CN106754976A - A kind of new Eimeria Tenella TERT related protein genes OTU - Google Patents

Abstract

The invention provides a kind of Eimeria Tenella TERT related protein genes OTU, there is provided a kind of newE. tenellaTERT interaction GFP OTU, and its function is determined are the cellular elements biological nature etc. for finding new pharmaccine target and further investigation coccidia from now on there is provided new clue.The present invention obtains a new positive interaction albumen by yeast two-hybrid screening and checking, and its function is inquired into, the characteristics of the method has practicality, high efficiency.E. tenellaThe carrier mediated ribozyme of virus transfection is that the influence of research coccidia gene pairs polypide and regulation and control provide a kind of easy method.

Description

A kind of new Eimeria Tenella TERT related protein genes OTU

Technical field

The invention provides a kind of Eimeria Tenella TERT related protein gene OTU, more particularly to the albumen is at end Effect in telomerase activity regulation, the albumen has the effect of positive regulation for E.tenella telomerase activations, is likely to become The potential target spot of global-worm illness is controlled, belongs to gene engineering technology field.

Background technology

Chicken coccidiasis have important influence to animal husbandry, and it is dramatically increasing the financial burden in the whole world.Chicken coccidiasis are big More because by eimeria tenella infection, it is the parasitic disease of most serious in chicken intestinal.The prevention and control master of current global-worm illness The use of anticoccidial drug and vaccine is relied on, but because the residual and drug resistance problems of medicine have had a strong impact on food security And public health, and it is not enough to the Cytobiology and molecular biology characteristic understanding of coccidia, preferable prevention and control measure is there is no so far.Cause This, finding preferable medicine and vaccine targets turns into the emphasis of current research.At present, Eimeria Tenella (E.tenella) Sequence has been reported reverse transcriptase of telomere (telomerase reverse transcriptase, TERT), but it is regulated and controled Albumen understands very few.The research of telomerase associated proteins is the medicine and vaccine action target of the anticoccidial for finding new and gos deep into Study Cytobiology and molecular biology characteristic of coccidia etc. and important clue is provided.At present, it is main on TERT and GAP-associated protein GAP research Mammal is concentrated on, report is studied in parasite little.

The content of the invention

The invention provides a kind of new Eimeria Tenella TERT interaction GFP OTU (ovarian Tumour), the albumen of the gene code has the effect of positive regulation for E.tenella telomerase activations, and it is found to be Further investigation cellular elements biological nature and the new pharmaccine target of searching etc. are there is provided new clue.

A kind of Eimeria Tenella TERT and its related protein gene OTU of the present invention, such as SEQ NO1, SEQ Shown in NO2.

The albumen of the gene code is literary to the cDNA of E.tenella by TERT albumen using the method for yeast two-hybrid Storehouse is screened, and obtains the albumen for having interaction with TERT, and carry out by the method that yeast replys experiment and pull-down Positive verification, so that it is determined that in the interaction albumen OTU of E.tenella telomerase albumen.It is situated between using E.tenella viral vectors Expression of the ribozyme interference OTU genes led in coccidia body, so as to study function of the OTU albumen in E.tenella bodies.

A kind of preparation method of Eimeria Tenella TERT related protein genes of the present invention, including following step Suddenly：

(1) structure of the recombinant bait plasmid containing TERT genes：TERT is obtained by PCR from E.tenella cDNA Sequence, reclaims purpose fragment and carries out double digestion, is connected with the pGBKT7 carriers after digestion, and is transferred to amplification in Escherichia coli, Positive colony is obtained by plasmid double digestion and sequencing identification, as can expressed fusion protein recombinant plasmid；

(2) recombinant bait plasmid is transformed into yeast strain, and carries out toxicity and self-activation identification；

(3) with the method for yeast two-hybrid screen in E.tenella cDNA libraries with TRBD (RNA binding Domain of telomerase reverse transcriptase) interact candidate albumen；

(4) method replied with pull-down and yeast further verifies that it interacts, so that it is determined that it is The albumen that E.tenella TERT interact.TERT albumen and candidate albumen are building up into pET-32a and pGEX-4T respectively to carry On body, under cryogenic, induced expression and purifying are carried out to soluble protein in BL21 (DE3) competence.By what is purified Candidate albumen adds Glutathione-Sepharose 4B Ago-Gels, after 4 ° of overnight incubations, being combined with candidate albumen Sepharose beads add TERT albumen, the result of positive interaction is tested and analyzed finally by Western blot；

(5) design synthesis is directed to the hammerhead ribozyme of interaction GFP and is connected on E.tenella viral vectors, In-vitro transcription is carried out with in-vitro transcription kit, its cell-free transcription folder is obtained, is divided in vivo and in vitro with fluorescence quantifying PCR method The hammerhead ribozyme of viral vectors mediation is not analyzed to the gene mRNA cutting efficiency；

(6) TRAP methods detection transfection strain telomerase activation.

The positive effect of the present invention is：

A kind of new E.tenella TERT interaction GFP OTU are provided, and its function is determined, be to find new from now on Pharmaccine target and further investigation coccidia cellular elements biological nature etc. there is provided new clue.The present invention passes through yeast Double cross is screened and checking obtains a new positive interaction albumen, and its function is inquired into, and the method has practicality The characteristics of property, high efficiency.The carrier mediated ribozyme of E.tenella virus transfections is for the influence of research coccidia gene pairs polypide and regulates and controls There is provided a kind of easy method.

Brief description of the drawings

Detection of the accompanying drawing 1 for restructuring bait protein to yeast mushroom toxin and autonomous reporter activation；

Accompanying drawing 2 is that alpha-galactosidase testing inspection TRBD interacts with candidate albumen；

Accompanying drawing 3 is pull-down checking TRBD and OTU interphase interactions；

Accompanying drawing 4 is the hammerhead ribozyme of E.tenella viral vectors mediation to OTU-sub In vitro digestion effect detections；

Accompanying drawing 5 is expressions of the GFP in E.tenella；

Accompanying drawing 6 is GFP-Ham-OTU plants of Flow cytometry and sorting；

Accompanying drawing 7A, Fig. 7 B are Western blot identification OTU expression changes；

Accompanying drawing 8 is the change that TRAP detects each worm strain Telomerase Activity.

Specific embodiment

To further illustrate application of the present invention in Eimeria Tenella TERT albumen, with TERT RNA binding domain (TRBD) for embodiment is illustrated.

Embodiment 1：

The structure of E.tenella TRBD bait expression plasmids

First, material

Trizol(Invitrogen)；Reverse Transcriptase Reagents kit (Tiangen)；T4DNA ligases, Ex Taq, dNTPs, pMD18-T、EcoR I、BamH I(TaKaRa)。

2nd, method and result

1E.tenella Sporulated Oocysts Total RNAs extractions

The treatment of 1.1 vessel：After by mortar, pestle washes clean, 0.1%DEPC-H is immersed in₂In O overnight.Then use Tinfoil is wrapped, and 180 DEG C of dry roasting 3h are standby；

The 1.2 E.tenella Sporulated Oocysts collected grind 20min on ice, add 1mL Trizol, lysis at room temperature 5min；

1.3 add 200 μ L chloroforms, mix, and room temperature places 15min, 12000g, 4 DEG C of centrifugation 15min；

The 1.4 absorption μ L RNA of upper strata about 600 are transferred to new centrifuge tube, add 500 μ L isopropanols, mix, and room temperature is placed 15min, 12000g, 4 DEG C of centrifugation 15min；

1.5 remove supernatant, and precipitation is washed with 75% ethanol, 12000g, 4 DEG C of centrifugation 15min；

1.6 go supernatant, centrifuge tube to be put into and 5min is air-dried in super-clean bench.RNase-free ddH₂O dissolution precipitations.Agarose The quality of detected through gel electrophoresis total serum IgE.

The synthesis of 2E.tenella cDNA

8 μ L RNA and 1 μ L Oligo dT primer (50uM) and 1uLdNTPs (10mM each) are mixed, 65 DEG C of water Bath 5min, is subsequently placed at 2min on ice.Add following mixture：

30 DEG C of 10min, 42 DEG C of water-baths 1h, 95 DEG C of 5min inactivate reverse transcriptase.

The structure of 3 pGBKT7-TRBD plasmids

3.1 PCR amplifying target genes：Special primer is designed according to genes of interest, and is added respectively in upstream and downstream primer EcoR I and BamH I restriction enzyme sites.

(italic is EcoR I enzymes to the-GGGGAATTCATTACAAGTACTAGAGTAGTAAATT-3 ' of downstream F-TRBD-BK 5 ' Enzyme site),

(italic is BamH I digestions to the-GGGGGATCCTCCTTTTAAACTTTCTAGATAC-3 ' of downstream R-TRBD-BK 5 ' Site).

Primer is synthesized by Changchun Ku Mei biotechnologys service company.

With cDNA as template, enter performing PCR, PCR system is as follows：

Response parameter is：95℃5min；94 DEG C of 30sec, 57 DEG C of 30sec, 72 DEG C of 30sec, 28cycles；72℃10min.

