CN106755562B - QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular marker related to soybean root surface area and application - Google Patents
QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular marker related to soybean root surface area and application Download PDFInfo
- Publication number
- CN106755562B CN106755562B CN201710203602.0A CN201710203602A CN106755562B CN 106755562 B CN106755562 B CN 106755562B CN 201710203602 A CN201710203602 A CN 201710203602A CN 106755562 B CN106755562 B CN 106755562B
- Authority
- CN
- China
- Prior art keywords
- surface area
- qtl
- molecular marker
- soybean
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a QTL (quantitative trait locus) and SNP (Single nucleotide polymorphism) molecular marker related to the soybean root surface area and application thereof, relates to the field of soybean molecular breeding, discovers a new QTL related to the soybean root surface area, and applies the new QTL to breeding of soybean root surface area characters. A QTL related to the surface area of soybean root is located in the M45646-M45636 interval of chromosome 9 and is positioned by SNP molecular markers M45646 and M45636. The molecular markers closely linked with the QTL are M45646 and M45636, the nucleotide sequence of M45646 is shown in SEQ ID NO.1, and the nucleotide sequence of M45636 is shown in SEQ ID NO. 2. The QTL and the molecular marker can be used for molecular marker-assisted selective breeding, so that the selection efficiency of materials with larger root surface areas is remarkably improved, and an economical and effective molecular breeding new way is provided for further enriching soybean root surface area regulation and control networks.
Description
Technical Field
The invention relates to the field of soybean molecular breeding, in particular to QTL (quantitative trait locus) and SNP (Single nucleotide polymorphism) molecular markers related to soybean root surface area and application thereof.
Background
The roots play an extremely important role in the growth and development of soybeans. The soybean has roots divided into main and lateral roots, and can be planted 1.5m deep into the soil to form bell-shaped root systems. The major roots of the soybeans are distributed in a surface soil cultivated layer of 0-20 cm, main roots of 7-8 cm below the ground surface are large, main branch roots also grow on the major roots, and the branch roots expand in parallel to the four directions after growing from the main roots and can reach more than 40-50 cm. The extension length and the surface area of the roots of different varieties are greatly different, and the general variety with large root surface area has good yielding ability and strong stress resistance. However, studies on the surface area of soybean roots are far less extensive than the above-ground.
In soybean breeding, due to the lack of root system research information, only selection of overground parts is focused, and the root surface area is rarely considered, so that the success of breeding work is influenced to a great extent. The root surface area characteristics of soybean varieties are deeply researched, and varieties with good comprehensive properties can be selected. However, the root surface area is difficult to observe visually, direct selection is not facilitated, and the genetic improvement process of the root surface area can be improved remarkably through molecular marker-assisted selection. At present, Quantitative Trait Locus (QTL) positioning research on soybean root surface area related genes is carried out rarely through linkage analysis, only 3 QTLs related to soybean root surface area are found to be distributed on chromosomes 1 and 11, and related action mechanisms and application research are not carried out fully. Therefore, there is a need to find a molecular marker which can more effectively reflect the soybean root surface area QTL and related SNP (single nucleotide polymorphism), and further apply the molecular marker in genetic improvement of soybean root surface area.
Disclosure of Invention
The invention aims to provide a QTL and SNP molecular marker related to the surface area of soybean roots and application thereof, so as to solve the technical problems. The invention discovers 1 QTL related to the surface area of the root, the marker interval is only 0.252cM, and the SNP marker is screened to be closely linked with the target character, so that the method can be used for molecular marker-assisted selective breeding, and the selection efficiency of the material with larger surface area of the root is obviously improved.
The technical problem to be solved by the invention is realized by adopting the following technical scheme:
a QTL associated with soybean root surface area characterized by: the QTL related to the surface area of soybean roots is located in the M45646-M45636 interval of chromosome 9 and is positioned by SNP molecular markers M45646 and M45636.
An SNP molecular marker closely linked with QTL, wherein the SNP molecular marker is M45646, the nucleotide sequence of the M45646 is shown as SEQ ID NO.1, and the amplification primers of the M45646 are as follows:
M46F: 5'-GTGCTTGGTGTTTAGATAAGGG-3', as shown in SEQ ID NO. 3;
M46R: 5'-ATACCTGGGTCATTCTCCC-3', as shown in SEQ ID NO. 4.
An SNP molecular marker closely linked with QTL, wherein the molecular marker is M45636, the nucleotide sequence of the M45636 is shown as SEQ ID NO.2, and the amplification primer of the M45636 is as follows:
M36F: 5'-CGATCCTTTGTGAGTGTGGGT-3', as shown in SEQ ID NO. 5;
M36R: 5'-GTTGTGAGCACGATTCGGC-3', as shown in SEQ ID NO. 6.
The application of the QTL related to the soybean root surface area in the soybean root surface area character breeding.
The SNP molecular marker is applied to the auxiliary selection breeding of the soybean root surface area character molecular marker according to the following technical scheme:
1) extracting genomic DNA of a material to be identified by using a CTAB method;
2) performing PCR amplification by using primers of M45646 and M45636 to obtain an M45646 amplification product and an M456366 amplification product respectively;
3) sequencing the M45646 amplification product and the M45636 amplification product respectively;
4) the surface area of the A radical at the 140 th position of the 5 'end of the M45646 amplification product is large, and the surface area of the G radical at the 88 th position of the 5' end of the M45636 amplification product is large.
The invention further adopts the technical scheme that:
a QTL associated with soybean root surface area characterized by: the QTL related to the soybean root surface area, wherein the QTL is positioned in a chromosome 9 mapping interval of M45646-M45636 and is carried out according to the following technical scheme:
crossing one thousand soybean varieties with wild beans in long green, and pairing F1Selfing the seeds obtained by the generation to obtain a high-generation recombinant inbred line population (RIL);
secondly, developing a high-density molecular label for the RIL separation population by utilizing an SLAF-seq (Specific-local Amplified Fragment Sequencing) technology and HighMap software, and constructing a genetic map;
thirdly, carrying out QTL analysis by adopting a CIM method of software rQTL, and carrying out genetic mapping on the surface area of the soybean root by taking LOD (LOD) more than or equal to 3 as a standard;
hybridizing one thousand soybean varieties with wild beans in long mountains, selecting seeds from 200 offspring, continuously planting, and selfing for multiple generations to obtain a soybean variety containing 200F5:8The method comprises the following steps of (1) constructing a genetic map of 20 chromosomes of soybean by using a recombinant inbred line group consisting of strains, wherein the genetic map comprises the following steps:
(1) extracting parental and 200 progeny genomic DNAs by using a CTAB method;
(2) carrying out enzyme digestion on genome DNA of each sample qualified for detection by utilizing RsaI and HaeIII respectively, selecting an SLAF fragment with the genome fragment range of 364-;
(3) according to the positioning result of sequencing Reads on a reference genome, performing local re-alignment (local alignment), GATK mutation detection and samtools mutation detection on GATK, taking intersection mutation sites obtained by the GATK method and the samtools method, and the like to ensure the accuracy of SNP obtained by detection, and finally screening 111399 available SNP labels;
(4) screening 4902 SNP labels according to the SNP label filtering rule with the integrity of less than 70% and serious segregation, dividing the SNP into 20 linkage groups by positioning with a reference genome, calculating MLOD values between every two labels, sharing 4564 SNP labels on a picture, analyzing by using HighMap software to obtain linear arrangement of markers in the linkage groups by taking the linkage groups as units, estimating the genetic distance between adjacent markers, and finally obtaining a genetic map with the total map distance of 3,403.90 cM;
the invention utilizes a multi-interval mapping method of rQTL mapping software, and carries out QTL analysis on the surface area of soybean roots by taking LOD (Long distance display) more than or equal to 3 as a standard; the QTL interval M45646-M45636 is found on chromosome 2, as shown in Table 1,
TABLE 1 Soybean root surface area QTL Interval
The application of QTL related to the surface area of soybean roots is characterized in that: SNP molecular markers which are closely linked with QTL related to the surface area of soybean roots are M45646 and M45636, and the SNP molecular markers are fragments obtained by taking genome DNA of a material to be identified as a template and carrying out PCR amplification by using primers;
wherein, the amplification primers of M45646 are as follows:
M46F: 5'-GTGCTTGGTGTTTAGATAAGGG-3' is shown as SEQ ID NO. 3;
M46R: 5'-ATACCTGGGTCATTCTCCC-3' is shown in SEQ ID NO. 4.
The amplification primers of M45636 are:
M36F: 5'-CCAATGAGTGTAACTTGTCCAG-3' is shown as SEQ ID NO. 5;
M36R: 5'-GTTGTGAGCACGATTCGGC-3' is shown in SEQ ID NO. 6.
The specific steps of utilizing the SNP molecular marker to assist in judging the surface area of the root are as follows:
1. extraction of genomic DNA of material to be identified by CTAB method
1) Adding liquid nitrogen into fresh soybean leaves, grinding into powder, and putting a proper amount of the powder into a 1.5mL centrifuge tube;
2) adding 0.6mL of preheated CTAB extracting solution, reversing and mixing uniformly for several times, carrying out water bath for one hour at the temperature of 65 ℃, mixing uniformly once every 15min, and centrifuging at 12000rpm for 15 min;
3) add 0.6mL 24:1(V/V) chloroform: inverting the isoamyl alcohol solution, mixing uniformly for 5-10 times, and centrifuging at 10000rpm for 15 min;
4) the supernatant solution was transferred to another empty centrifuge tube and the tube was washed with 24:1(V/V) chloroform: re-extracting the isoamyl alcohol solution once, adding 50 microliter RNase (10mg/mL), and standing at room temperature for 30 min;
5) adding equal volume of isopropanol precooled at-20 deg.C, centrifuging at-20 deg.C for 30min in a refrigerator at 5000rpm for 10min to remove supernatant;
6) washing twice with 70% ethanol, drying, dissolving with sterilized water to obtain genome template DNA, and storing in a refrigerator at 4 deg.C;
7) detecting the concentration of the DNA by using 0.8% agarose, and diluting the DNA to a working concentration for PCR amplification;
2. performing PCR amplification by using primers of M45646 and M45636 to obtain an M45646 amplification product, an M45646 amplification product and an M456366 amplification product respectively;
1) PCR amplification System: the total volume was 20. mu.L, including 2. mu.L of 10ng genomic template DNA, 10. mu.L of 2 XEs TaqMasterMix, 2. mu.L of 10mM primers each, and ddH2O 4μL；
2) PCR amplification conditions: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 45s, and extension at 72 ℃ for 45 s; circulating for 35 times; final extension at 72 deg.C for 10 min;
3. judging the root surface area according to the sequence comparison result
Sequencing the M45646 amplification product and the M45636 amplification product respectively, wherein the 140 th position of the M45646 amplification product from the 5' end is A in one thousand female parent beans and G in long-ridge male parent wild beans; the 88 th site of the M45636 amplification product from the 5' end is G in one thousand of female parent and T in the long-ridge wild bean of male parent; when the SNPs of the sub-generations are consistent with the female parent, the root surface area is large, when the SNPs are consistent with the male parent, the root surface area is small, the judgment accuracy of M45646 is 89.2%, and the judgment accuracy of M45636 is 83.4%, so that the SNP molecular markers M45646 and M45636 can be used as co-dominant molecular markers of the root surface area of the soybean.
The invention has the beneficial effects that:
the intervals of M45646-M45636 according to the present invention are ideal mark intervals of soybean root surface area (see Table 1), wherein M45646 is the highest LOD and the contribution rate is 13.11%. The additive effect of the QTL closely linked to this marker is negative, i.e. one thousand grains of this QTL allele give an increase in root surface area. Therefore, from the perspective of the location of the QTL, or the contribution rate of the QTL to the phenotype, the interval M45646-M45636 is the ideal marker interval for soybean root surface area. The important significance of the soybean root surface area chromosome mapping interval M45646-M45636 provided by the invention and shown in the table 1 is that a most economical and effective new molecular breeding way is provided for further enriching a soybean root surface area regulation network.
Drawings
FIG. 1 is a genetic map of the M45646-M45636 interval on chromosome 9 and a QTL mapping interval.
Detailed Description
The present invention will be further described with reference to specific embodiments for the purpose of facilitating an understanding of technical means, characteristics of creation, objectives and functions realized by the present invention, but the following embodiments are only preferred embodiments of the present invention, and are not intended to be exhaustive. Based on the embodiments in the implementation, other embodiments obtained by those skilled in the art without any creative efforts belong to the protection scope of the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified, and materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Construction of genetic population
Sexual hybridization is carried out by taking one thousand soybean local varieties with large root surface area as female parents and long-ridge wild beans with small root surface area as male parents, F1The generation selects the single plant with good growth vigor and more fruit to harvest, then adopts the single seed transmission method to breed and add generation to F5Then harvesting the single plant, planting the plant in the next year into a plant line, continuously planting the plant for 3 generations to obtain F5:8And (4) selecting 200 families randomly from the families to construct a genetic map.
