CN106754924A

CN106754924A - A kind of long non-coding RNA and its application in diagnosis/treatment non-small cell lung cancer

Info

Publication number: CN106754924A
Application number: CN201611164026.5A
Authority: CN
Inventors: 德伟; 张二宝
Original assignee: Nanjing Medical University
Current assignee: Nanjing University; Nanjing Medical University
Priority date: 2016-12-16
Filing date: 2016-12-16
Publication date: 2017-05-31

Abstract

The invention belongs to genetic engineering field, applications of the more particularly to LINC01116 in prediction non-small cell lung cancer prognosis and target drug treatment is prepared；Reagent for LINC01116 detections with diagnosing non-small cell lung cancer and can judge Patients with Non-small-cell Lung prognosis；The inhibitor of LINC01116 can treat non-small cell lung cancer.

Description

A kind of long non-coding RNA and its application in diagnosis/treatment non-small cell lung cancer

Technical field

The invention belongs to genetic engineering field, more particularly to a kind of long non-coding RNA and its in diagnosis/treatment non-small cell Application in lung cancer.

Background technology

Lung cancer is morbidity and mortality highest malignant tumour in China or even world wide.National Cancer Register Latest data shows：The annual new cases of China about 70.5 ten thousand, the incidence of disease be 36.28/10 ten thousand people, death about 56.9 ten thousand, The death rate is 28.81/10 ten thousand people, seriously threatens national health.Wherein non-small cell lung cancer (non-small cell lung Cancer, NSCLC) 80-85% of lung cancer morbidity, including adenocarcinoma of lung and the big main histological type of squamous carcinoma two are accounted for, for NSCLC The molecular mechanism for developing further investigate be current lung cancer research concern focus.

The life science of the past is conceived to encoding gene mostly, in recent years, with genome times afterwards comprehensively technical merit Continue to develop, long-chain non-coding RNA (long non-coding RNA, lncRNAs) has caused increasing pass Note.LncRNA is a RNA molecule of the class transcript length more than 200nt, their not encoding proteins, but in the form of RNA The expression of (epigenetic level, transcription and post-transcriptional level etc.) controlling gene in various aspects, thus pole is subject to recently Big concern.Increasing research confirms that lncRNAs is not only played in the normal physiological function maintenance of body and growth course Important regulating and controlling effect, the malignant progression that its unconventionality expression develops especially tumour with the generation of disease has close ties.Dislike Property tumour be that current lncRNAs studies one of field the most active, increasing research shows that lncRNAs can be in the cell Complicated expression regulation network is formed, the significant process such as propagation, apoptosis, the migration of tumour cell are adjusted, kinds of tumors bag is influenceed Lung cancer is included to develop.Such as lncRNA HOTAIR mediate target gene histone H 3 K27 front threes by raising and binding PRC2 A series of apparent expression for suppressing tumor suppressor genes of modification of base, promotes the invasion and attack transfer of breast cancer cell.In stomach cancer cell HOTAIR can also " emulative absorption " miR-331-3p so as to promote HER2 to express, promote the development of stomach carcinogenesis.For example, The lncRNA MALAT1 overexpressions found at first in lung cancer, can be various in the multiple level modulation such as histone modification, transcription Cancer associated gene promotes lung cancer malignant progression.

Weinberg et al. proposes that the lasting malignant proliferation of tumour cell is one of its important phenotype, Er Qiezheng on Cell Normal cell transformation is into needing to obtain a series of phenotypes and ability during tumour cell, including avoids the table that immunocyte kills Type.And it has been demonstrated that tumour cell will grow must reduce the immunogenicity of its own so as to avoid Immune discrimination and kill Wound.But it is less on Mechanism Study that modulate tumor cell obtains this performance process, and recently many studies have shown that, LncRNAs can regulate and control its immunobiologic function in various immunocytes.But it is endogenic in tumour cell to exempt from Epidemic disease role is unclear, is worth further investigation.

For further research lncRNAs occurs developing effect in NSCLC, we are first by lung cancer and cancer side group GEO (Gene Expression Omnibus) databases and TCGA (the The Cancer Genome Atlas) large database concept knitted It is analyzed, filters out lncRNA LINC01116.Result finds LINC01116 up-regulateds and again in many parts of chip datas It is a kind of intergenic lncRNA with reference to lncRNA MALAT1 and HOTAIR, LINC01116 that number is positive higher than lung cancer, is positioned at Human chromosomal 2q31.1, total length 1058nt, the research that there is no it to participate in tumor development at present.Further existed by qPCR Verified in 190 pairs of NSCLC samples and find that its expression is significantly raised.Further bioinformatic analysis find that LINC01116 starts There is the histone H 3 K27 acetylations enrichment of high abundance in sub-district, ChIP experiments prove that H3K27Ac can activate LINC01116's Expression.Cell and zoopery find that the expression for striking low LINC01116 can significantly inhibit the multiplication capacity of cell, and inducing cell Apoptosis.Transcript profile sequencing finds that it can not only regulate and control Proliferation and apoptosis related gene after striking low LINC01116, has been surprisingly found that it also Main influence anti tumor immune response and inflammation-related gene.Mechanism Study finds that LINC01116 can be as in nucleus " molecular scaffold " while bind PRC2 and DNMT1, while in the histone methylated and apparent silence IRF7 of DNA methylation level With the expression of CD1D.CD1D as NKT cell recognitions unique target spot, co-culture experiments find to strike low LINC01116 and can increase Identification and killing ability of the strong NKT cells to NSCLC cells.And LINC01116 can be used as " emulative endogenous in cytoplasm RNA " " absorption " microRNA-145-5p, promotes Survivin expression, so as to promote NSCLC cells survivals.To sum up, Wo Menfa Existing LINC01116, by different molecular mechanisms, collectively promotes the escape of NSCLC cellular immunities in nucleus and cytoplasm, from And promote the malignant proliferation of NSCLC, participating in NSCLC develops, and may for the diagnoses and treatment of NSCLC provide target spot and according to According to.

The content of the invention

It is an object of the invention to provide for diagnosing non-small cell lung cancer (NSCLC) prognosis situation or non-small thin as treatment The lncRNA LINC01116 of born of the same parents' lung-cancer medicament target spot, its gene is located at 2q31.1, and total length 1058nt, its nucleotides sequence is classified as SEQ ID NO：1,

SEQ ID NO:1：

Label the invention further relates to recognize described long non-coding RNA judges that Treatment for Non-small Cell Lung is pre- in preparation Application in the diagnostic products of situation afterwards, described label is included but is not limited to：

(1) long non-coding RNA described in the combination of the primer/primer sets or fluorescence labeling that combine the long non-coding RNA Primer/primer sets；

(2) micromolecular compound of the long non-coding RNA is combined；

(3) large biological molecule of the long non-coding RNA is combined, described large biological molecule includes but is not limited to：Antibody Or the antibody or antibody functional fragment of antibody functional fragment, fluorescence labeling, rna binding protein or its function fragment, fluorescence labeling Rna binding protein or its function fragment.

Preferably, the nucleotide sequence of the primer sets of described primer sets or fluorescence labeling such as SEQ ID NO.2 and SEQ Shown in ID NO.3,

LINC01116 Primer F(SEQ ID NO：2)：5'AACGCTTTTGAATATGGGGAC3',

Primer R(SEQ ID NO：3)：5’-CAATCACAGAGCTCTCCTTGC-3’.

GAPDH Primer F(SEQ ID NO：4)：5'AGCCACATCGCTCAGACAC 3',

Primer R(SEQ ID NO：5)：5'GCCCAATACGACCAAATCC3'.

The invention further relates to the label comprising the long non-coding RNA described in described identification for judging non-small cell The reagent or kit of lung cancer therapy prognosis situation.

Reagent the invention further relates to the label of the long non-coding RNA described in described identification or comprising the label Or application of the kit in the treatment prognosis situation for judging non-small cell lung cancer.

The invention further relates to application of the described long non-coding RNA in the medicine for preparing treatment non-small cell lung cancer；

The diagnosis of non-small cell lung cancer prognosis situation is being judged as screening the invention further relates to described long non-coding RNA Application in reagent.

The invention further relates to described long non-coding RNA answering in as the medicine of screening treatment non-small cell lung cancer With.

Technical scheme

Tissue specimen is collected

190 pairs of NSCLC tissues and cancer beside organism's sample come from Jiangsu Province's tumor tissues sample storehouse and Nanjing Military Command Zong Yuan Division of respiratory disease sample storehouse, compiled, and strictly identified by pathology department since 2009 and 2010.All samples are once excision Freezed in liquid nitrogen immediately, be stored in -80 DEG C, until RNA is extracted.And this research is by Nanjing Medical University ethics committee member Can agree to.

Cell culture

NSCLC cell line A549, PC9, NCI-H1703, NCI-H1975, NCI-H226, SK-MES-1, NCI-H1650, It is thin that NCI-H1299 and lung mucous epithelium normal cell system 16HBE are purchased from the American Type Culture Collection committee of the Chinese Academy of Sciences Born of the same parents storehouse.Cell culture the RPMI 1640 containing 10% hyclone (10%FBS) or DMEM culture medium (GIBCO), containing double Anti- 100U/ml penicillin and 100 mg/ml streptomysins (Invitrogen companies).In 37 DEG C of constant incubators of 5%CO2 Cellar culture.Fresh culture was changed per 2-3 days, is passed on when cell fusion degree is full.

RNA is extracted and quantitative PCR analysis

According to the operation instruction of reagent, total serum IgE is separated with Trizol reagents.Reverse transcription reaction application TaKaRa Prime Script kits (TaKaRa, Dalian, China).Reverse Transcriptase kit carries out reverse transcription to 1 μ g total serum IgEs, and final volume is 20 μ l.Interpretation of result：The specificity and amplification efficiency of analysis primer, the atopic of primer is judged according to solubility curve.According to expansion Increase curve and obtain Ct values, the analysis of genes of interest relative expression quantity is carried out using relative measurement and internal reference GAPDH.Computing formula For：2^ (- △ Ct), △ Ct=Ct gene-Ct control.

Plasmid construction

According to the full length cDNA sequence of NCBI (gene) inquirer's LINC01116 genes, company synthesizes the complete of LINC01116 Sequence long, and insert carrier for expression of eukaryon pCDNA3.1 (+), build LINC01116 eukaryotic over-expression vectors pCDNA- LINC01116, Escherichia coli are converted by above-mentioned plasmid, shake bacterium, and subsequent experimental is used for after extracting plasmid.

Cell transfecting

All plasmid vectors (pCDNA3.1-LINC01116, si-LINC01116 and empty carrier plasmid) for transfecting, It is both needed to extract (Qiagen) with the endotoxic plasmid extraction kit of removal.The interference sequence and negative control (si- of genes of interest NC Invitrogen companies (Invitrogen, USA)) are purchased from.A549 cells and NCI-H226 cell fusions have expired just inoculation To in six orifice plates, then operated according to explanation.After transfection 48 hours, cell is collected, for qRT-PCR or immunoblotting assay.

Cell-proliferation activity is detected

MTT experiment, 96 well culture plates are inoculated in by the cell after treatment by 2000-3000, every hole cell.Treat cell After 80% is adherent, cell synchronization 12h discards original culture medium.Each sample sets 6 multiple holes, is per hole total reaction volume 200μl.The MTT reaction solutions (5mg/ml is dissolved in PBS) of 20 μ l are added per hole, 37 DEG C of lucifuges are incubated 4h.Abandoning supernatant, per hole 150 μ l dimethyl sulfoxides (DMSO) are added, 10min is shaken, ELIASA determines the absorbance at 490nm wavelength.

Clone forming Test, first by 0.25% Trypsin Induced and blows and beats into single cell suspension.By cell suspension Make gradient multiple dilutions, (about 600-1000 left in being inoculated in culture dish with appropriate cell density (according to multiplication capacity) It is right), cell is uniformly dispersed.Put in 37 DEG C of CO2 incubators, probably cultivate 2 weeks or so.Liquid is changed in often observation, when going out in culture dish During existing macroscopic clone, terminate culture.Abandoning supernatant, is carefully embathed 2 times with PBS.Plus pure methyl alcohol 1-2ml or so, Gu Determine 10-15min or so.Then go fixer, plus appropriate 0.1% crystal violet application dyeing liquor to contaminate 10~30min, then use PBS Dyeing liquor slowly is washed away, is air-dried.Then plate is inverted and is superimposed a transparent film with grid, with the naked eye directly count Number clone, or the clone's number more than 10 cells is counted in microscope (low power lens), finally compare each group difference, calculate clone's shape Into rate.

BrdU experimental analyses, the specification that BrdU experimental procedures are provided according to kit carry out by step (Millipore, Cat.No.2750).OD values high represent multiplication capacity high.

Flow cytometry

Apoptosis detection, the cell after being transfected 48 hours with collected by trypsinisation, then according to FITC Annexin V apoptosis Detection kit (BD) and its operation instruction give Annexin V-FITC fluorescence probes and propidium iodide (PI) dyeing.Streaming is thin Born of the same parents' instrument is detected and analyzed.

Cell cycle detects that giving PI using CycleTESTTM PLUS DNA kits (BD) according to specification dyes, Then analyzed with FACScan.

Cell protein is extracted and determined

The extraction of total protein of cell：Tissue Culture Plate is placed on ice, and the cell after transfection is abandoned into culture medium, the PBS of precooling Rinse 2 times.RIPA cell pyrolysis liquids are taken, using PMSF and protease inhibitors cocktail is added in preceding several minutes, is made The ultimate density of PMSF is 1mM, and mixing is added in cell.Add the volume of 100 μ l or so to add per hole according to 6 orifice plates to mix Lysate.Cell is scraped off from culture dish bottom surface with clean cell scraper, is fully contacted lysate and cell.Put on ice 20min is put, cracks cell abundant.After cell is fully cracked, 4 DEG C, 12000g centrifugation 10min take supernatant, as total egg In vain.

BCA kits survey protein concentration：0.8ml protein standard liquid is taken to be added in a pipe standards albumen (20mg BSA), The protein standard solution of 25mg/ml is fully configured to after dissolving.Take appropriate 25mg/ml protein standard solution be diluted to eventually it is dense It is 0.5mg/ml to spend.According to the quantity of sample, 1 volume BCA reagents B (50 is added according to 50 volume BCA reagent As:1) prepare appropriate BCA working solutions, fully mix.Standard items are added in the standard sample wells of 96 orifice plates by 0,1,2,4,8,12,16,20 μ l, mark-on Quasi- product dilution is supplied to 20 μ l.Plus the sample of appropriate volume is in the sample well of 96 orifice plates, plus standard dilutions are to 20 μ l.Each hole adds 200 μ l BCA working solutions, 37 DEG C of placement 30min.The absorbance at 570nm is determined with ELIASA, according to mark Directrix curve calculates the concentration of testing protein sample.

Immunoblotting assay and antibody

Cell protein pyrolysis product is separated by 10%SDS-PAGE, is transferred to 0.22 μm of NC film, uses specific antibody It is incubated.Autoradiograph densitometry is so as to be quantized.GAPDH antibody is used as control.Specific purpose resists Body and GAPDH antibody (1:1000) bought from CST companies.

Immunohistochemical experiment

Dewaxing：Dimethylbenzene 3 × 5min, 100% ethanol 1 × 5min, 100% ethanol 1 × 1min, 95% 2 × 1min of ethanol, 70% 1 × 1min of ethanol, distilled water immersion washes away ethanol；600ml DW+5.6ml antigen retrieval buffers are held in beaker, by slide In on plastic processing frame, micro-wave oven big fire 3-5min is put in immersion to frame, and boiling is just tuned into small fire, and 15-20min, the time is more long beneficial to antigen More exposures；After natural cooling, the water around tissue is dried, it is good with SABC stroke；PBS+0.03%Tween20 (300 μ l Tween20 are added in 1000ml PBS), is added dropwise, and rinses 5min, gets rid of；3%H2O2 is added dropwise, and 15min gets rid of；PBS Rinse 5min；Blocking antigen (preparing 5% skim milk with PBS to be added dropwise) 30min；PBS+0.03%Tween20 is added dropwise to rinse, gets rid of Moisture is removed, primary antibody is added, 4 DEG C overnight；PBS+0.03%Tween20 is added dropwise to rinse, 3 × 5min；Secondary antibody is added dropwise to be incubated；It is added dropwise PBS+0.03%Tween20 is rinsed, 2 × 5min, and PBS rinses 1 × 5min；DAB is added dropwise, flowing water rinses 5-10min；Bush uniformly dyeing Color 1min, flowing water rinses 5min；1%Hcl (using 70% alcohol) soaks 5-15s, and flowing water rinses 10min；70% ethanol 2min, 80% ethanol 2min, 95% ethanol 2 × 2min, 100% 2 × 15min of ethanol, 3 × 5min of dimethylbenzene；Mounting.

Histotomy H＆E is dyeed

Dewaxed with dimethylbenzene first, then gradient alcohol dehydration；Dimethylbenzene 5min → diformazan 5min → 100% ethanol 2min → 95% ethanol 2min → 90% ethanol 2min → 85% ethanol 2min → 80% ethanol 2min → 70% ethanol 2min → 50% Ethanol 2min → 30% ethanol 2min → brazilwood extract dyeing 5min → ddH2O flushings 5min → weak ammonia liquor 5s → ddH2O 2min → 30% ethanol 2min → 50% ethanol 2min → 70% ethanol 2min → 80% ethanol 2min → 85% ethanol 2min → 85% second Alcohol 30min → 90% ethanol 2min → 95% ethanol, eosin stains 10min → 95% ethanol 2min → 100% ethanol 2min → 100% ethanol 2min → dimethylbenzene 5min- dimethylbenzene 5min.Neutral gum mounting, dries, you can basis of microscopic observation tissue disease Reason change situation.

The screening of G418 methods surely turns cell

Cell is diluted to 1000 cell/ml, 24 orifice plates is spread, in the G418 concentration ranges of 100ug/ml~1mg/ml Screened, selecting tried screening of the minimum G418 concentration of complete cell death to carry out next step in 10 to 14 days Test.Just start after plasmid transfection 24h plus G418 screenings, concentration and activity with the metabolism G418 of cell can all decline, institute The once screening liquid containing G418 will be changed with every 3 to 5 days.At this moment drug concentration can be down to 200 μ g/ml.Treat cell list After Clone formation, the culture dish that termination culture will form clone is placed in basis of microscopic observation cloning site, and each is cloned It is accurate that position marker pen is marked；In super-clean bench, the nutrient solution in culture dish is discarded；One piece of filter paper block is gripped with tweezers, is used 0.25%Trypsin digestive juices soak, and are placed at institute's marker clone position, 5-20s；G418 is added to select per hole 24 well culture plates Culture medium 2ml, the filter paper block for having sticked clone cell is taken out with tweezers, is placed in the culture medium in hole, rinses filter paper block number It is secondary, so that under the cell detachment for sticking.After Microscopic observation confirms that cell has come off, filter paper block is taken out and is discarded, other clones Method is shifted ibid；24 well culture plates for having clone cell will be moved, continues to put 37 DEG C of 5%CO2 incubator cultures, 2-5 days；Treat thin After born of the same parents cover with, the digestion of 0.25%Trypsin digestive juices, and cell is transferred to 6 orifice plates continues to cultivate, or expand in being transferred to many bottles Increase, hereafter can do further appraisal.

Nude mice Lung metastases model experiment

4 week old male nude mouse BALB/c mouses are bought, it is standby；Culture A549 cells, cultivate A549 cells, transfect respectively Sh-LINC01116 carriers and empty carrier；G418 screenings are steady to turn cell, and pancreatin digestion, PBS is washed twice, is resuspended in serum-free In culture medium, and count.Cell takes 2 × 106 cells and is suspended in 0.1ml serum free mediums or PBS, after injection cell Occurring since knurl body, 1 formational situation of knurl body of observation in every three days, and measure the volume of knurl body；After knurl body forms the 16th day Nude mice is put to death, sample is taken, the weight and volume of sample is measured, gross tumor volume computing formula is：Length × width2 × 0.5, Wherein L is the maximum length of tumour, and W is the Breadth Maximum of tumour；Above all of experimental arrangement is all according to NIH1996 versions Zoopery instruct to perform.Mouse is fed with full-valence pellet feed, autoclaving water is freely drunk, room temperature (22 ± 2) DEG C, Humidity 50~60%, well-ventilated, 12:12h illumination/dark cycle.All experiments by Nanjing Medical University's animal protection and Ethics Committee (IACUC) ratifies.

Sub-cellular orientation

According to operation instructions the thin of lung carcinoma cell is separated using PARIS kits (Life Technologies, USA) Karyon and cytoplasm.The distribution of LINC01116, GAPDH and U6 in cytoplasm and nucleus is detected using qPCR methods. GAPDH is cytoplasm reference, and U6 is nucleus reference.LINC01116, GAPDH and U1 are presented in cytoplasm with total serum IgE percentage With the expression in nucleus.

Transcript profile sequencing experiment

It is long to the lip2000si- that 10ul is awarded after 80% or so after cell by cell seeding in six orifice plates LINC01116 and si-NC treatment, is processed with Trizol after 48h and collects cell, sample presentation, by Beijing genetic test mechanism for implementing, choosing Subsequent experiment is carried out with Illumina, corresponding data are obtained and process.

Bioinformatics Prediction destination protein is combined with lncRNAs

In (http://pridb.gdcb.iastate.edu/RPISeq/references.php) website on-line prediction is each The possibility that individual destination protein is combined with LINC01116.Mainly by inquire about the amino acid sequence of destination protein with The prediction of the nucleotide sequence binding ability of LINC01116.By with BioGPS (http://biogps.org/#goto= Welcome) expression of the LINC01116 in various normal structures is analyzed.

RNA Western blottings (RIP)

Cracking A549 and NCI-H226 cells are used for endogenous PRC2 compound immunoblot experiments.By cell conditioned medium with Coating recognizes that EZH2, DNMT1, SNRNP70 and the albumin A/G agaroses magnetic bead of control IgG are incubated 6 hours at 4 DEG C respectively.With Afterwards, magnetic bead is cleaned, is incubated 30 minutes to remove removing protein at 55 DEG C with 0.1%SDS/0.5mg/ml Proteinase Ks.RNA is extracted to supply QPCR is analyzed.

Chromatin immune is co-precipitated (CHIP)

Using the solid A549 and NCI-H226 cells of 4% paraformaldehyde, it is incubated 10 minutes to produce DNA- protein-crosslinkings.Ultrasound Cell lysis to produce the chromosome fragment of 200-300bp, then with EZH2 and DNMT1 specific antibodies and control IgG antibody It is incubated precipitation.Recover chromatin dna, then tested and analyzed using qPCR.

Luciferase reporter gene is tested

The sequence (including sequence of LINC01116, the 3UTR of Survivin) of synthesis wild type and saltant type, is inserted into glimmering In light element zymophore, above-mentioned plasmid is converted into Escherichia coli, shake bacterium, cultivate, select the culture of monoclonal bacterium, surveyed after extracting plasmid Sequence.The plasmid for building transfects NSCLC cells jointly with renilla luciferase plasmids, after corresponding group is processed, 48 Promega dual luciferase reporter gene detection kits are used after hour, is comprised the following steps that：Cell in 24 orifice plates is tried 100 microlitres of lysate in agent box scrapes cell, and room temperature is placed 15 minutes, is transferred in 1.5ml centrifuge tubes and is put into -80 refrigerators It is to be measured；Cell cracking supernatant 20ul is taken, plus 100ul contains the buffer solutions of LAR II of Firefly luciferase substrates, be vortexed concussion Mix, detected and readings thereon in luciferase, this value contains for Firefly uciferase activity values add 100ul The Stop buffer solutions of renilla luciferase substrates, the concussion that is vortexed is mixed, and in readings on luciferase detector, this value is Renilla uciferase activity values.Relative luciferase activity=Firefly uciferase activities value/renilla luciferases Activity value.

RNA pull down are tested

In vitro, LINC01116 transcripts are transcribed by t7 rna polymerase (Ambion Life), then using RNeasy Plus Mini kits (Qiagen) and DNase 1 (Qiagen) are processed.The RNA of purifying is combined using biotin labeling RNA (Ambion Life) carries out biotin labeling.The control of the positive, negative control and biotinylated rna split in A549 cells Mixing and hatching in solution liquid.Then, magnetic bead is added to each association reaction, and mixture is incubated at room temperature.Finally, magnetic is cleaned Pearl, has been screened protein and has been detected by immunoblotting assay.

Data processing

Experimental data all uses SPSS17.0 software analysis, is represented with the average value ± standard error of three experiments, group difference Checked with double tail Student ' s T, correlation analysis are analyzed with linear regression model (LRM), patient's NSCLC prognosis survival function point Analysis.P values are shown in figure, P<0.05, P<0.01 is significant difference, with statistical significance.

Brief description of the drawings

Fig. 1 bioinformatic analysis find the LINC01116 expression high of the conspicuousness in lung cancer

1A、1B：GEO (Gene Expression Omnibus) database analysis, LINC01116 conspicuousnesses in lung cancer Raise；

1C：Many data set on-line analysis platforms --- lncRNAtor, on-line analysis finds that LINC01116 shows in lung cancer Write and raise

Fig. 2 .LINC01116 expression in NSCLC tissues is substantially raised and related to patient's prognosis

2A：LINC01116 is in NSCLC tissues compared with the obvious up-regulated of normal structure；

2B-C：The pathological data analysis of NSCLC patient, the expression of LINC0116 and the TNM stage of patient and tumour Size be proportionate；

2D：Kaplan-Meier survival functions are analyzed, and the LINC01116 of height expression points out the poor prognosis of patient NSCLC

Fig. 3 histone H 3 K27 acetylations activate the up-regulated of LINC01116

3A：5 pairs of gland cancer and squamous carcinoma tissue are carried out with ChIP experiments to find：Compared with cancer beside organism, in cancerous tissue There is the enrichment of the H3K27 acetylations of more high abundance in the promoter region of LINC01116

Fig. 4 .LINC01116 regulating cell proliferation activities

4A：Compared with normal lung mucomembranous epithelial cell (16HBE), LINC01116 is expressed substantially in various NSCLC cells Raise

4B：LINC01116 and overexpression LINC01116, interference sequence si-LINC01116 1# are disturbed in NSCLC cells With si-LINC01116 2#, the Deletional experimental selection 1# of following functions and 2# interference sequences

4C：MTT experiment, striking low LINC01116 can significantly inhibit the proliferation activity of cell, energy after overexpression LINC01116 Enough promote the proliferation activity of cell；Colony formation, striking low LINC01116 can significantly inhibit the clonality of cell, Overexpression LINC01116 can be obviously promoted the clonality of cell

4D：BrdU is tested, and striking low LINC01116 can significantly inhibit the multiplication capacity of cell, energy after overexpression LINC01116 Enough promote the multiplication capacity of cell

Fig. 5 .LINC01116 cell cycle regulation apoptosis

5A：Strike low LINC01116 the energy significantly process of arresting cell cycle and G1-G0 phases, energy after overexpression LINC01116 Enough promote the process in the cycle of cell；

5B：Strike the apoptosis that A549 and NCI-H226 cells can be substantially induced after low LINC01116.

Fig. 6 are struck in low LINC01116 expression inhibitings NSCLC cytokines into knurl

6A：Compared with control group, the mouse tumor body Forming ability that shLINC01116 strikes low group substantially weakens；

6B：Knurl physical examination is surveyed, and shLINC01116 strikes the low group of average weight of the knurl body of mouse significantly lower than control group；

6C：The detection of knurl body SABC, the expression water of the Ki-67 in the knurl body tissue of shLINC01116 closed group mouse It is flat to be significantly lower than control group.

Fig. 7 .LINC01116 may be by influenceing the immune response of NSCLC cells so as to regulating cell is bred

7A：Transcript profile high-flux sequence has been carried out after low LINC01116 is struck in A549 cells；

7B：Gene ontology (GO) is analyzed, it is found that LINC01116 is not only involved in the biology mistake such as proliferation of lung cancer cells, apoptosis Journey, while finding its also main influence tumour cell immune response；

7C：After low and overexpression LINC01116 is struck in A549 and NCI-H226 cells, sequencing result is carried out by qPCR Checking, mainly chooses some with the related gene of propagation, apoptosis and immune response

Fig. 8 .LINC01116 can be as " molecular scaffold " while binding PRC2 and DNMT1 in nucleus

8A：Verified by RIP in A549 and NCI-H226 cells and find that LINC01116 and PRC2 has binding very high rich Degree；

Cell caryoplasm separating experiment, LINC01116 is distributed in nucleus and cytoplasm, relatively many in nucleus Point

8B：Bioinformatics website on-line prediction is a series of with related (including the histone methylated and DNA first that methylates Base) albumen and LINC01116 binding ability；

8C：RIP is it is experimentally confirmed that only DNMT1 can be combined with LINC01116

8D：RNA pull down experiment opposite directions confirm that LINC01116 can simultaneously bind EZH2 and DNMT1

Fig. 9 LINC01116 can simultaneously in histone methylated and DNA methylation level modulation gene expression

9A：After low EZH2 and DNMT1 expression is struck in A549 and NCI-H226, have detected and a series of adjusted by LINC01116 The expression of the target gene of control

9B：ChIP experiment confirmations to be struck and can weaken EZH2 and DNMT1 after low LINC01116 and influenceed base by EZH2/DNMT1 The binding abundance of the promoter region of a part of gene because in, and the tri-methylated enrichment abundance of H3K27

9C：BSP can reduce IRF7, the DNA first of CD1D, p57Kip2 promoter region it is experimentally confirmed that striking low LINC01116 Base degree

The expression of the apparent suppression CD1D and IRF7 of Figure 10 LINC01116, promotes the immunologic escape of NSCLC

10A：The isolated NKT cells from human peripheral

10B：Streaming antibody labeling is tested, and to strike that can substantially raise after low LINC01116/EZH2/DNMT1 CD1D positive The cell number of expression

10C-D：NSCLC and NKT co-culture of cells killing experiments are proved, after low LINC01116/EZH2/DNMT1 is struck, Killing ability of the NKT cells to NSCLC cells can be remarkably reinforced in vivo and in vitro

10E：The target gene base related to interferon type Ⅰ signal path of IRF7 after low LINC01116 is struck in GSEA analyses Because being enriched with

10F：The expression of IRF7, as a result finds that IRF7 expresses substantially downward in cancerous tissue in qPCR detection NSCLC tissues；

Correlation analysis show that LINC01116 expression expresses negatively correlated with IRF7；

The IRF7 of low expression points out the poor prognosis of patient, SABC to display that IRF7 low expressions

10G：Rescue experiment finds that overexpression LINC01116 can suppress the expression for being readily apparent that to suppress IRF7,

And this inhibitory action can be substantially reversed after cotransfection si-EZH2/si-DNMT1

10H：MTT experiment, the propagation that cell can be significantly inhibited after overexpression IRF7 in A549 and NCI-H226 is lived Power,

And overexpression IRF7 can substantially reverse the ability that LINC01116 promotees cell propagation

Figure 11 LINC01116 can influence the expression of Survivin and are proportionate with expression

11A：In A549 and NCI-H226, Western Blot detect the expression of Survivin albumen, strike low After LINC01116, Survivin is substantially lowered；After overexpression LINC01116, Survivin is substantially raised

11B：QPCR detects 100 pairs of NSCLC tissues, and Survivin expresses substantially rise in cancerous tissue；

Correlation analysis find that LINC01116 expression is proportionate with Survivin expression；

Height expression Survivin points out the poor prognosis of patient；

SABC displays that Survivin low expressions

Figure 12 LINC01116 pass through " absorption " miR-145-5p so as to promote the expression of Survivin in cytoplasm

12A：Luciferase reporting is tested, and discovery has no effect on Survivin promoter regions after striking low LINC01116 Activity

12B：In A549 and NCI-H226 cells, low LINC01116 is struck, the expression of miR-145-5p occurs on substantially Adjust；The expression of overexpression LINC0111, miR-145-5p is lowered；

After transfection miR-145-5p mimics overexpression miR-145-5p, the mRNA water of LINC01116 and Survivin Flat expression is all substantially lowered；And the protein level of Survivin is also substantially lowered after overexpression miR-145-5p

12C：Overexpression miR-145-5p can substantially suppress the fluorescence of the 3 ' UTR comprising LINC01116 and Survivin Plain enzymatic activity, overexpression miR-145-5p can not influence the 3 ' UTR of the LINC01116 comprising mutation and the Survivin of mutation Uciferase activity

12D：Striking low LINC01116 can directly suppress the uciferase activity of 3 ' UTR of Survivin

Figure 13 LINC01116 promote the expression of Survivin, suppress NSCLC Apoptosis, so as to promote NSCLC cells Existence

13A：Rescue experiment, after cotransfection overexpression LINC01116 and miR-145-5p, miR-145-5p can be substantially inverse Turn expression facilitations of the LINC01116 for Survivin

13B：MTT experiment, striking low Survivin and overexpression miR-145-5p can substantially suppress the propagation work of A549 Power, and cotransfection finds that striking low Survivin can substantially reverse the propagation of LINC01116 to promote ability

13C：Flow cytometer showed, striking low Survivin can be obviously promoted A549 Apoptosis；

Strike after low Survivin that overexpression LINC01116 can substantially reverse the apoptosis for striking low Survivin to promote simultaneously Effect

Figure 14 hypothesized models：A tumor immune escape can be formed by different methods by what LINC01116 was mediated Phenotype, so as to promote NSCLC cells survivals

Specific embodiment

The invention will be further elaborated by the following examples, but does not limit the present invention.

General explanation：

The experimental technique of the dated actual conditions in end in embodiment, is substantially all according to Sambrook, what J et al. write 《Molecular Cloning:A Laboratory guide (the 3rd edition)》(MolecularCloning：ALaboratoryManual, 3rded. Huang Peitang etc. Translate, Science Press .2002.8) described in condition and method or enter according to the condition and method proposed by material supplier OK, the technology that other are not described in is well known standard method for corresponding to those skilled in the art.

Material of the invention：Cell line, slow virus interference carrier and the culture medium referred in the application have commodity to supply Should or with other approach can for the public gained, they are only for example, be not to the present invention it is unique, can be suitable with other respectively Instrument and biomaterial replace.

Interference sequence is as follows：

SEQ ID NO:6

si-LINC01116 1# CCGCUCAGUUCAAUAUUUCAAGUGA

UCACUUGAAAUAUUGAACUGAGCGG

SEQ ID NO:7

si-LINC01116 2# AGAAGACAACUGAAUUGCUUCUAAG

CUUAGAAGCAAUUCAGUUGUCUUCU

SEQ ID NO:8

si-EZH2 GAGGUUCAGACGAGCUGAUUU

AAAUCAGCUCGUCUGAACCUC

SEQ ID NO:9

si-DNMT1 GGAAGAAGAGUUACUAUAAUUU

AAAUUAUAGUAACUCUUCUUCC

SEQ ID NO:10

shLINC01116

CACCGCCGCTCAGTTCAATATTTCAAGTGATTCAAGAGATCACTTGAAATATTGAACTGAGCGGTTTTT TG

SEQ ID NO:11

shEZH2

CACCGAGGTTCAGACGAGCTGATTTCAAGAGAATCAGCTCGTCTGAACCTCTTTTTTG

SEQ ID NO:12

shSUZ12

CACCGGAAGAAGAGTTACTATAATTTCAAGAGAATTATAGTAACTCTTCTTCCTTTTTTG

Embodiment 1 detects expressions of the LINC01116 in tissue and cell

Take 0.1g tissues, liquid nitrogen grinding fully (powdered) or 1-5 × 10⁷Cell abandons culture medium, the PBS rinses of precooling 2 times.The Trizol lysates of 1ml are added, is mixed with being blown and beaten without enzyme pipette tips, stand 5min, lysate moved into and is marked in advance The centrifuge tube without enzyme 1.5ml in.4 DEG C of 7500g are centrifuged 5 minutes, take the chloroform that supernatant adds 1/5 volume, overturn and mix 30s, Stand 2min.4 DEG C, 12000g centrifugations, 15min.Solution point three layers (water phase-white precipitate-red organic matter), shifts aqueous layer Into new 1.5ml centrifuge tubes, try not to be drawn onto white precipitate.Isometric isopropanol is added, is gently overturned and is mixed, place 5- 10min.4 DEG C, 12000g centrifugations, 10min.Supernatant is abandoned in suction, adds the ethanol (now with) of 1ml 75%, washs RNA precipitate.4 DEG C, 7500g is centrifuged, and 5min abandons supernatant.The alcohol of removal 75%, dries, about 15min in room temperature as far as possible.With without RNase water (20- 25 μ l) dissolving RNA precipitate.

Determination of uv absorption method determines the concentration of RNA.RNA concentration and purity, measurement are determined using ultraviolet specrophotometer It is preceding first to be returned to zero with the DEPC water of dissolving RNA.Readings 1 is expression 40ng/ μ l at 260nm, the A260/A280's of RNA solution Ratio is used for the detection of RNA purity, and ratio range shows to meet the requirements 1.8 to 2.1.Agarose gel electrophoresis identification RNA's Integrality.Prepare 1% agarose gel.Heating for dissolving agarose, cooling adds 1 μ l ethidium bromides (EB, 10mg/ml).Shake up Fall glue afterwards, after after glue condensation, be placed in electrophoresis tank, be dipped in 1 × TAE buffer solutions and balance 10min, it is stand-by.Point sample.By 1：4(v/ V) 5 × nucleic acid electrophoresis sample-loading buffer is mixed with sample, accurately by each sample contain 1 μ g RNA add gel pore in.80V Constant pressure electrophoresis 50min.After electrophoresis terminates, result is observed in gel imaging instrument.

Tris- acetic acid (TAE) buffer formulation (1L) 50 ×：

Real-time quantitative PCR

NSCLC is organized and cancer beside organism's sample, the total serum IgE of NSCLC cells, reverse transcription reaction application TaKaRa PrimeScript kits (Dalian treasured bioengineering Co., Ltd).Reverse transcription reaction system is as follows：

Reverse transcription reaction condition is as follows：37 DEG C of 15min (reverse transcription reaction)；(inactivation of reverse transcriptase is anti-for 85 DEG C of 5sec Should).According to the gene order that Genebank is provided, primer sequence is designed,

QPCR application 7300PCR systems (Applied Biosystems, Warrington, UK).CDNA samples use three Portion's method PCR amplification standardization programs.Reaction system：

Reaction condition：

Interpretation of result：The specificity and amplification efficiency of analysis primer, the atopic of primer is judged according to solubility curve. Ct values are obtained according to amplification curve, the analysis of genes of interest relative expression quantity is carried out using relative measurement and internal reference GAPDH.Calculate Formula is：2^{^(-△Ct)}, △ Ct=Ct gene-Ct control.

The primer of LINC01116 is as follows：

Primer F(SEQ ID NO：2)：

5 '-AACGCTTTTGAATATGGGGAC-3 ',

Primer R(SEQ ID NO：3)：

5’-CAATCACAGAGCTCTCCTTGC-3’。

Result shows that LINC01116 raises (Fig. 1) in NSCLC tissue expressions compared with normal structure.We utilize real-time quantitative Round pcr have detected the expression of LINC01116 in 190 pairs of NSCLC tissues/cancer beside organisms.Result shows and cancer beside organism Compare, the expression tissue of LINC01116 is substantially lowered (Fig. 2A) in 90.5% (172/190) NSCLC tissues.

The LINC01116 of the up-regulated of embodiment 2 has significantly correlated with NSCLC patient's poor prognosis

Further the expression of LINC01116 and the disease of patient are analyzed by 190 pathological datas of patient NSCLC Correlation between reason feature, as a result shows the expression of LINC01116 with the size of the TNM stage of patient and tumour in just Related (Fig. 2 B and 2C).But sex, age, smoking history, pathological of the expression of LINC01116 and patient NSCLC etc. Non-correlation (table 1).

In order to further analyze LINC01116 expression and patient's NSCLC prognosis between relation, we according to 190 patients are divided into two groups by LINC01116 expression according to median, LINC01116 expression groups (n=95) high and low expression group (n=95).The LINC01116 expressions that Kaplan-Meier survival functions are used to analyze two groups of patients are pre- with patient NSCLC Correlation afterwards.The LINC01116 of result display expression high points out the poor prognosis (Fig. 2 D) of patient NSCLC.Single factor analysis Result shows Pathological degree, the expression of TNM stage and LINC01116 can as the prognostic indicator of patient NSCLC, and its His factor such as sex, age etc. are not statistically significant.And multivariate liner regress analysis find LINC01116 expressions, pathology level Other and TNM stage can serve as the prognostic indicator (table 2) of NSCLC independences.

Table 1:The clinic-pathological factors of 190NSCLC patients

*chi-square test

* p ＜ 0.05

* p ＜ 0.01

Table2

Univariate and multivariate analysis of clinic pathologic factors for overall survival in 190 patients with NSCLC

* HR hazard ratio

* p ＜ 0.01

The histone H 3 K27 acetylations of embodiment 3 activate the up-regulated of LINC01116

In order to explore the regulatory mechanism of the expression high of LINC01116, first, we are by using UCSC (Genome Bioinformatics Site)(http：//genome.ucsc.edu/) hair is analyzed to the promoter region of LINC01116 In present tumour cell there is the H3K27 acetylations enrichment of high abundance in its promoter region.Because it is presumed that in NSCLC H3K27 acetylations may have activated the expression of LINC01116.Discovery is tested by carrying out ChIP to 5 pairs of gland cancer and squamous carcinoma tissue： Compared with cancer beside organism, in cancerous tissue there is the enrichment of the H3K27 acetylations of more high abundance in the promoter region of LINC01116 (Fig. 3 A).Therefore, histone H 3 K27 acetylations activate the up-regulated of LINC01116.

The LINC01116 regulating cell proliferation activities of embodiment 4

In order to study biological functions of the LINC01116 in NSCLC cells, we have detected it in various cells first Expression in system.Result finds that LINC01116 is in various NSCLC cells compared with normal lung mucomembranous epithelial cell (16HBE) Expression substantially raises (Fig. 4 A).We have selected relative expression's one plant of adenocarcinoma cell A549 and one plant of squamous cell carcinoma strain of strain higher NCI-H226, transfects the interference sequence and eukaryon expression plasmid of LINC01116 in two plants of cells, and qPCR results show, and right Photograph ratio, after transfection LINC01116 interference sequences, the expression of LINC01116 is substantially lowered, after transfection eukaryon expression plasmid, The expression of LINC01116 is significantly raised (Fig. 4 B) in A549 and NCI-H226 cells.Further MTT experiment testing result shows, Low LINC01116 is struck in A549 and NCI-H226 cells can significantly inhibit the proliferation activity of cell, energy after overexpression LINC01116 Enough promote the proliferation activity of cell；Cloning experimentation result shows that A549 and NCI-H226 strike low LINC01116 and can significantly inhibit carefully The clonality of born of the same parents, overexpression LINC01116 can be obviously promoted the clonality (Fig. 4 C) of cell.BrdU experiment hairs Striking low LINC01116 in existing A549 and NCI-H226 cells can significantly inhibit the multiplication capacity of cell, after overexpression LINC01116 The multiplication capacity (Fig. 4 D) of cell can be promoted.

The LINC01116 cell cycle regulation apoptosis of embodiment 5

The cell that will be transfected is inoculated in 6 orifice plate culture plates by the certain cell in every hole, after after cell attachment, cells Synchronous After changing culture 12h, original culture medium is discarded, give respective handling special time.With the trypsin digestion cell without EDTA, centrifugation Cell is collected, PBS rinses cell 2 times.With 75% ethanol re-suspended cell of precooling, and in -20 DEG C of fixations overnight.Centrifugation is discarded Clear liquid, PBS washes cell 2 times.Each sample takes 450 μ l PBS re-suspended cells, adds propidium iodide (PI, the 0.5mg/ of 50 μ L Ml), 37 DEG C of water bath 30min are placed in after mixing.Centrifugation abandoning supernatant, PBS re-suspended cells, flow cytometer (BD companies, Model：FACS Calibur) measure cell cycle distribution and analysis result.

The cell that will be transfected is inoculated in 6 orifice plate culture plates by the certain cell in every hole, original after after cell attachment, discarding Culture medium, gives different disposal the corresponding time.With the trypsin digestion cell without EDTA, 4 DEG C, 1500rpm centrifugations 5min.Abandon Clear liquid, adds the PBS of precooling to wash 2 times.It is careful to exhaust PBS, the vortex oscillation 30s remained in cell precipitation, make cell into uniform Suspension.The combination buffer of 200 μ l calcium ions is added, 10 μ l Annexin V-FITC fluorescence probes are added, gently shaken Mixing is swung, lucifuge is incubated 30min on ice.The propidium iodide (PI) of 5 μ l is added in cell liquid, vortex oscillation is mixed, and is kept away on ice Light is incubated 5min.After adding 400 μ l combination buffers, vortex oscillation to mix, with 300 mesh nylon net filters, flow cytometer Detect and analyze using FL1 and FL3 double channel wavelengths.

We want to further determine that LINC01116 regulating cells propagation whether by have impact on cycle of NSCLC cells And apoptosis capacity.Flow cytometry finds that low LINC01116 is struck in A549 and NCI-H226 cells can significantly be blocked carefully The process in born of the same parents' cycle and G1-G0 phases, the process (Fig. 5 A) in the cycle of cell can be promoted after overexpression LINC01116.Apoptosis point Analysis finds substantially induce the apoptosis (Fig. 5 B) of A549 and NCI-H226 cells after striking low LINC01116.

Embodiment 6 is struck in low LINC01116 expression inhibitings NSCLC cytokines into knurl

4 week old male nude mouse BALB/c mouses, purchased from Nanjing University's model animal center；Culture A549 cells, respectively The small interference plasmid sh-LINC01116 or empty carrier of LINC01116；48 hours after cell transfecting, pancreatin digestion, PBS washes two Time, it is resuspended in serum free medium, and count.2 groups of cells take 1 × 107 cell and are suspended in 0.1ml serum-frees In DMEM culture mediums, tail vein injection sets up experimental lung into knurl model.Injection cell puts to death nude mice after 20 days, takes lung tissue Sample, observes macroscopic tumorous size, and take pictures.Above all of experimental arrangement is all according to the dynamic of NIH1996 versions Thing experiment instruction is performed.With full-valence pellet feed feed mouse, free water, room temperature (22 ± 2) DEG C, humidity 50~ 60%, well-ventilated, 12:12h illumination/dark cycle.All experiments are entrusted by Nanjing Medical University's animal protection and ethics Member's meeting (IACUC) approval.

4% paraformaldehyde is soaked in after the PBS flushings for taking mouse lung tissue precooling fix more than 16h；Tissue aquation：From Sample is taken out in formaldehyde, is placed in special casher box, and continue slight shower 2h with running water；Tissue dewatering：Soaked in 30% alcohol Bubble 5min；10min is soaked in 50% alcohol；20min is soaked in 70% alcohol；30min is soaked in 80% alcohol；In 90% alcohol Immersion 30min；30min is soaked in 95% alcohol I；30min is soaked in 95% alcohol II；10- is soaked in 100% alcohol I 20min；20-40min is soaked in 100% alcohol II；(the specific time is different with tissue block period and size, embryonic tissue and small The tissue block time is short).Transparency of organization：Alcohol/dimethylbenzene 1:In 1, soak 30 minutes；20-30min is soaked in dimethylbenzene I；Two 20-30min is soaked in toluene II；Paraffin/dimethylbenzene 1:30min is soaked in 1；60min is soaked in paraffin 1；Soaked in paraffin 2 60min；30min is soaked in paraffin 3.FFPE：Mould is placed on clean glass plate on demand, thawing is poured into complete Paraffin liquid, tissue block, tweezer goes out from paraffin 3 at once, immersion module in, treat that wax is parched after 14h at room temperature.

Treatment slide, slide acid cylinder soaked overnight, detergent, deionized water are cleaned successively, and frame is in drying on brandreth Dry in the air cool stand-by preparation gelatin treatment fluid：0.75%gelatine (gelatin), 0.005%chrome ablum (potassium chromium sulfate) are by frame 1min is soaked in the solution in pending slide on brandreth, slide is put into 37 DEG C of incubators, overnight.Melt wax with special flatiron copper sheet Wax liquor simultaneously, and is dropped in the dipped special wooden unit surface of wax by block, rapidly sticks on wooden unit wax stone, and wooden unit is fixed on into paraffin Serial section (5 μm of serial section, for adjacent section Immunohistochemical detection on slicer；5 μm of sections, it is glimmering for being immunized Light histochemistry is detected)；The section for taking needs is glued with the writing brush that gets wet, the Stainless steel basin of clear water is filled along the immersion of its convolution direction In, wax disk(-sc) is that nature is unfolded, and is then immersed in the water the slide that gelatin is treated, and makes open wax disk(-sc) part paste naturally On, help gently be brushed at just section convolution with writing brush and open, careful is laid on slide；By slide to being preheated in advance Soaked (can not be long, wax disk(-sc) can be changed) in exhibition piece machine hot water (50 DEG C or so), wax disk(-sc) is that nature is fully unfolded and is laid on slide；Will Slide is put in the roasting piece machines of 46 DEG C or so (no more than 50 DEG C) overnight.Next day collects slide.

Dimethylbenzene dewaxes, gradient alcohol dehydration；Dimethylbenzene 5min → diformazan 5min → 100% ethanol 2min → 95% ethanol 2min → 90% ethanol 2min → 85% ethanol 2min → 80% ethanol 2min → 70% ethanol 2min → 50% ethanol 2min → 30% ethanol 2min → brazilwood extract dyeing 5min → ddH2O rinses 5min → weak ammonia liquor 5s → ddH2O 2min → 30% ethanol 2min → 50% ethanol 2min → 70% ethanol 2min → 80% ethanol 2min → 85% ethanol 2min → 85% ethanol 30min → 90% ethanol 2min → 95% ethanol, eosin stains 10min → 95% ethanol 2min → 100% ethanol 2min → 100% ethanol 2min → dimethylbenzene 5min- dimethylbenzene 5min.Neutral gum mounting, dries, you can basis of microscopic observation histo pathological change feelings Condition

In order to further verify influences of the LINC01116 to NSCLC cytoma body Forming abilities, we construct first The small interference plasmid sh-LINC01116 of LINC01116, has then screened stable cell strain, hypodermic injection by the method for G418 The big male BALB/c nude mices of 4 week old, after 4 days posterior tuberosity bodies are formed, the knurl body for recording once the mouse of different groups for every 2 days is big Small, knurl body puts to death mouse after being formed 16 days, takes knurl body, Taking Pictures recording and measures the size of knurl body, and claims its weight to count two groups Difference.Statistical result showed, compared with control group, the mouse tumor body Forming ability that LINC01116 strikes low group substantially weakens (figure 6A)；Knurl body testing result shows that LINC01116 strikes the low group of average weight of the knurl body of mouse significantly lower than control group (figure simultaneously 6B).Knurl body is carried out the table of the Ki-67 in the knurl body tissue of SABC testing result display LINC01116 closed group mouse Up to level significantly lower than the expression (Fig. 6 C) in control group mice tissue.

The LINC01116 of embodiment 7 may be by influenceing the immune response of NSCLC cells so as to regulating cell is bred

Transcript profile sequencing experiment

After low LINC01116 48h are struck in A549 cells, added in control group and interference group cell respectively 500ulTrizol, places 10min；100 μ L chloroforms, strenuous vibration 15s are added to be stored at room temperature 5min, 4 DEG C, 12,000g centrifugations 10min, supernatant is transferred in a new 1.5ml centrifuge tubes；(being vortexed without oscillator, hold and firmly shake).The bodies such as addition Long-pending chloroform, strenuous vibration 15s is stored at room temperature 5min, 4 DEG C, 12,000g centrifugation 10min, supernatant is transferred into one new In 1.5mL centrifuge tubes；(being vortexed without oscillator, hold and firmly shake).Isometric isopropanol is added, is gently overturned and is mixed ,- 20 DEG C of placements more than 30min, 4 DEG C, 12,000g centrifugation 20min, reject supernatant.75% ethanol of 1ml precoolings is added, will be precipitated Upspring, washing precipitation, 4 DEG C, 12,000g centrifugation 5min, reject supernatant.Repetition previous step (75% ethanol of 1mL precoolings is added, Precipitation is upspring, washing precipitation, 4 DEG C, 12000g centrifugation 5min, reject supernatant).Micro- centrifugation, absorbs remaining ethanol, and room temperature is done Dry 10min.30-50 μ l RNase-Free water is added, RNA, -80 DEG C of preservations is dissolved.

The quality inspection of RNA：

The machines of Agilent 2200 are opened, software is opened；Load corresponding R6K Agilent ScreenTape, volley of rifle fire dress Enter 16 Loading pipette tips；8 unions are taken out, 4 μ L R6K Sample Buffer and 1 μ LRNA samples are separately added into order Product；It is collected by centrifugation mixed liquor after mixing, 72 DEG C of 3min, on ice 2min；Tube wall solution is collected by centrifugation, Agilent is then placed in In 2200 sample panels；Click on Start and start quality inspection.

Library construction：

Transcript profile RNA fragmentations：The acquisition of poly (A) RNA；RNA fragmentations；Fragment RNA purifying builds library：RNA adds Joint；Reverse transcription；CDNA is purified；CDNA is expanded；Amplified production is purified.Library quality inspection：The machines of Agilent 2200 are opened, is opened Software；Load corresponding D6K Agilent ScreenTape, the volley of rifle fire loads 16 Loading pipette tips；8 connecting legs are taken out, 3 μ LD1K Ladder are added in the first pipe, 3 μ LD1K Sample Buffer and 1 μ L are separately added into remaining pipe CDNA samples, are vortexed and mix 5s；Tube wall solution is collected by centrifugation, is then placed in the sample panels of Agilent 2200；Start is clicked on to open Prothyl is examined.

Sequencing template prepares：

The dilution in library；Emulsion droplet PCR；The cleaning of pearl；The enrichment of positive pearl

Upper machine sequencing：

Cleaning sequenator；Sequenator is initialized；Chip loading.

In order to further inquire into the molecular mechanism that LINC01116 promotes lung cancer malignant progression, we are first in A549 cells In strike low LINC01116 after carried out transcript profile high-flux sequence (Fig. 7 A).The mRNA that result finds differences more than twice has 942 genes, gene ontology (GO) analysis is carried out to sequencing result, it is found that LINC01116 is not only involved in proliferation of lung cancer cells, withers The biological process such as die, while its also main influence tumour cell immune response (Fig. 7 B) is had been surprisingly found that, including interferon type Ⅰ is situated between The signal path led, Immune discrimination, antigen such as offers at the process.Here the base closely related with interferon signal path is included Cause, including IRF7, IRF9, IFI6, IFI16, IFI44, IFIT1, IFIH1, OAS1, RIG-1, ISG15, MX1, MX2 and GBP1 Deng.Unique target spot that CD1D, NKT cell recognition are killed, is also induced.Proliferative index Survivin, PCNA are suppressed.Then exist After low and overexpression LINC01116 is struck in A549 and NCI-H226 cell lines, sequencing result is carried out by real-time quantitative PCR Checking, mainly chooses some with propagation, apoptosis and the related gene (Fig. 7 C and 7D) of immune response.

The LINC01116 of embodiment 8 can be as " molecular scaffold " while binding PRC2 and DNMT1 in nucleus

Regulate and control the molecular mechanism of proliferation of lung cancer cells and immune response for further investigated LINC01116, we retrieve first Document finds：LINC01116, is also designated as LINC-MTX2, and length is 1058nt, is reported by Khalil et al. first.They The LncRNAs that about ≈ 20% is identified in various kinds of cell system by RIP-Chip technologies can bind PRC2 albumen and be combined Body, including LINC01116.But the functional role for LINC01116 there is no research to report.PRC2 is a kind of important The apparent suppression compound of regulating and controlling effect, key component includes EZH2 (Enhancer of zeste homolog 2), SUZ12 (homolog of Suppressor of zeste 12) etc., main mechanism is turning by histone methylated suppression target gene Record.EZH2 is the core catalytic subunit of PRC2, and during target gene silence is made, EZH2 master is by mediating target gene promoters 27 sites of area H3 istone lysines are tri-methylated (H3K27me3).And overexpressions of the EZH2 in tumour take part in it is many Tumour is planted to develop.Khalil et al. verifies that can its LINC01116 with people normal foot fibroblast by RIP PRC2 is combined, and is as a result but negative.Next we are verified by RIP in A549 and NCI-H226 cells and found LINC01116 and PRC2 has binding abundance (Fig. 8 A) very high.Further cell caryoplasm separating experiment finds LINC01116 thin It is distributed in karyon and cytoplasm, relatively multiple spot (Fig. 8 A) in nucleus.And the research of the past shows histone methylated Can be synergy inhibition of gene expression with DNA methylation.And recently research have indicated that lncRNAs can be as " molecule Scaffold " is while binding multiple protein moleculars and playing adjusting function.Based on this, it will be assumed that LINC01116 is likely to conduct The multiple protein mediated regulation and control for methylating of " molecular scaffold " binding.To verify this it is assumed that we pass through biological information first Learn website on-line prediction it is a series of with methylate related (including histone methylated and DNA methylation) albumen with The binding ability of LINC01116, mainly including WDR5 (H3K4me3), LSD1 (H3K4me3), SETDB1 (H3K9me3), SUV39H1 (H3K9me3), DNMT1, DNMT3a, and DNMT3b (http://pridb.gdcb.iastate.edu/ RPISeq/references.php).Result shows that LINC01116 may be combined (figure with this several Modification methylases 8B).Then tested by RIP and confirm that can a series of this albumen combine with LINC01116, as a result shown, only DNMT1 energy It is enough to be combined with LINC01116 (Fig. 8 C).Then further testing opposite direction by RNA pull down confirms LINC01116 energy It is enough to bind EZH2 and DNMT1 (Fig. 8 D) simultaneously.In order to further study the particular sequence that LINC01116 and EZH2, DNMT1 are combined Region, is tested by a series of deletion mappings, and in-vitro transcription technology obtains the RNA fragments of the LINC01116 of different zones (200nt is one section), then carries out RNA pull down experiments, and the nucleotide fragments of the 1-200nt of LINC01116 can be tied up Determine EZH2, and the region of 800-1058nt is the effective coverage (Fig. 8 E) for binding DNMT1.EZH2 and DNMT1 are on LINC01116 There are different binding region sequences and show that LINC01116 can come while binding EZH2 and DNMT1 as one " molecule bridge ". By the Co-IP of albumen it is experimentally confirmed that EZH2 can be with DNMT1 directly in conjunction with and strike can be obvious after low LINC01116 Weaken this binding relationship (Fig. 8 F).The above experiment confirms that LINC01116 can be used as " molecule pin hand in nucleus Frame " is while bind PRC2 and DNMT1.

The LINC01116 of embodiment 9 can simultaneously in histone methylated and DNA methylation level modulation gene expression

Then, in order to detect LINC01116 whether with EZH2, DNMT1 to target gene have altogether regulation and control effect, Wo Men After low EZH2 and DNMT1 expression is struck in A549 and NCI-H226, a series of table of target genes regulated and controled by LINC01116 is have detected Reach.Result finds most gene, can be induced to express (Fig. 9 A).And found by consulting literatures, these genes exist The many supermethylations all with its promoter region of low expression in tumour are relevant.Confirmation is further tested by ChIP and strikes low The promoter region of a part of gene of EZH2 and DNMT1 in gene is influenceed by EZH2/DNMT1 can be weakened after LINC01116 Binding abundance, and the tri-methylated enrichment abundance of H3K27 (Fig. 9 B).And by BSP test confirmation strike low LINC01116 can Reduction IRF7, the DNA methylation degree of CD1D, p57Kip2 promoter region, these three gene promoter areas all exist substantial amounts of CpG islands (Fig. 9 C).

Conclusion

In sum, in nucleus, LINCO1116 avoids NKT thin by the expression of apparent suppression IRF7 and CD1D The identification and killing of born of the same parents, so as to promote cell to breed.In cytoplasm, LINC01116 is promoted by " absorption " miR-145-5p Enter the expression of Survivin, cause NSCLC apoptosis to resist and promote cells survival (Figure 14).Therefore, LINC01116 is by reducing The immunogenicity of lung carcinoma cell, partial interpretation lung carcinoma cell forms the hypotype of immunologic escape, be likely to become NSCLC diagnosis and Therapy target, for clinic provides foundation.

SEQUENCE LISTING

<110>Nanjing Medical University

<120>A kind of long non-coding RNA and its application in diagnosis/treatment non-small cell lung cancer

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 1058

<212> DNA

<213>Artificial sequence

<400> 1

caggaaatga cccgaactgc cagcctgcgc ctttgcagcc ggccctcgct ttgctgaaga 60

cgagcagctc ccaccaaagt cttgcctccc cttaccccga aagccccgct cagttcaata 120

tttcaagtga aaatctgcct gttcgaaaag aaaatattca caaatgagca gtgtattaga 180

agacaactga attgcttcta agaatgggtc tcactctgcc atcacccagg ctggagtgtg 240

gtggcaccat catggctcac tgcagccttg aactcctgag ctcaagtcat cctcccacct 300

cagccttccg agtagctgga actgcaggtg tgagccacca tgcctggctg atttgtcttt 360

ttaaattttt tatagagacc gagtctcaac tatattgtcc aggctggaaa agaacttctt 420

tccctccaag tgataacctt ttccagacaa gtcagcttaa aaactgaccc aaaggccctg 480

aagtacacag ttttcttgga gaaagaaaaa aataagtgaa aaggacttgc tgacttgcta 540

attcattttg gggcctgtgg gtaacatcag aatggcaaag cacttggggc ttttttctaa 600

tttgtatttt tttaatcttc tgagaaatga cttttatatg ccaagattca ttccatgatt 660

agtttttatg accaagttat gaacgctttt gaatatgggg acctagaata gaaatgctaa 720

cctacctgca aggagagctc tgtgattggc atccccatca tgctgtaact gacacaaaat 780

aaacttaggg taattgccgc atagtgtaac tttaatgtgt gagcatactg taacatctga 840

caagcttctt gatctagatc agcaatgtgt aacccattca ttgttgtcac tctcaacaag 900

gccttatggt caaacatcat cactctcact aaagagatag tttactgaaa tatactgaga 960

ttttgaaact ggagtcaaga ggtagcacac tgttttatgt tgatccattt aatggtcctt 1020

gacagccaat aaaaagacac tggaagaata cgtgaatg 1058

<210> 2

<211> 21

<212> DNA

<213>Artificial sequence

<400> 2

aacgcttttg aatatgggga c 21

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<400> 3

caatcacaga gctctccttg c 21

<210> 4

<211> 19

<212> DNA

<213>Artificial sequence

<400> 4

agccacatcg ctcagacac 19

<210> 5

<211> 19

<212> DNA

<213>Artificial sequence

<400> 5

gcccaatacg accaaatcc 19

<210> 6

<211> 50

<212> RNA

<213>Artificial sequence

<400> 6

ccgcucaguu caauauuuca agugaucacu ugaaauauug aacugagcgg 50

<210> 7

<211> 50

<212> RNA

<213>Artificial sequence

<400> 7

agaagacaac ugaauugcuu cuaagcuuag aagcaauuca guugucuucu 50

<210> 8

<211> 42

<212> RNA

<213>Artificial sequence

<400> 8

gagguucaga cgagcugauu uaaaucagcu cgucugaacc uc 42

<210> 9

<211> 44

<212> RNA

<213>Artificial sequence

<400> 9

ggaagaagag uuacuauaau uuaaauuaua guaacucuuc uucc 44

<210> 10

<211> 71

<212> DNA

<213>Artificial sequence

<400> 10

caccgccgct cagttcaata tttcaagtga ttcaagagat cacttgaaat attgaactga 60

gcggtttttt g 71

<210> 11

<211> 58

<212> DNA

<213>Artificial sequence

<400> 11

caccgaggtt cagacgagct gatttcaaga gaatcagctc gtctgaacct cttttttg 58

<210> 12

<211> 60

<212> DNA

<213>Artificial sequence

<400> 12

caccggaaga agagttacta taatttcaag agaattatag taactcttct tccttttttg 60

Claims

1. a kind of for judging non-small cell lung cancer (NSCLC) prognosis situation or non-as the length of Treatment for Non-small Cell Lung target spot Coding RNA (LINC01116) is characterized in that, the nucleotide sequence of the long non-coding RNA is as shown in Seq ID NO.1.

2. identification claim 1 described in long non-coding RNA label in diagnosing non-small cell lung cancer, judge non-small cell lung Application in cancer treatment prognosis situation, described label is included but is not limited to：

(1) primer of long non-coding RNA described in the combination of the primer/primer sets or fluorescence labeling that combine the long non-coding RNA/ Primer sets；

(2) micromolecular compound of the long non-coding RNA is combined；

(3) large biological molecule of the long non-coding RNA is combined, described large biological molecule includes but is not limited to：Antibody is anti- Body function fragment, the antibody of fluorescence labeling or antibody functional fragment, rna binding protein or its function fragment, the RNA of fluorescence labeling Associated proteins or its function fragment.

3. the label of the long non-coding RNA described in identification claim 1 is preparing diagnosing non-small cell lung cancer and is judging non-small Application in the diagnostic products of cell lung cancer treatment prognosis situation, described label is included but is not limited to：

(2) micromolecular compound of the long non-coding RNA is combined；

4. the application according to Claims 2 or 3, it is characterised in that described primer sets or the primer sets of fluorescence labeling Nucleotide sequence is as shown in SEQ ID NO.2 and SEQ ID NO.3.

5. comprising the label described in Claims 2 or 3 is for diagnosing non-small cell lung cancer and judges that non-small cell lung cancer is controlled Treat the reagent or kit of prognosis situation.

6. the long non-coding RNA described in claim 1 as Screening Diagnosis non-small cell lung cancer and is judging non-small cell lung cancer Application in the diagnostic reagent of prognosis situation.

7. application of the long non-coding RNA described in claim 1 in the medicine of screening treatment non-small cell lung cancer.

8. application of the inhibitor of the long non-coding RNA described in claim 1 in the medicine for preparing treatment non-small cell lung cancer, The inhibitor is included but is not limited to：

(1) siRNA, shRNA or functionally similar interference tiny RNA of the long non-coding RNA are suppressed；

(2) micromolecular compound of the long non-coding RNA is suppressed；

(3) large biological molecule of the long non-coding RNA is suppressed, described large biological molecule includes but is not limited to：Antibody is anti- Body function fragment, the enzyme of Substratspezifitaet high or its function fragment.

9. the inhibitor described in claim 8, it is characterised in that be a kind of siRNA.

10. the inhibitor in claim 8 or 9, it is characterised in that sequence such as SEQ ID NO:8 or SEQ ID NO:Shown in 9.