Embodiment 2：

Detection of the restructuring bait protein to yeast strain toxicity and autonomous reporter activation

First, material

X- α-GAL, salmon sperm dna (Sigma)；Yeast nitrogen (Biosharp)；c-Myc(Epitomics)；ECL chemistry Luminescence reagent box (Thermo)；The small extraction reagent kit of yeast plasmid (Tiangen).

2nd, method and result

The preparation of 1Y187 competent yeasts and the conversion of recombinant bait plasmid pGBKT7-TRBD

The 1.1 Y187 cell plates line that will be frozen, 30 DEG C of 3~4d of incubator culture to the Dan Ke for growing 2~3mm of diameter It is grand；

1.2 picking Y187 yeast monoclonal cells, in the test tube of the access fluid nutrient mediums of YPDA containing 10mL, and blow and beat equal It is even, 30 DEG C, 210r/min shaken cultivations to OD₆₀₀>1.5；Take 4~5mL saccharomycete access 50mL YPDA fluid nutrient mediums in, 30 DEG C, 210r/min shaken cultivations to OD₆₀₀=0.4~0.6；

1.3 50mL centrifuge tubes collect yeast liquid, and 700g room temperatures centrifugation 5min abandons supernatant；Add 25mL ddH₂O is resuspended Washing yeast sedimentation cell, 700g centrifugation 5min, removes supernatant, and repeated washing is once；With 1 × TE/LiAc of 1.5mL (10 × TE 150uL, 10 × LiAc 150uL, ddH₂O is l.20mL) resuspended precipitation, re-suspension liquid is competent yeast cells；

1.4 conversion plasmids are placed in 1.5mL centrifuge tubes with salmon sperm dna, are mixed.

The salmon sperm DNA of Fresh needs water-bath to be used after boiling 20min and ice bath；

1.5 often pipe addition 80uL competent yeast cells, vibration is mixed；

1.6 each additions 600uL PEG/LiAc (10 × TE 60uL, 10 × LiAc 60uL, 50%PEG 480uL), in order to Transformation efficiency is improved, mixture need to acutely shake, 30 DEG C, 210r/min shaken cultivations 30min；

1.7 add 70uL DMSO, and slow inversion mixes (can not vibrate), and 42 DEG C of water-bath 15min are rapidly inserted into ice bath cold But 1~2min；

1.8 room temperatures are centrifuged 12000g, 5sec, most supernatant are abandoned as far as possible, with 1 × TE of 0.5mL (10 × TE 50uL, ddH₂O 450uL) resuspended sedimentation cell, takes 80uL and is coated with corresponding solid culture plate, is inverted culture 3-5d for 30 DEG C and treats that bacterium colony grows.

2E.tenella TRBD are to yeast strain toxicity

The yeast size after pGBKT7-TRBD and pGBKT7 is converted more respectively, and the two no significant difference shows bait egg White (see accompanying drawing 1) free of toxic effects to yeast.

Detections of the 3E.tenella TRBD to yeast strain autonomous reporter activation

The yeast colony of picking conversion pGBKT7-TRBD and positive control pCL1 distinguishes dibbling in SD/-Trp/X- α-gal With SD/-Leu/X- α-gal agarose plates, 30 DEG C of incubator cultures.Result shows test group yeast colony without colour developing phenomenon, card Bright bait protein cannot be produced from Activation Activity (see accompanying drawing 1；1：Empty carrier plasmid pGBKT7；2：Bait plasmid pGBKT7- TRBD；3：Self-activation positive control plasmid pCL1).

Embodiment 3：

The screening of TRBD interaction proteins

First, material

-Trp/-His/-Leu DO Supplement、-Trp/-His/-Leu/-Ade DO Supplement (Clontech)。

2nd, method and result

The albumen that screening interacts with TRBD in 1 Yeast two-hybrid cDNA library

The Y187 monoclonals of 1.1 pickings conversion pGBKT7-TRBD are in 50mL SD/-Trp fluid nutrient mediums；

1.2 30 DEG C, 270r/min shaking table cultures to OD₆₀₀>0.8 (16~20h), normal temperature centrifugation 700g, 5min, abandons Clearly；

1.3 it is resuspended sink to the bottom, and with cell counting count board count, adjust cell concentration >=1 × 10⁸Cell/mL；

1.4 mixing 5mL bait bacterium Y187 and 1mL libraries AH109 cells (>=2 × 10⁷Cell) in an aseptic burning of 1L In conical flask；

1.5 add 2 × YPDA of 45mL fluid nutrient mediums (to contain Kan in conical flask⁺50 μ g/mL), the effective 1mL2 in library × YPDA is washed 2 times, and cleaning solution is added in conical flask；

1.6 30 DEG C of 30~50r/min of constant-temperature table, cultivate 20~24h；

1.7 culture 20h when, take a drop hybridization solution and check results of hybridization under the microscope, if having in hybridization solution clover or The heterozygote of Micky Mouse type occurs then stopping culture, 4h occurs if continuing to cultivate to heterozygote without if；

1.8 room temperature 1000g are centrifuged 10min, abandon supernatant.Use 50mL Mili-Q water washings conical flask 2 times simultaneously, and it is resuspended Sedimentation cell；

1.9 room temperature 1000g are centrifuged 10min, abandon supernatant.With 10mL Mili-Q water re-suspended cells；

1.10 coat on 90mm SD/-His/-Trp/-Leu solid mediums cell bead, per the μ L of plate 200, 30 DEG C incubated until clone occurs；

1.11 replicate be grown in SD/-His/-Trp/-Leu be cloned into SD/-Ade/-His/-Leu/-Trp culture mediums On, 30 DEG C of 3~8d of culture；

1.12 duplication SD/-Ade/-His/-Leu/-Trp are cloned into SD/-Ade/-His/-Leu/-Trp/X- α-Gal trainings Support on base and 2~4d is grown at 30 DEG C.PGBKT7-53/pGADT7-T and pGBKT7-lam/pGADT7-T be respectively it is positive and Negative control group.Test group and positive controls are cloned for blueness, and negative control culture plate bacterium colony do not grow and do not develop the color, tentatively Judge that the clone for obtaining is positive colony, see accompanying drawing 2；1：Test group (pGBKT7-TRBD/pGADT7-OTU)；2：Negative control Group (pGBKT7-lam/pGADT7-T)；3：Positive controls (pGBKT7-53/pGADT7-T).

The extraction and conversion of 2 positive yeast DNAs

The yeast clone that picking shows blue is inoculated in 5mL SD/-Leu fluid nutrient mediums, 30 DEG C, 210r/min shaken cultivations 1~2d, makes it lose pGBKT7-TRBD plasmids；5mL saccharomycete is collected, 3000g centrifugation 2min abandon supernatant；According to Tiangeng company The small extraction reagent kit specification of yeast plasmid, yeast plasmid is extracted using glass bead method.Carried locus coeruleus plasmid is converted into Escherichia coli Competent cell DH5 α, the positive bacterium solution clone of picking growth delivers to company's sequencing.By the gene order of sequencing result through NCBI Upper Blast compares, and preliminary proof OTU is an E.tenella TERT interaction albumen, in this research E.tenella OTU and E.tenella OTU(GenBank:013229759.1) nucleic acid homology is 100%.Nucleotide sequence is shown in sequence table 1.

Test example 1：

Positive interaction albumen pull-down checkings

First, material

Anti-His monoclonal antibodies, anti-GST monoclonal antibodies (Tiangen)；Glutathione-Sepharose 4B(GE,USA)；Protease inhibitor pellet (Roche)；Soluble type Ni-Agarose His label proteins purification kit, GST Ago-Gel.

2nd, method and result

1 primer synthesizes and PCR amplifying target genes

According to TRBD sequences Design special primers,

- the GGGGGATCCGACATCAAGACTCTTCGGGA-3 ' of F-TRBD-32a 5 ' (italic is BamH I restriction enzyme sites),

(italic is Xho I digestions position to the-GGGCTCGAGTCCTTTTAAACTTTCTAGATAC-3 ' of R-TRBD-32a 5 ' Point)；

The special primer ,-GGGGGATCCATGGTGCGCACATGTTTTGAC-3 ' of F-OTU-4T 5 ' are designed according to OTU genes (italic be BamH I restriction enzyme sites), (italic is the-GGGGTCGACCTATCCCGGCTTACTTGGCGT-3 ' of R-OTU-4T 5 ' Sal I restriction enzyme sites).Primer is synthesized by Shanghai biotechnology service company.

The structure of 2 recombinant expression plasmid pET-32a-TRBD and pGEX-4T-OTU

TRBD and OTU are subcloned to pET-32a and pGEX-4T respectively and build recombinant expression plasmid recombinant expression plasmid PET-32a-TRBD and pGEX-4T-OTU, recombinant expression plasmid pET-32a-TRBD is shown through double digestion and sequencing identification Successfully constructed with pGEX-4T-OTU.

