene |
| CN105713900A (en) * | 2016-03-29 | 2016-06-29 | 广州市玛达生物科技有限公司 | Nucleic acid extraction method based on magnetic graphene nano-composites |
-
2017
- 2017-01-12 CN CN201710021612.2A patent/CN106755584B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101701267A (en) * | 2009-11-26 | 2010-05-05 | 戴立忠 | Fluorescence quantitative PCR detection kit of hepatitis B virus and application thereof |
| CN102978201A (en) * | 2012-12-24 | 2013-03-20 | 厦门大学 | Application of graphene in polymerase chain reaction as reinforcing agent |
| CN103060473A (en) * | 2013-01-10 | 2013-04-24 | 湖南圣湘生物科技有限公司 | Herpes virus EBV (Epstein-Barr Virus) detection kit |
| CN104977194A (en) * | 2014-04-10 | 2015-10-14 | 北京雷根生物技术有限公司 | Method of accelerating sample treatment with addition of graphene |
| CN105713900A (en) * | 2016-03-29 | 2016-06-29 | 广州市玛达生物科技有限公司 | Nucleic acid extraction method based on magnetic graphene nano-composites |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108220484A (en) * | 2017-03-03 | 2018-06-29 | 绍兴迅敏康生物科技有限公司 | One-step method detects EBV, CMV, the kit and detection method of HSV-6 herpesvirals simultaneously |
| CN108220484B (en) * | 2017-03-03 | 2020-10-16 | 绍兴迅敏康生物科技有限公司 | Kit for simultaneously detecting EBV, CMV and HSV-6 herpes viruses by one-step method and detection method |
| CN107164561A (en) * | 2017-06-08 | 2017-09-15 | 江苏默乐生物科技股份有限公司 | A kind of primer and probe group and kit for Epstein-Barr virus fluorescence quantitative PCR detection |
| CN112195174A (en) * | 2019-07-08 | 2021-01-08 | 浙江智扬生物科技有限公司 | Cell lysis reagent containing graphene oxide |
| CN112195175A (en) * | 2019-07-08 | 2021-01-08 | 浙江智扬生物科技有限公司 | Nucleic acid extraction method based on graphene oxide |
| CN118240982A (en) * | 2024-05-22 | 2024-06-25 | 深圳市明鉴检测专业技术有限公司 | Herpesvirus detection kit and detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106755584B (en) | 2019-07-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755584B (en) | A kind of ebb virus's detection kit and detection method | |
| CN105420403B (en) | A kind of real time fluorescence quantifying PCR method for carrying out magnetic bead in a pipe and extracting nucleic acid and amplification | |
| CN110283940A (en) | Nucleic acid compositions, the detection kit of influenza virus and micro-fluidic chip | |
| CN102154510B (en) | Nucleic acid quantitative detection kit for hepatitis C virus (HCV) | |
| CN103060473B (en) | Herpes virus EBV (Epstein-Barr Virus) detection kit | |
| CN102839169B (en) | Kits for extracting enterovirus RNA and corresponding method for extracting and purifying enterovirus RNA | |
| CN109385418A (en) | A kind of method extracted for virus in animal specimen/bacterial nucleic acid and reagent | |
| CN101586162B (en) | Method of extracting target nucleic acid and performing PCR amplification | |
| CN103509877A (en) | Fluorescence quantitative PCR kit used for detecting PRV, and application thereof | |
| CN103710338A (en) | Kit for extracting DNA (deoxyribonucleic acid) from white cells in human whole blood | |
| CN108753767A (en) | A kind of Viral nucleic acid extraction reagent box and extracting method | |
| CN103122396B (en) | Kit for detecting human cytomegalovirus (HCMV) | |
| CN109762874A (en) | Nucleic acid settling agent, pregnant woman blood plasma dissociative DNA extracts kit and method | |
| CN105695624B (en) | The method for quick identification in crude heparin sodium different genera source | |
| CN106957924A (en) | It is a kind of simultaneously to detect and differentiate porcine reproductive respiratory syndrome and the detection kit and primer and probe of swine flu | |
| CN103184214A (en) | Hepatitis B virus nucleic acid rapid extraction reagent | |
| CN102827947B (en) | Kit and detection method for rapid quantitative detection of hepatitis virus nucleic acid | |
| CN103184295B (en) | A kind of hbv nucleic acid quantitative detecting method and test kit | |
| CN105296676A (en) | Fluorescent quantitative PCR detecting kit for hepatitis E virus and using method of fluorescent quantitative PCR detecting kit | |
| CN105420411A (en) | Nucleic acid fluorescence PCR detection kit for universal enterovirus, coxsackievirus A16 and enterovirus 71 | |
| CN101570798B (en) | Detection kit and detection method for 3 species of food-borne viruses in marine products | |
| CN103789420A (en) | Fluorescence quantitative polymerase chain reaction (PCR) detection kit for alpha-thalassemia and application thereof | |
| CN101948936B (en) | Real-time fluorescence PCR method for detecting norovirus in aquatic product | |
| CN111808721B (en) | Nucleic acid extraction chip and method for rapidly extracting blood DNA by using same | |
| CN103074429B (en) | UU (ureaplasma urealyticum) detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20190612 Address after: 314113 Building 101, No. 371 Hongye Road, Dayun Town, Jiashan County, Jiaxing City, Zhejiang Province (Residence Declaration) Applicant after: Aiji Taikang (Jiaxing) Biotechnology Co., Ltd. Address before: 510530 Guangzhou High-tech Industrial Development Zone, Guangdong Province Applicant before: Hua Hong bio tech ltd, Guangzhou |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |