CN106755016B - A kind of Karl Jaspers carboxypeptidase y gene and its application - Google Patents
A kind of Karl Jaspers carboxypeptidase y gene and its application Download PDFInfo
- Publication number
- CN106755016B CN106755016B CN201611094281.7A CN201611094281A CN106755016B CN 106755016 B CN106755016 B CN 106755016B CN 201611094281 A CN201611094281 A CN 201611094281A CN 106755016 B CN106755016 B CN 106755016B
- Authority
- CN
- China
- Prior art keywords
- gene
- cpy
- carboxypeptidase
- enzyme
- pichia pastoris
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/485—Exopeptidases (3.4.11-3.4.19)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/06—Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/16—Serine-type carboxypeptidases (3.4.16)
- C12Y304/16005—Carboxypeptidase C (3.4.16.5), i.e. carboxypeptidase Y
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a kind of Karl Jaspers carboxypeptidase y gene and its applications, belong to field of biotechnology.Carboxypeptidase y full length gene of the present invention is the RNA by extracting Karl Jaspers, after reverse transcription obtains cDNA, is obtained by terminal amplification technology (RACE), full length gene 1557bp encodes 518 amino acid.The present invention is that successful clone goes out CPY full length gene from Karl Jaspers bacterium PEP001 (A.elegans PEP001) for the first time, and its encoding gene is recombinantly expressed in GS115.Proenzyme by Activation In Vitro, purifying, determine the basic zymologic property of mature CPY, for it is carried out deeper into research precondition is provided.
Description
Technical field
The present invention relates to a kind of Karl Jaspers carboxypeptidase y gene and its applications, belong to field of biotechnology.
Background technique
Carboxypeptidase y (carboxypeptidase Y, CPY) is serine albuminoid enzyme, and activated centre is by serine, Tianmen
Aspartic acid and histidine (Ser-Asp-His) composition, it can hydrolyze peptide chain C-terminal amino acid residue and form free amino
Acid, widely exists in bacterium, fungi, in Plants and Animals.There is CPY very wide substrate to compose, and can hydrolyze any carboxylic
Base end amino acid is especially difficult to the residues such as the proline hydrolyzed for other most of carboxypeptidases, therefore it can be answered
Sequencing and mass spectral analysis for polypeptide.
Carboxypeptidase y is widely used because it can cut the hydrolysis properties of peptide C end arbitrary amino acid, and different next
The zymologic property of the carboxypeptidase y in source is not identical, the CPY being reported at present be mainly derived from saccharomyces cerevisiae, Pichia pastoris with
Fission yeast etc., wherein the CPY of Saccharomyces cerevisiae is studied the clearest.
Karl Jaspers (Actinomucor elegans) are one of the main bacteria seeds of sufu fermentation production, are possessed non-
Often abundant and high activity extracellular protein enzyme system, CPY also wherein, have very big commercial application potentiality.
Summary of the invention
It present invention firstly provides a kind of gene cpy for encoding carboxypeptidase y, is radiated with fermented bean curd industrial production bacterium grace
Mucor is starting strain, separates its total serum IgE, and reverse transcription obtains the cDNA of carboxypeptidase y, obtains full length gene information by RACE.
The cpy full length gene 1557bp encodes 518aa as shown in SEQ ID NO.1.Maturase has the amino of hydrolysis peptide chain C-terminal
Acid, so that it becomes the function of free amino acid.
The gene of acquisition is also connect by the present invention with carrier pPIC9K, constructs recombinant expression carrier pPIC9K-procpy, is turned
Change Pichia pastoris, culture gained recombinant yeast pichia pastoris, the successful expression gene, obtains the proenzyme of carboxypeptidase y after induction.It will
The proenzyme of expression passes through Activation In Vitro, measures enzyme activity after purification, the results showed that the carboxypeptidase of gene expression shown in SEQ ID NO.1
Has the function of high catalytic activity.
Carboxypeptidase y provided by the present invention has high enzyme living in acid condition, can be applied to protein hydrolyzate
De- hardship, can be also used for the sequencing and mass spectral analysis of polypeptide.
