CN107988422B

CN107988422B - SNP (Single nucleotide polymorphism) marker related to oil content of soybean seeds, interval, primer and application

Info

Publication number: CN107988422B
Application number: CN201810083844.5A
Authority: CN
Inventors: 王洋; 王跃强; 邱红梅; 侯云龙; 马晓萍; 于妍; 高淑芹; 陈健; 胡金海; 王丽
Original assignee: Jilin Academy of Agricultural Sciences
Current assignee: Jilin Academy of Agricultural Sciences
Priority date: 2018-01-29
Filing date: 2018-01-29
Publication date: 2021-01-12
Anticipated expiration: 2038-01-29
Also published as: CN107988422A

Abstract

The invention belongs to the technical field of soybean molecular biology, and particularly relates to an SNP (single nucleotide polymorphism) marker, an interval, a primer and application related to oil content of soybean seeds. The SNP marker is located at 43173920 th position of the No. 18 chromosome of the soybean, and the nucleotide of the SNP marker is A or T; the nucleotide sequence of the marker sequence is shown as SEQ ID NO. 1; the marker interval is the interval from position 43163920 to position 43183920 of chromosome 18 of soybean. The SNP marker belongs to a co-dominant marker, is reliable and convenient to use, provides great convenience for breeding of soybean high-oil-content strains, and can be applied to molecular marker assisted selection in soybean seed oil content component improvement and application in fine positioning of related genes of the seed oil content and map-based cloning, so that the improvement process of the soybean seed oil content character is accelerated.

Description

SNP (Single nucleotide polymorphism) marker related to oil content of soybean seeds, interval, primer and application

Technical Field

The invention belongs to the technical field of soybean molecular biology, and particularly relates to an SNP (single nucleotide polymorphism) marker, an interval, a primer and application related to oil content of soybean seeds.

Background

Soybean is an important oil crop, and the oil and fat of the soybean are important sources of food industry, industrial deep processing and medical health care medicines. The content of unsaturated fatty acid in soybean oil is up to 85%, wherein linoleic acid and linolenic acid are essential fatty acids for human body, and the soybean oil has important physiological functions of reducing serum cholesterol and triglyceride, softening blood vessels and the like, and is called as 'safe fatty acid' by nutriologists. Studies on phenotypic identification of soybean oil have been reported for a long time. The soybean germplasm resources have wide genetic variation in oil content and fatty acid components. The oil content of 18840 soybean germplasm resources is determined by scientists, the germplasm with the oil content between 15.10% and 20.00% is 92.40%, the specific germplasm with the oil content less than 15.10% or more than 20.00% is less than 7.60%, and the genetic diversity index is 2.61. The phenotype identification of oil content of germplasm resources lays a foundation for germplasm innovation and breeding, but the germplasm resources are more, have larger data volume and lack of fatty acid component level evaluation, and are not beneficial to the utilization of high-oil germplasm.

In more than ten years, with the development of sequencing technology, researchers have more comprehensive knowledge of soybean genome. Genome re-sequencing research on 17 wild soybeans and 14 cultivated soybeans shows that more than 630 ten thousand SNPs are found, and analysis shows that the soybeans have high Linkage Disequilibrium (LD) and are beneficial to correlation analysis of target traits. In 1996, the LD was first used to locate the bipolar disorder-associated gene. Association analysis is one type of LD application that detects whether genetic variation of some markers or candidate genes within a population that are in the LD state are significantly associated with a particular phenotype more frequently than is desired. At present, the correlation analysis is widely applied to plant research, such as soybean seed protein content, rice amino acid components, triticale aluminum toxicity resistance and the like. In recent years, the development of functional markers for target traits by correlation analysis has become one of the hot spots in molecular biology research. Molecular marker assisted selection can significantly improve the genetic improvement process of the oil content of the seeds.

Until now, Quantitative Trait Locus (QTL) location research on soybean seed oil content related genes has been performed through linkage analysis, and it has been found that more than 100 QTLs related to soybean seed oil content are mainly distributed on linkage groups such as F, G, M, C2 and I, and related action mechanisms and application research thereof have not been fully performed. However, SNP (Single nucleotide polymorphism) molecular markers related to the oil content traits of soybean seeds are not found, and difficulty is brought to genetic improvement of the oil content traits of the soybean seeds and molecular marker-assisted selective breeding.

Disclosure of Invention

The SNP marker, the interval, the primer and the application are closely related to the oil content of the soybean seeds, can more effectively reflect the oil content of the soybean seeds, can be used for auxiliary selection breeding and genetic improvement of soybean molecular markers, and can obviously improve the selection efficiency of materials with larger oil content of the seeds.