The induced expression of 3 recombinant proteins

Take pET-32a-TRBD and pGEX-4T-OTU and be transformed into BL21 (DE3) competence respectively, plus IPTG is to final concentration 1mM.His-TRBD recombinant protein induced expression conditions are：25 DEG C, overnight；GST-OTU recombinant protein induced expression conditions are：18 DEG C, 20 hours.8000r/min is centrifuged 2min collects thallines.

The identification of 4 recombinant proteins

The bacterium solution that will be collected adds 800 μ L PBS, 55% power ultrasonic 10min, 12000g centrifugation 15min, separates supernatant And precipitation carries out SDS-PAGE analyses, as a result show that the two can be expressed with soluble form.

The purifying of 5 recombinant proteins

5mL bacterium solutions, 37 DEG C of 180r/min shaken cultivation 45min, plus IPTG to final concentration are added in 200mL LB culture mediums 1mM induction expression proteins.8000r/min is centrifuged 20min collects thallines.

His-TRBD is purified：3mL bacterial lysates, 55% power ultrasonic degradation on ice are added per 100mg thalline (weight in wet base) Thalline to bacterium solution becomes clear；12000g, 4 DEG C of centrifugation 20min, collects the soluble protein in supernatant；Will with Binding Buffer Cellular lysate liquid equimultiple dilution after upper prop and collect flow through liquid；Pillar is rinsed using 15 times of Binding Buffer of column volume, Wash away foreign protein；Eluted using Elution Buffer, it is albumen to collect eluent.

GST-OTU is purified：The resuspended precipitations of 1 × PBS of 10mL precoolings on ice, ultrasonication thalline is to transparence on ice； 12000g, 4 DEG C of centrifugation 20min, collects the soluble protein in supernatant；PBS balances chromatographic column, is subsequently adding containing destination protein Supernatant, so that destination protein is combined with Ago-Gel；After completion of the sample, 20 times of PBS detergent gels of bed volume are removing Foreign protein；Elute gst fusion proteins with the elution buffers of 10~15 times of bed volumes, and be in charge of collection (GST label proteins with Same procedure is purified, and does check experiment).

SDS-PAGE analysis shows purifying proteins effect preferably, can be used for follow-up test.

6pull-down

100 μ L Protein G lutathione-Sepharose 4B pearls, lysis are added in 6.1 1.5mL centrifuge tubes Buffer is washed 3 times；

GST-OTU albumen is added in 6.2lysis buffer, and adds protease inhibitors, 4 DEG C of shaking table overnight incubations. His-TRBD and GST is added in negative control group；

Supernatant discarded after 6.3 centrifugations, is washed three times with PBS, and His-TRBD soluble proteins, 4 DEG C of incubations are added in pearl 2h；

6.4PBS washings pearl 3 times；

6.5 add 30 μ L 1 × SDS-loading buffer, boiling water boiling 5min to separate albumen；

6.6Western blot analysis results.The Western blot analyses of test group, anti-His labels can be detected His-TRBD, shows that the two has interaction.And in control group His-TRBD/GST, Western blot cannot detect TRBD Albumen, shows that GST label proteins can not be combined with His-TRBD, sees accompanying drawing 3；1.GST/His-TRBD；2.GST-OTU/His- TRBD；3.input.

Test example 2：

E.tenella viral vectors mediates hammerhead ribozyme to OTU In vitro digestion effect disquisitions

First, material

T7 in-vitro transcription kits (Promega Corporation)；FastStart Universal SYBR Green Master (Rox) (F.Hoffmann-La Roche, Ltd)；Quantitative real time PCR Instrument (Applied Biosystems)；anti- α-tubulin antibody (green skies Bioisystech Co., Ltd).

2nd, method and result

1 sequent synthesis

Note：Wherein italicized item is restriction enzyme site, and underscore part is hammerhead ribozyme.Primer is U.S. biological by Jilin provincial treasury Science and Technology Ltd. synthesizes.

2 construction of recombinant plasmid

With E.tenella cDNA as template, OTU-sub-F/OTU-sub-R as primer, PCR amplification cutting substrates, and sub- It is cloned into pEtV-GFP-CFP, construction recombination plasmid pEtV-OTU-sub.By Ham-OTU-F/Ham-OTU-R, Ham-MIC-F/ Ham-MIC-R and Noham-OTU-F/Noham-OTU-F tri- is slowly annealed to room temperature to 95 DEG C of denaturation 5min of primer.By three Fragment is connected with the pEtV-GFP-CFP carriers preserved through this laboratory after Hind III/Sal I digestions respectively, engineered structure Build up recombinant plasmid pEtV-GFP-Ham-OTU, pEtV-GFP-Ham-MIC and pEtV-GFP-Noham-OTU.