Second, construction of genetic map
1. Extracting parent and 200 filial generations F by CTAB method5:8Pedigree DNA was checked for DNA concentration using Thermo nanodrop 2000 and DNA purity and integrity using 1% agarose electrophoresis.
2. The method comprises the following steps of developing high-density molecular labels for 2 parents and 200 offspring by utilizing an SLAF-seq technology and HighMap software independently developed by Beijing Baimaike biotechnology limited to construct a genetic map, wherein the specific steps are as follows:
(1) the enzyme digestion scheme is as follows: enzyme digestion prediction is carried out on the published soybean reference genome by utilizing enzyme digestion prediction software, and endonuclease RsaI and HaeIII are selected
Carrying out enzyme digestion on each sample genome qualified for detection, and selecting the SLAF fragment with the genome fragment range of 364 and 414 bp.
(2) Sequencing process: the obtained SLAF Fragment was treated with Klenow Fragment (3 ' → 5 ' exo-) (NEB) and dATP at 37 ℃ for 3 ' end addition A, ligated with Dual-index sequencing adaptors, PCR amplified (PCR amplification primer: FAATGATACGGCGACCACCGA R CAAGCAGAAGACGGCATACG), purified (Agencour AMPure XP beads (Beckman Coulter, High Wycombe, UK)), mixed, cut to extract the desired Fragment, and the library was qualified and sequenced with Illumina HiSeqTM 2500. To evaluate the accuracy of the library construction experiment, rice (Oryza sativa) was selected as a Control (Control) for the same treatment to participate in library construction and sequencing.
(3) SNP tagging and genotyping: (3) according to the positioning result of sequencing Reads on a reference genome, performing Local re-alignment (Local alignment), GATK mutation detection and samtools mutation detection on GATK, taking intersection mutation sites obtained by the GATK method and the samtools method, and the like on GATK and samtools to ensure the accuracy of the SNP obtained by detection, and finally screening 111399 available SNP labels.
(4) And (4) screening the upper icon labels: in order to avoid the influence of the SNP aggregation phenomenon on the chromosome on the construction process of the genetic map, redundancy removal processing is carried out on part of the tags before analysis, and for each contig/superconting, within a window with a certain size (120 kb is adopted in the project), a unique Marker with the highest depth mean value is taken to represent the section for subsequent analysis, and 4902 SNP tags are screened out in total.
(5) Linkage analysis: and dividing the selected 4902 SNP labels into 20 linkage groups by positioning with a reference genome, and calculating MLOD values between every two SNP labels, wherein 4564 SNP labels are positioned on the upper graph and are positioned as upper graph markers (Marker). And analyzing by using HighMap software to obtain linear arrangement of the markers in the linkage group by taking the linkage group as a unit, and estimating the genetic distance between adjacent markers to finally obtain a genetic map with the total map distance of 3403.90 cM.
Thirdly, artificially inoculating and identifying the root surface area of the parent and 200 filial generations
The test was conducted in an Anpu Intelligent greenhouse of agricultural science institute of Jilin province two times in 2015, 1 month to 2016, 12 months.
1. Soybean plant culture: river sand is used as a cultivation medium, the height of a cultivation barrel is 30cm, the diameter of the cultivation barrel is 25cm, each material is 3 barrels, and 4 plants are planted in each barrel. Sowing at the same period, and watering 1L of nutrient solution (conventional formula) every 10 days after seedling emergence.
2. Root surface area identification: and when the material reaches the R7 stage, taking root systems below cotyledonary nodes, and scanning the root systems by using an LA-S series plant root system analyzer/root system analysis system to obtain root surface area data.
Fourth, QTL analysis of soybean root surface area
And carrying out QTL analysis on the surface area of the soybean root by utilizing the average value of the surface areas of the two batches of roots and the constructed genetic map with the total map distance of 3403.90cM and adopting a multi-interval mapping method of rQTL mapping software by taking the LOD (Long distance detection) not less than 3 as a standard. The QTL interval M45646-M45636 was found on chromosome 9 as shown in Table 1.