The first purpose of the invention is to provide a SNP marker related to oil content of soybean seeds, wherein the SNP marker is located at 43173920 th position of a soybean 18 th chromosome, and the nucleotide of the SNP marker is A or T.

The second purpose of the invention is to provide a marker sequence containing the SNP marker related to the oil content of soybean seeds, and the nucleotide sequence of the marker sequence is shown as SEQ ID number 1.

The third object of the present invention is to provide a marker interval containing the SNP marker related to the oil content of soybean seeds, wherein the marker interval is the interval from 43163920 to 43183920 of chromosome 18 of soybean.

The fourth purpose of the invention is to provide a primer for amplifying the marker sequence, wherein the primer is:

M18-O1F: 5'-CAATAGCAGCAATCAGGACA-3', as shown in SEQ ID number 2,

M18-O1R: 5'-TAGCAAGGAGAAATGGGC-3', as shown in SEQ ID number 3.

The fifth purpose of the invention is to provide the application of the SNP marker in soybean oil content quality breeding.

The sixth purpose of the invention is to provide an application of the marker sequence in soybean oil content quality breeding.

The seventh purpose of the invention is to provide an application of the marker interval in soybean oil content quality breeding.

The eighth purpose of the invention is to provide an application of the primer in soybean oil content quality breeding.

Compared with the prior art, the SNP marker related to the oil content of the soybean seeds and the application thereof provided by the invention have the following beneficial effects:

(1) the SNP marker related to the oil content of the soybean seeds belongs to a co-dominant marker, is reliable and convenient to use, and provides great convenience for breeding of soybean high-oil-content strains. The SNP marker provided by the invention can be applied to molecular marker assisted selection in soybean seed oil content component improvement and application in fine positioning and map cloning of a gene related to the content of the seed oil, thereby accelerating the improvement process of the soybean seed oil content character.

(2) The interval between 43163920 th position and 43183920 th position (43173920 +/-100 Kb) of the 18 th chromosome is an ideal marker interval of the oil content of soybean seeds, wherein the contribution rate of 43173920 th SNP is 12.84%, and the additive effect is 3.01. The SNP marker at the site is used for selection in advanced breeding groups, so that materials with the oil content higher than 20.96 percent can be screened, the accuracy is about 70 percent, the selection cost is greatly reduced, and the quality improvement efficiency is improved.

Drawings

FIG. 1 is a graph of the oil content distribution of 280 soybean related populations;

FIG. 2 is a group structure diagram of related groups obtained by an Admixure software analysis based on SNPs;

FIG. 3 is a Manhattan chart of the results of MLM correlation analysis of soybean seed oil content.

Detailed Description

The invention is described in detail below with reference to the figures and the specific embodiments, but the invention should not be construed as being limited thereto. The technical means used in the following examples are conventional means well known to those skilled in the art, and materials, reagents and the like used in the following examples can be commercially available unless otherwise specified.

The soybean germplasm resource information collected in the following examples and having an oil content measured by the soxhlet extraction method is as follows: 280 soybean germplasm resources with the purity of 40 degrees N in China are collected and evaluated by a soybean germplasm resource research team group cultivated by a soybean research institute of agricultural academy of agricultural sciences in Jilin province, and are stored in a germplasm resource library of agricultural academy of agricultural sciences in Jilin province. The 280 soybean germplasm resource sources cover most of the major producing areas of high-latitude soybeans in China, including Heilongjiang province, Jilin province, Liaoning province, inner Mongolia, Xinjiang and the like.

The SNP marker related to the oil content of soybean seeds provided by the invention is located at 43173920 th site of a No. 18 chromosome of soybean (the reference genome is Wm82.a2.v 1), the nucleotide genotype is A or T, the SNP marker belongs to a codominant marker, and the SNP marker is reliable and convenient to use, thereby providing great convenience for breeding soybean high-oil-content strains; the nucleotide sequence of the marker sequence containing the SNP marker is shown as SEQ ID number 1 and is as follows:

CAATAGCAGCAATCAGGACATCCTGGCATCCATGGGGGACAAAGGAACCCTGTGACGCCTGCTCCTCCAATAAGTCTTGTACAGAAGACATTTATTTGTT TAGTCAATTAGAGAATAAACATAAATAATTACAATTATTAATTGAAAGTGACTTGCAATCTTCTCAGCAATTTCGTTTGCTGCCTCAGACGTCATCTGGCCAATTTTCTTGGTGCGGCCAATCTTCCACTTCACGTGTCGTCTGATGGGAGATGGAGGGTCAATTACGGCCTCAGTGCTTCTGATTGAGCGGCTTCCTCCAGTTTTTTCTTTGTCTTCTCAGCCATCAATTTCTGTTCTAAATATTCATAACCCCCACGAGACAACACGTGGGGGCAGTGTTTTGCTTCTGGATGGCCTGTGCCTTTTTCCGCACATCCTGCAAAAATTGAACATTAATGAAAC[A/T]CTTGATTACAATGCATTATACTAAATGAATTTTAACTTTAAAACAATGAAAATGACAAAGTACCTACCTCCCACGAGGGGTCTCTGCGGCTCTGACAAAACTGGGCCCATTTCTCCTTGCTA

the soybean oil content-related SNP marker comprises a marker interval from 43163920 bit to 43183920 bit (namely 43173920 +/-100 Kb) of the SNP marker related to the soybean seed oil content.

The SNP marker is specifically obtained by the following method:

seed oil content determination of soybean related group

280 parts of soybean germplasm resources are planted in a field, after the seeds are completely mature, the seeds are harvested, the oil content (crude fat content) of the seeds is extracted, and the crude fat content is calculated according to the weight difference between a sample and residues. The operation steps are as follows:

(1) 10g of soybean seeds were baked in an oven at 80 ℃ for 12 hours to a constant weight.

The filter paper was cut into 4cm × 4cm, stacked into paper bags with one side not sealed, marked with a hard pencil, and the filter paper bags were weighed (denoted as a).

The seeds were crushed, sieved through a 60 mesh sieve, and then weighed to give about 0.2g of powder, which was put into the above weighed filter paper pack, and the mouth of the pack was sealed and weighed (denoted as b).

The filter paper pack containing the sample was placed in an extraction cylinder with long tweezers, and about 20ml of anhydrous ether was injected thereto to completely immerse the sample pack in the ether. Connecting each part of the extractor, connecting a condensed water flow, extracting in a constant-temperature water bath, adjusting the water temperature to 55-60 ℃, making the condensed and dripped ether into a continuous bead shape, and extracting until the ether in the extraction cylinder is checked to have no oil stain by using filter paper (about 1 h). After extraction, the filter paper bag is taken out by using long tweezers, and the ether in the extraction bottle is recovered.

After the ether was evaporated, the filter paper bag was placed in an oven at 65 ℃ for drying for 8min and placed in a desiccator to cool until constant weight was reached (denoted as c).

Oil content = (b-c)/(b-a) × 100%. The oil content of 280 resources is in accordance with normal distribution in a population, belongs to quantitative traits, has a genetic diversity index of 2.71, and is shown in figure 1, wherein figure 1 is a distribution diagram of the oil content of seeds of 280 soybean-related populations, the ordinate in figure 1 represents the number of samples, and the abscissa represents the oil content of soybean seeds.

Second, soybean seed oil content whole genome correlation analysis

And (2) carrying out whole genome Sequencing on 280 germplasms by utilizing an SLAF-seq (Specific-local Amplified Fragment Sequencing) technology, comparing Sequencing reads to a reference genome by utilizing BWA, developing SNP by utilizing two methods of GATK and Samtools, and taking the SNP marker intersection obtained by the two methods as a final reliable SNP marker data set. The method comprises the following specific steps:

1. extracting the DNA of the 280 seed individual leaf leaves by using a CTAB method, detecting the DNA concentration to be 100 ng/mu L by using Thermo nanodrop 2000, and detecting the purity and integrity of the DNA by using 1% agarose electrophoresis, wherein the DNA is required to be not degraded, and the DNA is not polluted by protein, polysaccharide and the like.

2. The method comprises the following steps of performing genome sequencing on 280 parts of single seed leaf DNA by utilizing an SLAF-seq technology independently developed by Beijing Baimaike Biotechnology Limited, wherein the genome sequencing method comprises the following specific steps:

(1) genome enzyme digestion: enzyme digestion prediction is carried out on the published soybean reference genome by using enzyme digestion prediction software, endonuclease RsaI and HaeIII are selected to carry out enzyme digestion on each sample genome qualified for detection, and then an SLAF fragment with the genome fragment range of 364-414 bp is selected.

(2) Gene sequencing: the obtained SLAF Fragment is treated by Klenow Fragment (3 ' → 5 ' exo-) (NEB) and dATP at the 3 ' end under the temperature of 37 ℃ and is connected with a Dual-index sequencing adaptor, then PCR amplification and purification of PCR amplification products, sample mixing and gel cutting are carried out to recover the target Fragment, the recovered target Fragment is subjected to cDNA library quality inspection, and the cDNA library quality inspection is qualified and then sequenced by Illumina HiSeqTM 2500. 713.59M reads were obtained with an average Q30 of 95.80% and an average GC content of 43.21%. To evaluate the accuracy of the library construction experiment, rice (Oryza sativa) was selected as a Control (Control) for the same treatment to participate in library construction and sequencing.