3 In vitro digestions

By pEtV-OTU-sub, pEtV-GFP-Ham-OTU, pEtV-GFP-Ham-MIC and pEtV-GFP-Noham-OTU Expanded through primer T7-F/T7-R PCR.As template after the recovery of PCR primer gel, carried out in vitro with T7 in-vitro transcription kits Transcription.

By the transcription product RNA of pEtV-GFP-Ham-OTU, pEtV-GFP-Ham-MIC and pEtV-GFP-Noham-OTU With pEtV-OTU-sub transcribe RNA with molecular proportion be 5:The solution that 1 ratio is mixed in Tris-HCl (pH 8.0) is dense to end It is 50mM to spend, 95 DEG C, 3min；37 DEG C, 5min；It is eventually adding MgCl₂To final concentration 10mM start cleavage reaction, 37 DEG C, 3h, often Individual reaction sets 3 repetitions.

4 In vitro digestion Efficiency testings

With OTU-sub-R as primer, by the product RNA reverse transcriptions of pEtV-OTU-sub transcriptions into cDNA.Use RNase- free H₂CDNA is pressed 10 by O^-2~10^-7After gradient dilution, respectively taking 1 μ L carries out Real-time PCR reactions, each gradient sample 3 repetitions are done, standard curve is made.The linear relationship of standard curve is good, and coefficient correlation is 0.994.

Mixture after being cut with pEtV-GFP-Ham-OTU, pEtV-GFP-Ham-MIC and pEtV-GFP-Noham-OTU It is template, OTU-sub-R carries out RT reactions for primer.Respectively taking 1 μ L cDNA carries out Real-time PCR reactions, is used to detect The cutting efficiency of pEtV-GFP-Ham-OTU In vitro transcripts.Each gradient sample does 3 repetitions.Real-time PCR results Show, pEtV-GFP-Ham-OTU in-vitro transcriptions RNA is notable to the cutting efficiency of pEtV-OTU-sub In vitro transcripts RNA, reaches To 85.24%.And influence of the pEtV-GFP-Noham-OTU In vitro transcripts to pEtV-OTU-sub In vitro transcripts RNA compared with Small, efficiency is only that 20%, pEtV-GFP-Ham-MIC influences on pEtV-OTU-sub outer transcription RNA reverse transcriptions, sees accompanying drawing 4.

Test example 3：

E.tenella viral vectors mediates hammerhead ribozyme to OTU vivo excision effect disquisitions

First, material

GFP-CFP transfection strains are built and are preserved by this laboratory；Anti- α-tubulin antibody (the green skies)；Electroporation and Electric revolving cup (BTX)；Flow cytometer FACS Aria II (BD).

2nd, method and result

The separation of 1 transgenosis egg capsule

Added in electric revolving cup 20 μ L pEtV-GFP-Ham-OTU in-vitro transcriptions RNA, 30 μ L unsporulated oocysts (1 × 10⁵It is individual) and 50 μ L electricity turn buffer solution, carried out after ice bath 15min electricity turn.Electricity turns condition：Voltage 500V, time 0.3ms, electric shock 3 It is secondary, per minor tick 100ms.After electricity turns to finish, ice bath 15min in transfer unsporulated oocysts to 6 porocyte culture plates, is added Appropriate K₂Cr₂O₇Carry out Sporulated.

The Sporulated Oocysts (being defined as GFP-Ham-OTU plants) for transfecting pEtV-GFP-Ham-OTU in-vitro transcriptions RNA are connect 10 Japanese instar chicklings are planted, the excrement after 5~7d of inoculation is collected and is separated egg capsule.RFP after confocal laser scanning microscope transfection Expression, it is seen that GFP-Ham-OTU plants can be observed green fluorescence, and untransfected group unstressed configuration is shown in accompanying drawing 5；A：GFP-Ham- OTU unsporulated oocysts；B：GFP-Ham-OTU Sporulated Oocysts.

Fluidic cell sorting is carried out with red fluorescence egg capsule by separate, the egg capsule after sorting is inoculated with 10 Japanese instar chicklings, Collect the excrement after 5~7d of inoculation and separate egg capsule.The egg capsule ratio with green fluorescence is 26.9% (see accompanying drawing in two generation egg capsules 6；A：Wild strain；B：Two generations of GFP-transfected-Ham-OTU egg capsule).The egg capsule that will mix is sorted by fluidic cell.

The detection of 2 vivo excision effects and protein content

Extract the total serum IgE for extracting wild strain, GFP-Ham-OTU plants and GFP-CFP plants respectively respectively, external reverse transcription, It is template with 2ul reverse transcription products, Real-time PCR reactions is carried out, while setting up negative control.Extract wild strain, GFP- The Ham-OTU plants and GFP-CFP plants polypide albumen of egg capsule, Western blot detection OTU expression quantity, albumen applied sample amount is 20 μg.With anti-OTU polyclonal antibodies and anti-α-GAPDH antibody (internal reference) as primary antibody, with goat-anti rabbit and sheep that HRP is marked Anti- mouse IgG is secondary antibody.Relative to wild strain, accompanying drawing 7A (1 is shown in GFP-Ham-OTU plants of downward：Wild type unsporulated oocysts；2： Transfection RFP-GFP unsporulated oocysts；3：GFP-transfected-Ham-OTU unsporulated oocysts), Fig. 7 B (E.tenella viral vectors The hammerhead ribozyme of mediation is to OTU-sub vivo excisions effect).Result shows the hammerhead ribozyme for building in E.tenella bodies The interior expression for successfully disturbing OTU.

Test example 4：

TRAP methods detection transfection strain telomerase activation

First, material

Telomerase activation detection kit (Millipore).

2nd, method and result

1 primer synthesizes

TRAP reaction primers are designed according to E.tenella telomeric dnas repetitive sequence.

2 TRAP methods detect telomerase activation

After RNase-free PBS washing unsporulated oocysts, 1 × 10 is taken⁷Individual polypide adds 200 μ L CHAPS lysates, uses High-speed organization mill grinds 35 times on ice, every time 1~2sec.Ice bath cracks 20min, then 12000g, 4 DEG C of centrifugation 15min, Supernatant is taken, is dispensed, -80 DEG C of preservations.

TRAP reaction systems：

Telomere enzyme extract	2μL(600ng)
		10×TRAP Buffer	5μL
50×dNTP Mix	1μL
		TS primers	1μL
ddH2O	39μL

30 DEG C of reactions 30min, 95 DEG C of inactivation 5min.Be subsequently adding PR primers 1 μ L, rTaq 1 μ L enter performing PCR amplification.

Amplification is：94 DEG C of 1min, 59 DEG C of 1min, 72 DEG C of 1min, 33cycles.

12% Native PAGE gel electrophoresis, EB dyeing, is shown in (the M of accompanying drawing 8：DNA molecular amount (DL500DNA Marker)；1： HeLa cell TRAP products (positive control)；2：Wild type unsporulated oocysts TRAP products；3：The GFP-transfected non-Sporulateds of-GFP Egg capsule TRAP products；4：GFP-transfected-Ham-OTU unsporulated oocysts TRAP products).Result shows：When OTU gene expression quilts After suppression, the reduction of E.tenella telomerase activations shows that OTU has the effect of positive regulation for telomerase activation.