TABLE 1 Soybean root surface area QTL Interval
Application of QTL interval marker for surface area of five roots and root
SNP molecular markers which are closely linked with QTL related to the surface area of soybean roots are M45646 and M45636, and the SNP molecular markers are fragments obtained by taking genome DNA of a material to be identified as a template and carrying out PCR amplification by using primers; wherein the nucleotide sequence of M45646 is shown in SEQ ID NO.1, and the nucleotide sequence of M45636 is shown in SEQ ID NO. 2.
Wherein, the amplification primers of M45646 are as follows:
M46F: 5'-GTGCTTGGTGTTTAGATAAGGG-3' is shown as SEQ ID NO. 3;
M46R: 5'-ATACCTGGGTCATTCTCCC-3' is shown in SEQ ID NO. 4.
The amplification primers of M45636 are:
M36F: 5'-CCAATGAGTGTAACTTGTCCAG-3' is shown as SEQ ID NO. 5;
M36R: 5'-GTTGTGAGCACGATTCGGC-3' is shown in SEQ ID NO. 6.
The specific steps of utilizing the SNP molecular marker to assist in judging the surface area of the root are as follows:
1. extraction of genomic DNA of material to be identified by CTAB method
1) Adding liquid nitrogen into fresh soybean leaves, grinding into powder, and placing a proper amount of the powder into a 1.5mL centrifuge tube.
2) Adding 0.6mL of preheated CTAB extract, mixing several times by inversion, water-bathing at 65 deg.C for one hour, mixing once every 15min, and centrifuging at 12000rpm for 15 min.
3) Add 0.6mL 24:1(V/V) chloroform: and (3) inverting the isoamyl alcohol solution, mixing uniformly for 5-10 times, and centrifuging at 10000rpm for 15 min.
4) The supernatant solution was transferred to another empty centrifuge tube and the tube was washed with 24:1(V/V) chloroform: the isoamyl alcohol solution was re-extracted once, and then 50. mu.L of RNase (10mg/mL) was added and left at room temperature for 30 min.
5) Adding equal volume of-20 deg.C pre-cooled isopropanol, centrifuging at-20 deg.C for 30min in a refrigerator at 5000rpm for 10min, and removing supernatant.
6) Washed twice with 70% ethanol. And (3) drying, dissolving with sterilized water to obtain genome template DNA, and storing the genome template DNA in a refrigerator at 4 ℃ for later use.
7) The DNA concentration was checked with 0.8% agarose and diluted to the working concentration for PCR amplification.
2. PCR amplification is carried out by using primers of M45646 and M45636 respectively to obtain an M45646 amplification product, an M45646 amplification product and an M456366 amplification product respectively.
1) PCR amplification System: the total volume was 20. mu.L, including 2. mu.L of 10ng genomic template DNA, 10. mu.L of 2 XEs TaqMasterMix, 2. mu.L of 10mM primers each, and ddH2O 4μL。
2) PCR amplification conditions: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 45s, and extension at 72 ℃ for 45 s; circulating for 35 times; final extension at 72 ℃ for 10 min.
3. Judging the root surface area according to the sequence comparison result
Sequencing the M45646 amplification product and the M45636 amplification product respectively, wherein the 140 th position of the M45646 amplification product from the 5' end is A in one thousand female parent beans and G in long-ridge male parent wild beans; the 88 th position of the M45636 amplification product from the 5' end is G in one thousand of female parent and T in long-ridge wild bean of male parent. When the SNPs of the sub-generations are consistent with the female parent, the root surface area is large, when the SNPs are consistent with the male parent, the root surface area is small, the judgment accuracy of M45646 is 89.2%, and the judgment accuracy of M45636 is 83.4%, so that the SNP molecular markers M45646 and M45636 can be used as co-dominant molecular markers of the root surface area of the soybean.
QTL intervals of M45646-M45636 in the invention are ideal mark intervals of soybean root surface areas (shown in Table 1), wherein M45646 is the highest LOD point, and the contribution rate is 13.11%. The additive effect of the QTL interval closely linked to this marker is negative, i.e. one thousand particles are donors for this QTL. Therefore, both from the point of view of the QTL interval and the contribution rate of the QTL interval to the phenotype, the interval M45646-M45636 is an ideal marker interval of the soybean root surface area.