Wherein, the primers used for PCR amplification are F: 5'-AATGATACGGCGACCACCGA-3' (SEQ ID number 4) and R: 5'-CAAGCAGAAGACGGCATACG-3' (SEQ ID number 5).

Wherein, the PCR amplification product is purified by utilizing Agencour AMPure XP beads (Beckman Coulter, High Wycombe, UK).

(3) SNP tagging and genotyping: according to the positioning result of sequencing Reads on a reference genome, performing Local duplication (Local duplication) and mutation detection by using GATK software, performing mutation detection by using samtools software, obtaining intersection mutation sites obtained by the GATK software and the samtools software, and the like to ensure the accuracy of detected SNPs (single nucleotide polymorphisms), and finally screening 1819858 available SNP labels to obtain an SNP data set.

3. The phylogenetic tree is used to express the evolutionary relationship between species, and according to the distance of the relationship between various organisms, various organisms are arranged on a branched tree-shaped chart to express the evolutionary process and the relationship simply. Based on the 1819858 SNPs, a population evolutionary tree of the sample is constructed through MEGA5 software and neighbor-join algorithm.

4. Obtaining genetic structure data: the group genetic structure analysis can provide the ancestral source and the composition information of individuals, and is an important genetic relationship analysis tool. The population structure of the samples was analyzed by the admixture software based on 1819858 SNPs, and clustering was performed assuming that the number of clusters (K value) of the samples was 1 to 20, respectively, and the clustering results are shown in FIG. 2. FIG. 2 is a group structure diagram of an associated group obtained by the analysis of the admixture software based on SNP, clustering is performed assuming that the group number (K value) of samples is 1-20, the clustering results are cross-verified, and the optimal group number is determined to be 12 according to the valley value of the cross-verification error rate.

5. Principal Component Analysis (PCA) analysis was performed by eigenfeft software based on 1819858 SNPs to obtain the Principal component clustering condition of the sample. Through PCA analysis, which samples are relatively close to each other and which samples are relatively distant from each other can be known, so that the evolution analysis can be assisted.

6. Obtaining Kinship matrix data of the genetic relationship: the SPAGeDi software can be used for estimating the genetic relationship (relative Kinship) between every two natural groups to obtain genetic relationship Kinship matrix data. The genetic relationship itself is a relative value defining the genetic similarity between two specific materials and the genetic similarity between arbitrary materials, and thus is directly defined as 0 when the result shows that the value of the genetic relationship between two materials is less than 0.

7. Based on related group SNP marker data, genetic structure data, genetic relationship Kinship matrix data and oil content data, Genome wide association analysis (GWAS) is carried out by using a Mixed Linear Model (MLM) of the TASSEL5.0 software. X is genotype, Y is phenotype, and finally each SNP locus can obtain an association result, FIG. 3 is a Manhattan graph of the MLM association analysis result of soybean seed oil content, the ordinate is the negative logarithm of p-value, the abscissa is chromosome, and one point represents one SNP locus; the red dotted line (dotted line below fig. 3) is the negative logarithm of 0.1/SNP number, the blue dotted line (dotted line above fig. 3) is the negative logarithm of 0.01/SNP number, a point above the blue line, indicating that the corresponding SNP marker is significantly associated with oil content, with the highest green point on chromosome 18 blue line corresponding to SNP position 43173920. An SNP marker (A/T) significantly related to the oil content was obtained at position 43173920 of chromosome 18 using LOD.gtoreq.8 as a screening standard, and the detailed information of the SNP marker is shown in Table 1.

TABLE 1 SNP marker information significantly related to soybean seed oil content

Chromosome	SNP type	Physical location (bp)	Marking intervals	Contribution ratio (%)	Additive effect
						18	A/T	43173920	43173920±100Kb	12.84	3.01

Application of SNP (single nucleotide polymorphism) marker with obvious association of oil content of seeds

The nucleotide sequence of the SNP marker closely linked with the oil content of the soybean seeds is shown as SEQ ID number 1 and is named as M18-O1, wherein the genotype of a site with polymorphism is A/T (445 th site of the SEQ ID number 1 sequence, and [ a/T ]), the genotype is positioned at 43173920 th site of the No. 18 soybean chromosome, and the SNP marker is a fragment obtained by performing PCR amplification by taking genomic DNA of a material to be identified as a template and using an M18-O1 primer.

Wherein, the amplification primers are as follows:

M18-O1F：5’- CAATAGCAGCAATCAGGACA -3’（SEQ ID NO. 2）

M18-O1R：5’- TAGCAAGGAGAAATGGGC -3’（SEQ ID NO. 3）

the specific steps of utilizing the SNP marker to assist in judging the content of the soybean oil are as follows:

1. extraction of genomic DNA of material to be identified by CTAB method

1) Adding liquid nitrogen into fresh soybean leaves, grinding into powder, and placing a proper amount of the powder into a 1.5mL centrifuge tube.

2) Adding 0.6mL of preheated CTAB extract, mixing several times by inversion, water-bathing at 65 deg.C for one hour, mixing once every 15min, and centrifuging at 12000rpm for 15 min.

3) Add 0.6mL 24: 1(V/V) chloroform: and (3) inverting the isoamyl alcohol solution, mixing uniformly for 5-10 times, and centrifuging at 10000rpm for 15 min.

4) The supernatant solution was transferred to another empty centrifuge tube and the tube was washed with 24: 1(V/V) chloroform: the isoamyl alcohol solution was re-extracted once, and then 50. mu.L of RNase (10 mg/mL) was added and left at room temperature for 30 min.

5) Adding equal volume of-20 deg.C pre-cooled isopropanol, centrifuging at-20 deg.C for 30min in a refrigerator at 5000rpm for 10min, and removing supernatant.

6) Washed twice with 70% ethanol. And (3) drying, dissolving with sterilized water to obtain genome template DNA, and storing the genome template DNA in a refrigerator at 4 ℃ for later use.

7) The DNA concentration was checked with 0.8% agarose and diluted to the working concentration for PCR amplification.

2. PCR amplification is carried out by using primers of M18-O1F/M18-O1 FR to obtain an M18-O1 amplification product.

1) PCR amplification System: the total volume was 20. mu.L, including 2. mu.L of 10ng genomic template DNA, 10. mu.L of 2 XEs Taq MasterMix, 2. mu.L of 10mM each primer and ddH₂O 4μL。

2) PCR amplification conditions: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 45s, and extension at 72 ℃ for 45 s; circulating for 35 times; final extension at 72 ℃ for 10 min.

3. Judging the oil content according to the sequence comparison result

Sequencing analysis is carried out on the M18-O1 amplification product, and the average value of the oil content of the subgroup of the strains with the A position 445 from the 5' end of the amplification product is obviously higher than the average value of the subgroup of the strains with the T position. 68.09% of the 280 samples had a strain oil content of A at position 445 higher than 20.96%, indicating that the SNP marker was effective for aiding selection.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<120> SNP (Single nucleotide polymorphism) marker related to soybean seed oil content, interval, primer and application

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 567

<212> DNA

<213> Soybean

<400> 1

caatagcagc aatcaggaca tcctggcatc catgggggac aaaggaaccc tgtgacgcct 60

gctcctccaa taagtcttgt acagaagaca tttatttgtt tagtcaatta gagaataaac 120

ataaataatt acaattatta attgaaagtg acttgcaatc ttctcagcaa tttcgtttgc 180

tgcctcagac gtcatctggc caattttctt ggtgcggcca atcttccact tcacgtgtcg 240

tctgatggga gatggagggt caattacggc ctcagtgctt ctgattgagc ggcttcctcc 300

agttttttct ttgtcttctc agccatcaat ttctgttcta aatattcata acccccacga 360

gacaacacgt gggggcagtg ttttgcttct ggatggcctg tgcctttttc cgcacatcct 420

gcaaaaattg aacattaatg aaac[a/t]cttga ttacaatgca ttatactaaa tgaattttaa 480

ctttaaaaca atgaaaatga caaagtacct acctcccacg aggggtctct gcggctctga 540

caaaactggg cccatttctc cttgcta 567

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

caatagcagc aatcaggaca 20

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence

<400> 3

tagcaaggag aaatgggc 18

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

aatgatacgg cgaccaccga 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

caagcagaag acggcatacg 20

Claims

1. The application of a nucleotide sequence containing a SNP marker related to the oil content of soybean seeds in the quality breeding of the oil content of soybean seeds is characterized in that the nucleotide sequence is shown as SEQ ID number 1, and the 445 th position in the SEQ ID number 1 is A/T.

2. The use of the nucleotide sequence containing the SNP marker related to soybean seed oil content in soybean oil content quality breeding according to claim 1, wherein primers for amplifying the nucleotide sequence are as follows:

M18-O1F：5’- CAATAGCAGCAATCAGGACA -3’，

M18-O1R：5’- TAGCAAGGAGAAATGGGC -3’。