Detailed description of the invention
Fig. 1 is the electrophoretogram of cpy gene；M, standard Marker；1, CPY full length gene.
Fig. 2 is the purification result of the carboxypeptidase of the secreting, expressing of recombinant yeast；M, standard protein；0, carry pPIC9K's
P.pastoris GS115 fermentation supernatant；1, recombinant bacterium fermentation supernatant；2, the proCPY of purifying；3, the CPY of purifying.
Fig. 3 is that the HPLC of L-Tyr standard specimen schemes, appearance time 3.4min.
The HPLC figure of substrate N-CBZ-Phe-Tyr in Fig. 4 CPY catalytic reaction process.
The HPLC figure of product, appearance time 3.4min in Fig. 5 CPY catalytic reaction process.
Specific embodiment
The activity of HPLC measurement enzyme:
The CPY of 5 μ l activation purifying is taken to be added in 1ml 2mmol/L N-CBZ-Phe-Tyr, it is anti-under 37 DEG C and pH6.0
10min, reaction products therefrom L-Tyr is answered to be detected with HPLC.Chromatographic column is DIKMAC18 (5 μm, 4.6 × 250mm)；Flowing
Phase A is the water of the sodium acetate containing 55mmol/L, and Mobile phase B is water, methanol and the acetonitrile of the volume ratio of sodium acetate containing 55mmol/L 1:2:2
Mixture, pH is 7.2, and the percent by volume of linear eluent gradient B is 40%-70%, elutes 15min.Ultraviolet detection wave
Long 338nm, 40 DEG C of column temperature.Measured peak areas is scaled standardized products concentration, to calculate enzyme activity.Enzyme activity definition:
Under 25 DEG C, 6.0 sodium phosphate buffer of pH, enzyme amount needed for N-CBZ-Phe-Tyr generates 1 μm of ol L-Tyr is converted per minute
For 1U.
The acquisition of 1 cpy gene of embodiment
Karl Jaspers total serum IgE is extracted, RACE-Ready cDNA is prepared by template of RNA, with 5'- RACE-Ready
CDNA is template, carries out PCR amplification with degenerate primer, is sequenced after carrying out glue recycling to purpose product, obtains the gene of about 500bp
Information finds it for CPY partial sequence by the library NCBI information comparison.The special of RACE is designed by the CPY partial sequence obtained
Property primer, further PCR obtains the sequence of cpy.
The full length gene 1557bp of the carboxypeptidase y in the source A.elegans PEP001, as shown in SEQ ID NO.1, coding
518aa。
The expression of 2 cpy gene of embodiment
The pre- geodesic structure of SingnalP shows that AeCPY albumen n end contains the N-terminal signal peptide sequence of 23 amino acid, optimal to cut
Enzyme site is between the 23rd and the 24th amino acids.In Expasy ProtParam prediction proCPY theoretical molecular weight with
Isoelectric point is respectively 58.8kD and 5.5.According to signal peptide prediction as a result, the gene of design primer amplification coding proCPY.
Upstream primer: pPproCPY-F (5'- GGAATTCGAACCAGCCATGTTTCAGCAGCA -3')
Downstream primer: pPproCPY-R (5'- TAAACTATGCGGCCGCCTAATGATGATGATGATGATGGTTGAGTT
CACCACGAACCC ATT–3')。
Use will be connected to after procpy gene EcoR I and Not I restriction enzymes double zyme cutting that PCR amplification obtains
On the plasmid vector pPIC9K of same digestion with restriction enzyme, the plasmid pPIC9K-procpy of building is transformed into
In Escherichia coli JM109, positive restructuring is selected in the LB solid medium tablets containing amicillin resistance
Son, sequence verification.
Plasmid pPIC9K-procpy Sac I is linearized, setting electricity turns parameter: 1500v, 400 Ω, 4-6ms, electricity turn
Pichia pastoris.Transformant is screened on MD plate, select positive recombinant and with MD and MM plate assay transformant whether be
Mut+ genotype.It is respectively the YPD plate screening height copy of 0.25,0.5,0.75,2.0,3.0,4.0mg/mL with G418 concentration
Transformant.
Recombinant plasmid pET-22b (+)-procpy is transformed into Escherichia coli Rosetta (DE3), is selected
Single bacterium drops down onto the LB liquid medium of 5mL ampicillin containing 50mg/L, 37 DEG C, 200r/min culture 10h after, take 1mL to train
Object is supported into the 2 × YT culture medium of 100mL ampicillin containing 50mg/L, is cultivated in 37 DEG C, 200r/min to the OD600 of thallus
Thalline were collected by centrifugation after addition IPTG to final concentration of 0.4mmol/L, 20 DEG C of induction 12h when being 0.8.Recombinant bacterial strain is through inducing table
After reaching, expression product is virtually all inclusion body.This utilizes Bacillus coli expression saccharomyces cerevisiae proCPY with what is reported before
Result it is similar.
Pichia pastoris transformant single bacterium is dropped down onto 100ml BMGY, 30 DEG C, 200r/min cultivate it is left to OD600 about 20
The right side, 6,000 × g centrifugation 5min collect thallus and are transferred in 100ml BMMY.30 DEG C, under 200r/min every the first that 1% is added for 24 hours
Alcohol is induced, and induces 144h, fermentation supernatant is collected by centrifugation.By the fermentation supernatant of collection, will be sent out with the super filter tube in the aperture 30ku
The concentration of ferment supernatant protein is dissolved in 100mM Tris/HCl (pH 7.5).After handling 1h at 37 DEG C with appropriate trypsin, it is added
Trypsin inhibitor can obtain the recombinant protein c PY of greater activity.Protein solution after activation, with surpassing for the aperture 30ku
Buffer is changed to combination buffer (20mM sodium phosphate, 500mM sodium chloride, 20mM imidazoles, pH 7.4) by chimney filter, is concentrated and is removed
Remove part foreign protein.Crude enzyme liquid is purified with His Trap FF crude, 1mL nickel column, with the imidazoles containing 150mmol/L
Elution buffer elutes destination protein, carries out SDS-PAGE identification (Fig. 2).
The CPY of 5 μ l activation purifying is taken to be added in 1ml 2mmol/L N-CBZ-Phe-Tyr, it is anti-under 37 DEG C and pH6.0
10min, reaction products therefrom L-Tyr is answered to be detected with HPLC.Chromatographic column is DIKMAC18 (5 μm, 4.6 × 250mm)；Flowing
Phase A is the water of the sodium acetate containing 55mmol/L, and Mobile phase B is water, methanol and the acetonitrile of the volume ratio of sodium acetate containing 55mmol/L 1:2:2
Mixture, pH is 7.2, and the percent by volume of linear eluent gradient B is 40%-70%, elutes 15min.Ultraviolet detection wave
Long 338nm, 40 DEG C of column temperature.Measured peak areas is scaled standardized products concentration, to calculate enzyme activity.L-Tyr standard specimen,
As in Figure 3-5, enzyme activity is 157.20 ± 1.80U/mg (p < 0.01) to substrate N-CBZ-Phe-Tyr and reaction product HPLC figure.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill
The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention
Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>a kind of Karl Jaspers carboxypeptidase y gene and its application
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 1557
<212> DNA
<213>Karl Jaspers PEP001
<400> 1
atgcccactt tattttcact tgccaaggtg gctgtagtag catcttgtgt atttggctta 60