FIG. 1 is a genetic map of an M45646-M45636 interval and a QTL mapping interval on a chromosome 9, as shown in FIG. 1, the soybean root surface area chromosome (09) mapping interval M45646-M45636 provided by the invention as shown in Table 1 is only 0.252cM and has a small distance, and the screened molecular markers M45646 and M45636 are closely linked and significantly related to the soybean root surface area, so that the soybean root surface area chromosome molecular marker can be used for molecular marker-assisted selective breeding, the material selection efficiency of large root surface area is significantly improved, and a most economical and effective new molecular breeding way is provided for further enriching soybean root surface area regulation and control networks.
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Sequence listing
Sequence listing
<110> Jilin province academy of agricultural sciences
<120> QTL (quantitative trait locus), SNP (Single nucleotide polymorphism) molecular marker related to soybean root surface area and application
<160>6
<170>PatentIn version 3.3
<210>1
<211>220
<212>DNA
<213> Artificial sequence
<400>1
gtgcttggtg tttagataag ggtgatatat ggctatttaa tgtggtctca catggtattc 60
cacttaacat ttttgcagga tccagacaac aatgcttgca tggcttattg gctatccaac 120
acatcttctt tgtttttcca tcttcagcaa tgtctaagag tacctacaac acggaaacca 180
cccactccaa cgtcattttt cgggagaatg acccaggtat 220
<210>2
<211>212
<212>DNA
<213> Artificial sequence
<400>2
ccaatgagtg taacttgtcc agcgagcaga acaagctgaa gagtgacttt tggaatttac 60
aaagaactcg cccagtgagt cttactcgct caacgagtat tgtgttctct aaagtgatga 120
gacaacgaca ttgggcccat tataaaaggg gcattccctt aaggataaaa aagaatcaac 180
ttagggcaca tcgaggtgcg gaaatacaaa gc 212
<210>3
<211>22
<212>DNA
<213> Artificial sequence
<400>3
gtgcttggtg tttagataag gg 22
<210>4
<211>19
<212>DNA
<213> Artificial sequence
<400>4
atacctgggt cattctccc 19
<210>5
<211>21
<212>DNA
<213> Artificial sequence
<400>5
cgatcctttg tgagtgtggg t 21
<210>6
<211>19
<212>DNA
<213> Artificial sequence
<400>6
gttgtgagca cgattcggc 19
Claims (3)
1. An SNP molecular marker closely linked with QTL related to the surface area of soybean roots is characterized in that the QTL related to the surface area of the soybean roots is positioned in the M45646-M45636 interval of No. 9 chromosome, and is positioned by the nucleic acid sequences SEQ ID NO.1 and SEQ ID NO.2 of the SNP molecular marker M45646 and M45636; the SNP molecular marker is M45646, the nucleotide sequence of M45646 is shown in SEQ ID NO.1, and the amplification primer of M45646 is:
M46F: 5'-GTGCTTGGTGTTTAGATAAGGG-3', as shown in SEQ ID NO. 3;
M46R: 5'-ATACCTGGGTCATTCTCCC-3', as shown in SEQ ID NO. 4.
2. An SNP molecular marker closely linked with QTL related to the surface area of soybean roots is characterized in that the QTL related to the surface area of the soybean roots is positioned in the M45646-M45636 interval of No. 9 chromosome, and is positioned by the nucleic acid sequences SEQ ID NO.1 and SEQ ID NO.2 of the SNP molecular marker M45646 and M45636; the molecular marker is M45636, the nucleotide sequence of M45636 is shown in SEQ ID NO.2, and the amplification primer of M45636 is:
M36F: 5'-CGATCCTTTGTGAGTGTGGGT-3', as shown in SEQ ID NO. 5;
M36R: 5'-GTTGTGAGCACGATTCGGC-3', as shown in SEQ ID NO. 6.
3. The SNP molecular marker according to claim 1 or 2, wherein the application of the SNP molecular marker in the auxiliary selection and breeding of the soybean root surface area character molecular marker is carried out according to the following technical scheme:
1) extracting genomic DNA of a material to be identified by using a CTAB method;
2) performing PCR amplification by using primers of M45646 and M45636 to obtain an M45646 amplification product and an M456366 amplification product respectively;
3) sequencing the M45646 amplification product and the M45636 amplification product respectively;
4) the surface area of the A radical at the 140 th position of the 5 'end of the M45646 amplification product is large, and the surface area of the G radical at the 88 th position of the 5' end of the M45636 amplification product is large.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710203602.0A CN106755562B (en) | 2017-03-30 | 2017-03-30 | QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular marker related to soybean root surface area and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710203602.0A CN106755562B (en) | 2017-03-30 | 2017-03-30 | QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular marker related to soybean root surface area and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106755562A CN106755562A (en) | 2017-05-31 |
| CN106755562B true CN106755562B (en) | 2020-06-12 |
Family
ID=58965705
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710203602.0A Expired - Fee Related CN106755562B (en) | 2017-03-30 | 2017-03-30 | QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular marker related to soybean root surface area and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755562B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107988422B (en) * | 2018-01-29 | 2021-01-12 | 吉林省农业科学院 | SNP (Single nucleotide polymorphism) marker related to oil content of soybean seeds, interval, primer and application |
| CN112735519B (en) * | 2021-01-11 | 2022-08-30 | 华中农业大学 | Method, device and storage medium for positioning segregation character |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101619357B (en) * | 2009-07-31 | 2012-09-26 | 东北农业大学 | Method for obtaining EST-SSR mark |
| CN105543222B (en) * | 2016-02-29 | 2019-05-07 | 南京农业大学 | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application |
-
2017
- 2017-03-30 CN CN201710203602.0A patent/CN106755562B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN106755562A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755561B (en) | QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular marker related to soybean root dry weight and application | |
| CN106755480B (en) | SSR molecular marker I for identifying progeny plants of Gala apples and application thereof | |
| CN103952402B (en) | A kind of SNP site relevant to root system of plant proterties and application thereof | |
| CN108060261B (en) | Method for capturing and sequencing corn SNP marker combination and application thereof | |
| CN103882146B (en) | Four-primer molecular marking method for identifying different genotypes of rice grain length gene GS3 | |
| CN109055395B (en) | Photoperiod insensitive Hd1 allele and molecular marker and application thereof | |
| CN106978494B (en) | QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular marker related to salt tolerance of soybeans and application | |
| CN111910013A (en) | InDel molecular marker closely linked with anthocyanin synthetic gene of eggplant, primer and application thereof | |
| CN106498048B (en) | One kind QTL relevant to soybean nodulation number, SNP marker and application | |
| CN106755562B (en) | QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular marker related to soybean root surface area and application | |
| CN108103238A (en) | V. amurensis SNP marker and the application in genetic map construction, the positioning of white rot resistance | |
| CN110684858A (en) | Molecular marker of rice long and thin grain type gene and application thereof | |
| CN111926104B (en) | SSR molecular marker for identifying authenticity of sugarcane and festuca arundinacea filial generation and method thereof | |
| CN106755413B (en) | Rice nitrogen absorption and utilization site qNUE6 and molecular marking method thereof | |
| CN108085404B (en) | Strong female-like molecular marker of pumpkin indicum and primer pair for identifying strong female-like character of pumpkin indicum | |
| CN106399538B (en) | Application of SNP (single nucleotide polymorphism) marker closely linked with peach tree dwarfing gene | |
| CN114875168A (en) | InDel marker for identifying existence of granuloma on surface of bitter gourd fruit as well as detection primer and application thereof | |
| CN111394502B (en) | InDel marker and method for identifying RN type CMS (cytoplasmic male sterility) restoring gene of soybean | |
| CN107130019B (en) | Molecular marker primer of rice local variety thin rice panicle blast resistance gene and application thereof | |
| CN111635958A (en) | Molecular marker linked with rice cold-resistant gene qSF12 and application thereof | |
| CN111004857A (en) | Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer | |
| CN111378778B (en) | Molecular marker closely linked with cowpea weevil resistance QTL locus and application thereof in cowpea weevil resistance molecular marker assisted breeding | |
| CN106609297B (en) | Molecular marker for powdery mildew of pumpkin and primer pair for identifying powdery mildew resistance traits of pumpkin | |
| CN112626256B (en) | Sesame seedling stage drought tolerance molecular marker and application thereof | |
| CN111057786B (en) | SNP marker closely linked with cucumber seed pre-harvest germination resistance character and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200612 Termination date: 20210330 |