Eimeria Tenella TRBD sequences

<110>Jilin University

<120>

<140>

<160> 1

<210> 1

<211>513

<212> DNA

<213>Eimeria Tenella（Emeriatenella）

<400> 1

1 attacaagtactagagtagtaaattttttatctagatacttgattaaagtattaccaaag

61 aatatacttttaggtacctttaaaaactttaagacttttattaataaaaagatcccaataa

121 ttgtgaatcttcatattagagaaacttttaagattcaacatgcaatgaatggaattgagg

181 tttcaaattgggtaaatagacttgaaatagaaagttatcaatttaaaattaaatcaaaa

241 aatgaattaaatgaatctattaatagatctaaaaagcaaccgaataatgtaacaagatct

301 aagagtaaaaaaagtttaattagccttggaattaaatatctagctacaagggaaaacatt

361 tattttttaatatatttggtatttccagtaatattaagaagacattatgcaacagaaatt

421 gagggtttcagtaaagtaagatattttaatagaccagtttggataaagatcgtgcataga

481 caagctgataaatggtatctagaaagtttaaaa

Eimeria Tenella OTU sequences

<110>Jilin University

<120>

<140>

<160> 1

<210> 1

<211> 1107

<212> DNA

<213>Eimeria Tenella（Emeriatenella）

<400> 1

1 atggtgcgcacatgttttgactcgaaagtgctgagctcctctccttcctcctccgcatcc

61 agctcagacgaatcggcttctccctctaaaaagggatattccatagtcgggggcccctct

121 cttgacggccaccaggagcaacgtgatgccccgaagattcggccaatgactacagatgat

181 ttcgtcttattggatcgtttggaaaggcgagttgacgtacaaagcttcgcgactgtcttg

241 aaggcgtatttgattgtgcggactcgcttggctgcgaagagggcggacagggagtttaag

301 agacgcaggacgaagggtaggaatgcgtccgcaggggccgaagggtccaccatgaagggc

361 cctttgatgtctccaaagaaggtgagcagcagagtggctcttcttagcagttataagcca

421 gatgcctatgacgcagaagagcagaggcaaggagatgaaaagcaactcgcgagaggtgcc

481 agtttctttcgtcgcctgtggtctttcaagaagagcgacagagaagaagaggcgaggcca

541 accactgtcctgacgaccacgtcaaacagcagcagcacatcacccagagcggctgcgcga

601 gcccacgttagctatccaaagaacataacggcgtgggagacggagtcgagtctgcttgag

661 cagcgtttgtcgtttttaggatgccgcacagtaacatccgtaggggacggcaactgccag

721 ttccgttcgtgttcattctctctatttgggaaggaggacgaacatcggcatgtgaggcgt

781 atggctgtcgcacaaatgcgaaaatgccgcaaagattatgaagtcttttttgatggcgcc

841 ccattgtttgataggtatttgagagatatggagcgaagcggcacatggggagacgaactg

901 tctctccgtgcagtggccgatgcgttttgctgcaccatacacctgataacatcaacccca

961 acgagctggtacctccgctacgaccctgagcgagacggagcaaaggtcagcccacaaaga

1021 cacattttcctcacatatatttcgcccatacactacaatgccttctacctaaaggaaagc

1081 gtaggcacgccaagtaagccgggatag

Claims (4)

1. a kind of Eimeria Tenella TERT and its related protein gene OTU, it is characterised in that：Gene order such as SEQ NO1, Shown in SEQ NO2.

2. the Eimeria Tenella TERT and its related protein gene OTU described in claim 1, it is characterised in that：The gene The albumen of coding is to pass through TERT albumen pair using the method for yeast two-hybridE. tenellaCDNA library screened, obtain The albumen for having interaction with TERT is obtained, and positive verification is carried out by the method that yeast replys experiment and pull-down, so that It is determined thatE. tenellaThe interaction albumen OUT of telomerase albumen；UtilizeE. tenellaThe ribozyme of viral vectors mediation is done Expression of the OTU genes in coccidia body is disturbed, so as to study OTU albumen existE. tenellaInternal function.

3. a kind of preparation method of Eimeria Tenella TERT related protein genes as claimed in claim 1, including it is following Step：

1）The structure of the recombinant bait plasmid containing TERT genes：FromE. tenellaTERT sequences are obtained by PCR in cDNA Row, reclaim purpose fragment and carry out double digestion, are connected with the pGBKT7 carriers after digestion, and are transferred to amplification in Escherichia coli, lead to Cross plasmid double digestion and sequencing identification and obtain positive colony, as can expressed fusion protein recombinant plasmid；

2）Recombinant bait plasmid is transformed into yeast strain, and carries out toxicity and self-activation identification；

3）Screened with the method for yeast two-hybridE. tenellaThe candidate albumen interacted with TRBD in cDNA library；

4）The method replied with pull-down and yeast further verifies that it interacts, so that it is determined that it isE. tenella The albumen that TERT interacts；TERT albumen and candidate albumen are building up on pET-32a and pGEX-4T carriers respectively, low Under the conditions of temperature, induced expression and purifying are carried out to soluble protein in BL21 (DE3) competence；The candidate albumen of purifying is added Enter Glutathione-Sepharose 4B Ago-Gels, after 4 ° of overnight incubations, the agarose for being combined with candidate albumen is coagulated Glue bead adds TERT albumen, and the result of positive interaction is tested and analyzed finally by Western blot；

5）Design synthesis is directed to the hammerhead ribozyme of interaction GFP and is connected toE. tenellaOn viral vectors, body is used Outer transcript reagent box carries out in-vitro transcription, obtains its cell-free transcription folder, is divided in vivo and respectively in vitro with fluorescence quantifying PCR method The hammerhead ribozyme of viral vectors mediation has been analysed to the gene mRNA cutting efficiency；

6）TRAP methods detection transfection strain telomerase activation.

4. a kind of preparation method of Eimeria Tenella TERT related protein genes as claimed in claim 1, its feature exists In：

Anti-sense primer：F-TRBD-BK 5’-GGGGAATTCATTACAAGTACTAGAGTAGTAAATT-3’；

Anti-sense primer：R-TRBD-BK 5’-GGGGGATCCTCCTTTTAAACTTTCTAGATAC-3’。