ggctatgccg aaccagccat gtttcagcag caaggagcta ttgcagattt tggcgaaaag 120
gcctgggaca acgtgcagca cgtagtccat gatgctgctg ataaggtcca cagcgctacg 180
gataaattca agcaaatttt aagccatggc gctgatactt taaccacctt tacccaccct 240
gctttctctc aatacgcttt gagatacaag agacctactc tttgtgatcc tgatgtgaaa 300
caaatttccg gttacttgga cgttggaaaa gataagcatt tcttcttttg gttctttgaa 360
tcaagagata agcccaagga agatcccgtt gttttatggt tgaacggtgg cccaggctgt 420
tcttctttga ccggtctttt tatggaactt ggtccttgta cagtcaataa ggaaggcaat 480
gataccatca tcaacaagta ctcttggaac gataaagcca atattatctt cttggatcag 540
ccattgaatg tcggttattc tcatggtagc ggtggtgcct ccaataccga tgctgctgct 600
caagatgtat atgctttcct tcaactcttc ttcaaggaat tccctcaata tgccgatctt 660
gatttccata tttctggtga atcttatgca ggtcattaca ttcctgccat tggtggagtc 720
attaacaata ataataaggg caagttccag tcaatggaac tcttgaagaa gaagcatacc 780
ctctctgata tcaagctaaa gagtttgttg atcggtaatg gtttgactga tcctttggtt 840
caatacaagt actatgctga aatggcctgt aataattctt atggtcctgt cttggataaa 900
gctacctgtg ataacatgga agctcaattc cctgcttgtg ctcgcttgat caaaaactgt 960
tatgaaagta agaatgtatt ctcttgtttg cctgctgcta tgaagtgtaa caaggatcaa 1020
atccaacctt accaacaaac cggcatgaat ccttatgatg tccgcgaaaa gtgtaaaggt 1080
ggaaaccttt gctatgatat cctcgaatct gtccagaaat acttgaatat tcccgctgtc 1140
aagaaagaag ttggtgccga gactgataaa tatgaaagct gtaacatgca aatcaacttt 1200
agattccaaa tggccggtga ttggatgcgc ccttatgtcg aagaagtgcc caagcttttg 1260
gaagatgata tcaaaatctt gatttatgct ggtgatgctg acttcatttg taactggatt 1320
ggtaataagg catggactat tgaattgcct tggtctggcc atgaagaatt ctcttccgct 1380
aatgatactg aatggcactc tgagcttctt ggtaagcaag ctggtgagct tcgcaagact 1440
gaagatggcc gctttgcctt cttgcgcgtc tttggtgctg gtcacatggt cccttacgac 1500
caacctgaaa gcggtcttga tatgttgcag caatgggttc gtggtgaact caactaa 1557
<210> 2
<211> 30
<212> DNA
<213>artificial sequence
<400> 2
ggaattcgaa ccagccatgt ttcagcagca 30
<210> 3
<211> 60
<212> DNA
<213>artificial sequence
<400> 3
taaactatgc ggccgcctaa tgatgatgat gatgatggtt gagttcacca cgaacccatt 60
Claims (8)
1. a kind of gene cpy for encoding carboxypeptidase, which is characterized in that nucleotide sequence is as shown in SEQ ID NO.1.
2. the enzyme of the coding of gene cpy described in claim 1.
3. carrier or cell comprising gene cpy described in claim 1.
4. a kind of recombinant yeast pichia pastoris for recombinantly expressing gene cpy described in claim 1, which is characterized in that by nucleotides sequence
Column gene as shown in SEQ ID NO.1 is connect with carrier pPIC9K, constructs recombinant expression carrier pPIC9K-procpy, conversion
Pichia pastoris, culture gained recombinant yeast pichia pastoris, and induce the gene expression.
5. a kind of method for obtaining enzyme described in claim 2, which is characterized in that by nucleotide sequence as shown in SEQ ID NO.1
Gene connect with carrier pPIC9K, construct recombinant expression carrier pPIC9K-procpy, convert Pichia pastoris, culture gained weight
Group Pichia pastoris, and the gene expression is induced to obtain the proenzyme of carboxypeptidase y, by the proenzyme of expression by Activation In Vitro, purifying, obtain
To carboxypeptidase.
6. enzyme as claimed in claim 2 is preparing the application in peptide or amino acid.
7. application of the enzyme as claimed in claim 2 in the de- hardship of protein hydrolyzate.
8. application of the enzyme as claimed in claim 2 in the sequencing and mass spectral analysis of polypeptide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611094281.7A CN106755016B (en) | 2016-12-02 | 2016-12-02 | A kind of Karl Jaspers carboxypeptidase y gene and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611094281.7A CN106755016B (en) | 2016-12-02 | 2016-12-02 | A kind of Karl Jaspers carboxypeptidase y gene and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106755016A CN106755016A (en) | 2017-05-31 |
| CN106755016B true CN106755016B (en) | 2019-09-17 |
Family
ID=58882778
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611094281.7A Active CN106755016B (en) | 2016-12-02 | 2016-12-02 | A kind of Karl Jaspers carboxypeptidase y gene and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755016B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107828673B (en) * | 2017-12-19 | 2020-03-06 | 江南大学 | Method for efficiently expressing carboxypeptidase Y from actinomucor elegans |
-
2016
- 2016-12-02 CN CN201611094281.7A patent/CN106755016B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Specificity of carboxypeptidases from Actinomucor elegans and their debittering effect on soybean protein hydrolysates;Fu J等;《Appl Biochem Biotechnol》;20110820;第165卷(第5-6期);第1201-1210页 |
| 登录号：OAC99848.1;Corrochano LM等;《GenBank》;20160506;第1-518位 |
| 雅致放射毛霉AS3.2778碱性蛋白酶的纯化及水解特性;潘进权等;《华南理工大学学报（自然科学版）》;20081231;第36卷(第12期);第106-111页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106755016A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1871351B (en) | Novel fungal proteins and nucleic acids encoding same | |
| KR101304958B1 (en) | Cleavage of precursors of insulins by a variant of trypsin | |
| CN102839165B (en) | Gene mutation type recombined protease K and industrialized production method thereof | |
| CN109652392B (en) | Feruloyl esterase and preparation method and application thereof | |
| JP2007167062A (en) | High-efficiency secretory signal peptide and protein expression system using the peptide | |
| WO2011023009A1 (en) | Recombinant expression of carboxylesterases | |
| CN110054702A (en) | Zearalenone degradation enzyme fusion proteins and its encoding gene and application | |
| CN104232611B (en) | A kind of recombination muscardine Proteinase K and its industrialized production and purification process | |
| CN110272856A (en) | A kind of recombinant bacterium that expressing D-Thr aldolase and its construction method and application | |
| CN106755016B (en) | A kind of Karl Jaspers carboxypeptidase y gene and its application | |
| Castro‐Rodríguez et al. | Medicago truncatula Yellow Stripe‐Like7 encodes a peptide transporter participating in symbiotic nitrogen fixation | |
| CN105296509B (en) | A kind of malate dehydrogenase gene RKMDH2 and its recombinant expression carrier | |
| CN103570817B (en) | Plasmodium vivax PvMSP1 recombinant antigenic protein as well as preparation method and application thereof | |
| CN106337042B (en) | Double alkali yl enzyme kex2 variant and its high-efficiency expression method | |
| CN112662644A (en) | Diglycerol phosphate phosphodiesterase mutant and application thereof | |
| CN108342371B (en) | Novel feruloyl esterase and coding gene and application thereof | |
| CN105886517B (en) | A kind of malate dehydrogenase gene RKMDH1 and its recombinant expression carrier | |
| CN106554951B (en) | Recombinant Kluyveromyces cicerosporus CBS4857 exoinulase, encoding gene, expression and application | |
| CN103205444A (en) | Preparation method of human active granzyme K recombinant proteins | |
| RU2453604C1 (en) | Hybrid protein (versions), bacterial strain escherichia coli - hybrid protein producer (versions) and method for producing methionine-free human interferon alpha-2 | |
| CN109161539B (en) | Organic solvent-tolerant aminopeptidase LapA and preparation method and application thereof | |
| KR101962865B1 (en) | Method for manufacturing the antigen and the antibody for diagnosing stress and composition and kit for diagnosing stress | |
| CN112662643A (en) | Organophosphorus anhydrase, coding gene thereof and application of organophosphorus anhydrase in degradation of organophosphorus pesticides | |
| CN105368802A (en) | Salt-tolerant esterase, coding gene of salt-tolerant esterase and application of salt-tolerant esterase | |
| CN112226378A (en) | Large yellow croaker cysteine protease inhibitor Cystatin recombinant protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |