CN105969846B - A kind of long non-coding RNA and its application in diagnosis/treatment non-small cell lung cancer - Google Patents
A kind of long non-coding RNA and its application in diagnosis/treatment non-small cell lung cancer Download PDFInfo
- Publication number
- CN105969846B CN105969846B CN201610299374.7A CN201610299374A CN105969846B CN 105969846 B CN105969846 B CN 105969846B CN 201610299374 A CN201610299374 A CN 201610299374A CN 105969846 B CN105969846 B CN 105969846B
- Authority
- CN
- China
- Prior art keywords
- agap2
- cell
- lung cancer
- coding rna
- cell lung
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Pathology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Hospice & Palliative Care (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of long non-coding RNA and its applications in diagnosis/treatment non-small cell lung cancer, and the nucleotide sequence of the long non-coding RNA is as shown in SEQ ID NO.1.The expression quantity of the long non-coding RNA can preferably react the prognosis situation of NSCLC, meanwhile, targetedly the silencing gene is able to suppress the development of NSCLC.
Description
Technical field
The invention belongs to genetic engineering field, in particular to a kind of long non-coding RNA and its in diagnosis/treatment non-small cell
Application in lung cancer.
Background technique
The main reason for lung cancer is one of most common malignant tumour in the whole world, is malignant tumour associated death, nearly 80%
Lung cancer is non-small cell lung cancer (NSCLC), and non-small cell lung cancer includes Various Tissues hypotype such as gland cancer, squamous cell carcinoma
(SCC) and large cell carcinoma (LCC).Although current surgical intervention, Treatment of non-small-cell lung cancer with chemotherapy and molecular targeted therapy obtain
Significant progress, but the overall 5 years survival rates of patient still are below 15%.With the quick hair of sequencing technologies and oncobiology
Exhibition, gene diagnosis and molecular targeted therapy become a hot issue in Treatment for Non-small Cell Lung.Therefore, research participates in non-small
The molecular mechanism of occurrence and development and the transfer of cell lung cancer is extremely closed to specific diagnostic method and personalized therapeutic strategy is formulated
It is important.
In past ten years, gene expression analysis technology and bioinformatics based on the high-flux sequence quickly occurred
The research of large-scale human activities environment has been pushed, and then has had found non-coding RNAs.There was only 2% volume in human genome
Code is transcribed into albumen, and the overwhelming majority is transcribed into non-coding RNAs, including small molecule RNA, long non-coding RNA
(lncRNAs) and pseudogene.Recently, miRNA has been confirmed in the effect of the various aspects of cellular processes, however,
The functional study of lncRNAs is not very thorough.ENCODE in the works GENECODE study group new data show it is thousands of
LncRNAs, but only some of which has biological function.It is interesting that these lncRNAs participate in adjusting by chromatin remodeling
Control various kinds of cell process, including recombination stem cell versatility, the diffusion and transfer of the marking and tumour cell of parent and apparent
Genetic modification and absorption miRNAs.
Recently, the human diseases especially malignant tumour phase of a large amount of studies have shown that exception lncRNAs expression and multiplicity
It closes.For example, lncRNAROR can promote the promoter region H3K9 demethylation of TESC to participate in swollen by inhibiting transmethylase G9A
Tumor occurs.Meanwhile AOC4P inhibits Epithelial and stromal conversion (EMT) to inhibit by the way that its degradation is bound and promoted with vimentin
Hepatocellular carcinoma transfer.In addition, the LUADT1 of up-regulation promotes the cell of adenocarcinoma of lung by the way that the expression of P27 is bound and inhibited with SUZ12
Proliferation.These discoveries show that lncRNAs plays the part of vital role during human malignancies occurrence and development.Therefore,
It was found that the relevant lncRNAs of more tumours and study their biological function and mechanism, to more fully understanding that NSCLC tumour sends out
The molecular biology of hair tonic exhibition has important meaning.
AGAP2-AS1 is the lncRNA that a length is 1567nt, is located at human chromosomal 12q14.1.We have found that
AGAP2-AS1 is raised in NSCLC tissue and cell, and its overexpression is related to patient's poor prognosis.It is raising or is striking
After AGAP2-AS1, AGAP2-AS1 is had studied in the effect of NSCLC tumour occurrence and development and has studied AGAP2-AS1 and exists
Target gene in NSCLC cell.
Summary of the invention
The object of the present invention is to provide non-small thin for diagnosing non-small cell lung cancer (NSCLC) prognosis situation or as treating
The long non-coding RNA (AGAP2-AS1) of born of the same parents' lung-cancer medicament target spot, nucleotides sequence are classified as SEQ ID NO.1,
SEQ ID NO.1:
AGCGCCTAGGAGCCCGTACCGCTGGGGACCTCCCCTTCCGCGAACCCCGAGCGGGTAGACCCAGAGCA
ATCCGAGTGTGGAAACAATGGAGAGGGGGCGTGTTGAGCTGGGGTCTCCATGCCTCGTTGGGGAGAGGGAGCTCAC
GTACCCACAGCAGCAGTTGCG TGATGACGACGTGGGCGAGCTCGGCCGCCAGGTGGAGTGGGGAGCGCAGCTGTG
GGTCCTCTACGCTGGTGTCGAGCGGCCCGTGTCGCGCATGGGCCAAAAGCAGGAGAACGGTAGCCACGTCCTGGGC
CTGCACGGCGGCCCACAGCTGGCGGCCCAGCGGCTCCTCCGAGGTGCTCAGCGGCGCCAGGAACAGTAGCTGCTCG
TACTTGGCGCGAATCCACGACTCGCGCTCCTCCCTGCAAGACCAGGGATCAACGGAAAAGGCTCTAGGGACCCCCA
GCCAGGACTTCTGCCCCTACCCACGGGACCGTCTCAGGTTCGCACACCCTCAGCAACCCTCCCCCCGCTCTGTTCC
CTCACGCTTACCGCGAAGAGTCCCGCGAGGGCTTGGCACGGCCTCGCGTGTCGCTTTCCCACACGCGGTTGGCCGT
GTCGTTGCCAATAGCCGTCAGCACCAGGGTCAGCTCCCGTGGCCAGTCGTCCAAGTCCAGCGAGCGAACGCGGGAC
AGGTGTGTGCCCAGGTTGCGGTGGATGCCAGAACACTCGATGCAGATGAGGGCGCCCAGGTTCAAGCTGGCCCACG
TGGGGTCTGCGGAAGGAGCGTAGAGGTCGGCTCCCAGCCGGGCAGCACAGGCACCCCGGCATTCACTACACTCCCT
AGCCCCTCCGCTGCCTCCTGGCACTCACTGGGGGCCCCGCAGTCCACGCAGATTGAATTCCCCTTGGCGTTCCGGA
TCGCCTGGATGGCCACGGCCTCGCTTTGGCTGTCTGTGCGCAGCTGCAGAGAGGGTTTGGGTTGGCACTGACTCTG
CCTCCAAGCCCCACCTCCTTCTCAGACACCTCTGCTCTCCTCTCACACGACTTCGGCCGTGTCGTTGCCAATGGCC
GTCAGCACCAGGGTCAGTTCCTGCGGCCAGTCCTCCACTCCACCTCAAACTCTTACCTTGACCTTGCTGCTCTCAC
AGCATTGCAGACTGGCTAGGATCTGACTCTCGATGGCCTGGACCCAGGCATCCCGCTCCTCAAAACTGGCTGCCTC
AAAGTGCCACGTCTGACCCGTGCTGGACACGATCAGGAACTCAAAGTTTTCCTCTGAGTGGGGGATGGGATGGGGT
CATTAAGGGACAGAGTTCAAGCAGGGGCTGCCTTTCCCAAGACCGTCCTCCCTGATGTCCATCCCGAGCCCCTGGG
AGTGGGGCAGTGGGGGTAGGGAAAGCAGAGGGTGGGGGGCAGCAGGAAGCCCGAGCACATGCAGGGGAAGGCGGGG
GCACCCCCACCCTTCTGCACCCCAGCTGAGCGCCCCTCCCGGCTCCCCACTTGTTACCTGCTTTATAAATATTTCT
TAAACTACCAAAGGATTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA。
The invention further relates to the markers of the identification long non-coding RNA to judge that Treatment for Non-small Cell Lung is pre- in preparation
Application in the diagnostic products of situation afterwards, the marker includes but is not limited to:
(1) in conjunction with described in the combination of primer/primer sets of the long non-coding RNA or fluorescent marker long non-coding RNA
Primer/primer sets；
(2) in conjunction with the small molecule compound of the long non-coding RNA；
(3) in conjunction with the large biological molecule of the long non-coding RNA, the large biological molecule includes but is not limited to: antibody
Or the antibody or antibody functional fragment of antibody functional fragment, fluorescent marker, rna binding protein or its function fragment, fluorescent marker
Rna binding protein or its function fragment.
Preferably, the nucleotide sequence of the primer sets or the primer sets of fluorescent marker such as SEQ ID NO.4 and SEQ
Shown in ID NO.5,
Primer F (SEQ ID NO:4):
5 '-TACCTTGACCTTGCTGCTCTC-3 ',
Primer R (SEQ ID NO:5):
5’-TGTCCCTTAATGACCCCATCC-3’。
The invention further relates to the markers comprising long non-coding RNA described in the identification for judging non-small cell
The reagent or kit of lung cancer therapy prognosis situation.
Reagent the invention further relates to the marker of long non-coding RNA described in the identification or comprising the marker
Or application of the kit in the treatment prognosis situation for judging non-small cell lung cancer.
The invention further relates to inhibit the inhibitor of the long non-coding RNA preparing the drug for treating non-small cell lung cancer
In application, the inhibitor includes but is not limited to:
(1) inhibit siRNA, shRNA or functionally similar interference tiny RNA of the long non-coding RNA；
(2) inhibit the small molecule compound of the long non-coding RNA；
(3) inhibit the large biological molecule of the long non-coding RNA, the large biological molecule includes but is not limited to: antibody
Or the enzyme or its function fragment of antibody functional fragment, high Substratspezifitaet.
Preferably, the nucleotide sequence such as SEQ ID of the coding DNA of the siRNA of the inhibition long non-coding RNA
Shown in NO.2 or SEQ ID NO.3,
SEQ ID NO.2:(5 ' to3 ') CCACTCCACCTCAAACTCTTACCTT,
SEQ ID NO.3:(5 ' to3 ') GGGTCATTAAGGGACAGAGTTCAAG.
The invention further relates to the drugs or pharmaceutical composition for being used to treat non-small cell lung cancer comprising the inhibitor.
Drug the invention further relates to the inhibitor or comprising the inhibitor or pharmaceutical composition are non-in treatment
Application in Small Cell Lung Cancer.
The invention further relates to the long non-coding RNAs in the diagnosis for judging non-small cell lung cancer prognosis situation as screening
Application in reagent.
The invention further relates to the long non-coding RNA answering in the drug as screening treatment non-small cell lung cancer
With.
Technical solution
Tissue collecting
We have collected 80 pairs and undergo surgery in Jiangsu provincial hospital for 2010 to 2011, and tissue is through pathological diagnosis
Non-small cell lung cancer, the non-small cell lung cancer of the preoperative pairing that do not treated locally or systemically and neighbouring normal tissue.
And the characteristics of recording clinical pathology: including lymphatic metastasis, TNM stage and tumor size.Tissue specimen collection is first
Time liquid nitrogen is stored in -80 DEG C, until RNA is extracted.The research is ratified by Ethics Committee, Nanjing Medical University.Obtain institute
There is the written informed consent of patient.
Cell line
Five kinds of gland cell systems (A549, PC9SPC-A1, H1975 and H1299), three kinds of squamous cell carcinomas (H520, SK-
MES-1 and H1703) and normal bronchial epithelial cell line 16HBE be purchased from Chinese Academy of Sciences's American Type Culture Collection committee member
Meeting cell bank (Chinese Shanghai).The 1640 culture medium culture of RPMI of A549, H1975, H1299, H520 cell；16HBE, PC9,
SPC-A1, SK-MES-1 cell are cultivated with DMEM culture medium (GIBCO-BRL), in culture medium containing 10% fetal calf serum,
The penicillin of 100U/ml and the streptomysin of 100mg/ml.Routine culture in 37 DEG C of constant incubators of 5%CO2.Every 2-3 days more
Fresh culture is changed, the passage when cell fusion degree reaches 80%-90%.All cell lines are by the DNA of short tandem repeat
Analysis verifying.
RNA is extracted and quantitative PCR analysis
According to the operation instruction of reagent, total serum IgE is separated with Trizol reagent.Reverse transcription reaction application TaKaRa Prime
Script kit (TaKaRa, Dalian, China).Reverse Transcriptase kit carries out reverse transcription to 1 μ g total serum IgE, and final volume is 20 μ
l.Interpretation of result: the specificity and amplification efficiency of primer are analyzed, the atopic of primer is judged according to solubility curve.According to expansion
Increase curve and obtain Ct value, the analysis of target gene relative expression quantity is carried out using relative measurement and internal reference GAPDH.Calculation formula
Are as follows: 2^ (- △ Ct), △ Ct=Ct gene-Ct control.
Plasmid construction
People's overall length AGAP2-AS1 cDNA is synthesized, and is inserted into carrier for expression of eukaryon pCDNA 3.1, is constructed
Above-mentioned plasmid is then converted Escherichia coli by AGAP2-AS1 over-express vector plasmid, is shaken bacterium, is cultivated, selects the culture of monoclonal bacterium
Amplification.The coding DNA for being directly targeted the shRNA of AGAP2-AS1 is synthesized by Shanghai Ji Ma company.
Cell transfecting
Plasmid vector (pCDNA-AGAP2-AS1, sh-AGAP2-AS1, pCDNA-LATS2, pCDNA- for transfection
KLF2 and empty carrier plasmid), mentioned with the endotoxic plasmid extraction kit (DNA Midiprep kit, Qiagen) of removal
It takes.The interference sequence of AGAP2-AS1, LATS2 and out-of-order control (si-NC) are purchased from Invitrogen company (Invitrogen
Company, CA, USA).Cell H1299 and H1975 are pressed into every hole 2 × 105A cell kind is in 6 well culture plates, after cell is adherent,
12h, which inhales, before transfecting abandons original culture medium, changes culture medium without double antibody into；10 μ L liposomes are taken to be diluted in the OPTI-MEM of 250 μ L
In, mild piping and druming mixes is incubated for 5min at room temperature；100pmol siRNA is taken, si-NC or 4ug plasmid vector is diluted in 250 respectively
In μ L OPTI-MEM, piping and druming mixes and is incubated for 5min at room temperature；The liposome being incubated for is mixed with siRNA or plasmid dilution,
Mild piping and druming mixes.Continue to be incubated for 20min at room temperature；Said mixture is uniformly instilled and adds good 1.5mL OPTI-MEM in advance
6 well culture plates in, mix gently.37 DEG C, continues in 5%CO2 incubator after cultivating 6h, change complete medium.After transfection
48h, collects cell extraction RNA or albumen carries out real-time quantitative RT-PCR or immunoblotting assay.Sh-AGAP2-AS1 or empty matter
Grain surely turns H1299 cell line and is screened two weeks after transfection sh-AGAP2-AS1 or empty plasmid with G418, then collects clone cell
It carries out in-vivo tumour and forms experiment.
Cell-proliferation activity detection
MTT experiment, by treated, cell presses 1500-2000, every hole cell inoculation in 96 well culture plates.To cell
After 80% is adherent, cell synchronization 12h discards original culture medium.6 multiple holes are arranged in each sample, and every hole total reaction volume is
200μl.The MTT reaction solution (5mg/ml is dissolved in PBS) of 20 μ l is added in every hole, and 37 DEG C are protected from light incubation 4h.Discard supernatant liquid, every hole
150 μ l dimethyl sulfoxides (DMSO) are added, shake 10min, microplate reader measures the absorbance at 490nm wavelength.
EdU experiment, will be in appropriate treated cell in 24 orifice plates, and 10 μM of EdU reagents are added in every hole.After 2h, use
4% paraformaldehyde fixes 30 minutes.Cleaning is dyed 30 minutes using Click-iTR Edu kit, then with DAPI dyeing 5
Minute, then using fluorescence microscope shooting (Olympus, Japan).Finally, being analyzed using Image-Pro Plus software.
Flow cytometry
Apoptosis detection, H1299 the and H1975 cell after being transfected 48 hours with collected by trypsinisation, then according to FITC
Annexin V apoptosis detection kit (BD) and its operation instruction give Annexin V-FITC fluorescence probe and propidium iodide
(PI) it dyes.Flow cytomery and analysis.
Cell cycle detection gives PI using CycleTESTTM PLUS DNA kit (BD) according to specification and dyes,
Then analyzed with FACScan.
Cell migration and Matrigel
The cell Transwell of 8 μm of pore sizes is placed in 24 orifice plates.Cell invasion experiment, with 50mg/l BD
Matrigel 1:8 dilution is coated with the upper chamber face of the cell Transwell bottom film, and the cell being coated with is put into 24 orifice plates, incubates
2h is incubated in case.Vitellophag, centrifugation discards culture solution after terminating digestion, is washed 1-2 times with PBS, with the free serum culture containing BSA
Base weight is outstanding.Cell density is adjusted to 1x105.Take 200 μ l of cell suspension that the cell Transwell is added.Room is added 500 under 24 orifice plates
Culture medium of the μ l containing 10%FBS is put into incubator routine culture for 24 hours.Cell migration assay, adjustment cell density to 1-
10x104.Take 200 μ l of cell suspension that the cell Transwell is added.500 culture mediums of the μ l containing 10%FBS are added in room under 24 orifice plates,
It is put into incubator routine culture for 24 hours.Cell is taken, wipes matrigel and upper indoor cell with cotton swab, it will be small with 0.1% crystal violet
The cell dyeing of outdoor bottom surface is clapped using cell of the inverted microscope to the dyeing that room side above and below the cell Transwell counterdie is adhered to
According to counting.
Tumour forms experiment
4 week old Female nude mice BALB/c mouses are purchased from Nanjing University's model animal center；H1299 cell is cultivated, is turned respectively
Contaminate sh-AGAP2-AS1 or empty carrier；48 hours after cell transfecting, pancreatin digestion, PBS is washed twice, is resuspended in serum-free training
It supports in base, and counts.2 groups of cells take 1 × 107A cell is suspended in 0.1ml plasma-free DMEM medium, and subcutaneous injection is built
Vertical in-vivo tumour forms model.A tumor growth situation is measured every three days.After 18 days, nude mice is put to death, measures subcutaneous tumor group
Knit size.Above all of experimental arrangement is performed according to the zoopery guidance of NIH1996 version.It is raised with complete granular
Material feeds mouse, free water, room temperature (22 ± 2) DEG C, humidity 50~60%, well-ventilated, 12:12h illumination/dark cycle.
All experiments are ratified by Nanjing Medical University's animal protection and Ethics Committee (IACUC).
Sub-cellular orientation
It is thin using PARIS kit (Life Technologies, USA) separation NSCLC cell line according to operation instructions
Karyon and cytoplasm.Use the distribution of the detection of qPCR method AGAP2-AS1, GAPDH and U1 in cytoplasm and nucleus.
GAPDH is cytoplasm reference, and U1 is nucleus reference.AGAP2-AS1, GAPDH and U1 is presented in cytoplasm with total serum IgE percentage
With the expression in nucleus.
RNA immunoblotting
H1299 and H1975 cell is cracked to use for endogenous PRC2 compound and LSD1 immunoblot experiment.It will be on cell
Clearly with coating respectively identify EZH2, LSD1, SNRNP70 and compare IgG albumin A/G agarose magnetic bead it is 6 small in 4 DEG C of incubations
When.Then, magnetic bead is cleaned, is incubated for 30 minutes at 55 DEG C with 0.1%SDS/0.5mg/ml Proteinase K to remove removing protein.Extract RNA
It is analyzed for qPCR.
Chromatin immune co-precipitation
Using the fixed H1299 and H1975 cell of 4% paraformaldehyde, 10 minutes are incubated for generate DNA- protein-crosslinking.Ultrasound
Lytic cell is then anti-with EZH2, H3K27me3, LSD1 and H3K4me2 specificity to generate the chromosome fragment of 200-300bp
Body and control IgG antibody are incubated for precipitating.Restore chromatin dna, is then tested and analyzed using qPCR.
Protein immunoblotting
The cell protein pyrolysis product being denaturalized is added to 10% pre-fabricated modacrylic acyl ammonia gel (SDS-
PAGE in well), albumen in separating sample.NC film is then switched into, and is incubated for specific antibody.Finally shone with ECL
Hydraulic exposure.GAPDH antibody is control, and LATS antibody is purchased from CST company, and KLF2 antibody is purchased from sigma company.
Data processing
Experimental data all uses SPSS17.0 software to analyze, and is indicated with the average value ± standard error tested three times, group difference
With double tail Student ' s T inspection, rank sum test and Chi-square Test.DFS and OS analysis Kaplan-Meier method.Existence number
According to also with single factor test and the analysis of multifactor Cox proportional hazard model.Based on Cox regression analysis, p < 0.05 in single factor analysis
Then reuse multiplicity.Correlation analysis is analyzed with linear regression model (LRM) between AGAP2-AS1 and LATS2 or KLF2 expression
Connection.Double tail p values are calculated, the inspection level of a=0.05 is chosen.
Detailed description of the invention
Fig. 1, lncRNA AGAP2-AS1 express up-regulation in NSCLC tissue, and closely related with patient's poor prognosis.
1A:lncRNA AGAP2-AS1 is raised in NSCLC tissue expression compared with normal tissue；
The expression of 1B:AGAP2-AS1 in the cancerous tissue of 72.5% (58/80) compared with normal tissue expression increase (multiple >
1.5, P < 0.01)；
1C: according to the expression in opposite AGAP2-AS1 tumor tissues, 80 NSCLC patients are divided into two groups: high AGAP2-
AS1 group (n=40, multiple >=average ratio)；With low AGAP2-AS1 group (n=40, multiple≤average ratio)；
1D: overall survival (OS), the above are 17.8%, low AGAP2-AS1 group is 34.6% to high AGAP2-AS1 group within 3 years.
The high AGAP2-AS1 group mean survival time is 24 months, and low AGAP2-AS1 group is then 31 months；
1E: Progression free survival (PFS), high AGAP2-AS1 group are 11.6%, and low AGAP2-AS1 group is 30.2%.Middle position is raw
It deposits the time, high AGAP2-AS1 group is 20 months, and low AGAP2-AS1 group is then 29 months.
Fig. 2, RNAi technology strike the proliferative capacity of the expression inhibiting NSCLC cell of low AGAP2-AS1
The overexpression of Fig. 2A and Fig. 2 B:AGAP2-AS1 promotes A549 and SPCA1 cell Proliferation；
Fig. 2 C: Clone forming Test the result shows that, lower AGAP2-AS1 after H1299 and H1975 Cell clonality
Weaken, and AGAP2-AS1 enhances A549 and SPCA1 Cell clonality after being overexpressed；
Fig. 2 D:EDU dyeing proves, reduces the proliferation of non-small cell lung cancer cell after striking low AGAP2-AS1, and is overexpressed
Cell proliferation of NSCLC enhances after AGAP2-AS1；
Cell-cycle arrest is in the G1/G0 phase after Fig. 2 E:H1299H1975 cell transfecting si-AGAP2-AS1
Fig. 3, RNAi technology strike the induced expression NSCLC Apoptosis of low AGAP2-AS1
3A: early apoptosis (UR) and late apoptic rate (LR) strike height in low H1299 and H1975 cell in AGAP2-AS1
In cellular control unit；
3B: transfection AGAP2-AS1 siRNA H1299 and H1975 cell in Tunel staining positive cells (it is green, blue,
Core) rate be higher than cellular control unit；
3C and 3D: inhibiting non-small cell lung cancer cell transfer ability about 70% after striking low AGAP2-AS1, inhibits invasion energy
Power 60%.
Fig. 4, strike low AGAP2-AS1 expression inhibiting NSCLC cell internal one-tenth knurl ability
4A:sh-AGAP2-AS1 group is significantly less than control group；
4B:sh-AGAP2-AS1 group tumor weight (0.22 ± 0.09g) is shown compared with empty carrier group (0.085 ± 0.02g)
Writing reduces；
4C: detecting AGAP2-AS1 expression with qPCR in tumor tissues, and transfection sh-AGAP2-AS1 cell forms tumor
Middle AGAP2-AS1 expression forms tumor lower than cellular control unit；
4D:sh-AGAP2-AS1 transfects H1299 cell and forms Ki67 decrease of positive Tunel positive increase in tumor, shows to strike
It can inhibit the growth of tumour after low AGAP2-AS1 in vivo.
Specific embodiment
The present invention will be further explained by examples below, but does not limit the present invention.
Generality explanation:
The experimental method of the dated actual conditions in end in embodiment is substantially all and writes according to Sambrook, J et al.
" Molecular Cloning:A Laboratory guide (the 3rd edition) " (MolecularCloning:ALaboratoryManual, 3rded. Huang Peitang etc.
Translate, Science Press .2002.8) described in condition and method or according to condition proposed by material supplier and method into
Row, it is well known standard method that other technologies being not described in, which correspond to for those skilled in the art,.
Material of the invention: cell strain, slow virus interference carrier and the culture medium referred in the application has commodity confession
Answer or with other approach can for obtained by the public, they are only for example, to the present invention be not uniquely, can be respectively with other suitable
Tool and biomaterial replace.
Embodiment 1 detects expression of the AGAP2-AS1 in tissue and cell
0.1g is taken to organize, liquid nitrogen grinding sufficiently (at powdered) or 1-5 × 107Cell abandons culture medium, the PBS rinse of pre-cooling
2 times.The Trizol lysate of 1ml is added, is blown and beaten and is mixed with no enzyme pipette tips, stands 5min, lysate immigration is marked in advance
The centrifuge tube without enzyme 1.5ml in.4 DEG C of 7500g are centrifuged 5 minutes, are taken supernatant that the chloroform of 1/5 volume is added, are mixed by inversion 30s,
Stand 2min.4 DEG C, 12000g centrifugation, 15min.Three layers (water phase-white precipitate-red organic matter) of solution point shifts aqueous layer
Into new 1.5ml centrifuge tube, try not to be drawn onto white precipitate.Isometric isopropanol is added, is gently mixed by inversion, places 5-
10min.4 DEG C, 12000g centrifugation, 10min.It inhales and abandons supernatant, the ethyl alcohol (now matching) of 1ml 75% is added, wash RNA precipitate.4 DEG C,
7500g centrifugation, 5min abandon supernatant.The alcohol of removal 75% as far as possible, dries, about 15min in room temperature.With no RNA enzyme water
(20-25 μ l) dissolves RNA precipitate.
The concentration of determination of uv absorption method measurement RNA.RNA concentration and purity, measurement are measured using ultraviolet specrophotometer
It is preceding first to be returned to zero with the DEPC water of dissolution RNA.Readings 1 is to indicate 40ng/ μ l at 260nm, the A260/A280's of RNA solution
Ratio is used for the detection of RNA purity, and ratio range shows to meet the requirements 1.8 to 2.1.Agarose gel electrophoresis identifies RNA's
Integrality.Prepare 1% agarose gel.Agarose is dissolved by heating, it is cooling, 1 μ l ethidium bromide (EB, 10mg/ml) is added.It shakes up
The glue that falls afterwards is placed in electrophoresis tank after glue condensation, is dipped in 1 × TAE buffer and balances 10min, for use.Point sample.By 1:4 (v/
V) 5 × nucleic acid electrophoresis sample-loading buffer is mixed with sample, accurately the RNA that each sample contains 1 μ g is added in gel pore.80V
Constant pressure electrophoresis 50min.After electrophoresis, result is observed in gel imager.
Tris- acetic acid (TAE) buffer formulation (1L) 50 ×:
Real-time quantitative PCR
NSCLC tissue and cancer beside organism's sample, the total serum IgE of NSCLC cell, reverse transcription reaction application TaKaRa
PrimeScript kit (Dalian treasured bioengineering Co., Ltd).Reverse transcription reaction system is as follows:
Reverse transcription reaction condition is as follows: 37 DEG C of 15min (reverse transcription reaction)；(inactivation of reverse transcriptase is anti-by 85 DEG C of 5sec
It answers).According to Genebank provide gene order, design primer sequence,
QPCR application 7300PCR system (Applied Biosystems, Warrington, UK).CDNA sample uses three
Portion's method PCR amplification standardization program.Reaction system:
Reaction condition:
Interpretation of result: the specificity and amplification efficiency of primer are analyzed, the atopic of primer is judged according to solubility curve.
Ct value is obtained according to amplification curve, the analysis of target gene relative expression quantity is carried out using relative measurement and internal reference GAPDH.It calculates
Formula are as follows: 2^(-△Ct), △ Ct=Ct gene-Ct control.
The primer of AGAP2-AS1 is as follows:
Primer F (SEQ ID NO:4):
5 '-TACCTTGACCTTGCTGCTCTC-3 ',
Primer R (SEQ ID NO:5):
5’-TGTCCCTTAATGACCCCATCC-3’
The result shows that lncRNA AGAP2-AS1 raises (Figure 1A) compared with normal tissue in NSCLC tissue expression.We utilize
Real-time quantitative PCR has detected the expression of AGAP2-AS1 in 80 pairs of NSCLC tissue/Carcinoma side normal tissues.As the result is shown with cancer
Other normal tissue is compared, and the expression of AGAP2-AS1 increases (again in the cancerous tissue of 72.5% (58/80) compared with normal tissue expression
Number>1.5, P<0.01) (Figure 1B).In addition, we will be between the expression of AGAP2-AS1 and Patients with Non-small-cell Lung Clinical symptoms
Relationship analyzed, the results showed that the AGAP2-AS1 level of up-regulation and Patients with Non-small-cell Lung tumor size (p <
0.01) and pathological late (p < 0.01) is related.However, AGAP2-AS1 expression and other parameters such as gender (p=
And age (p=0.823) unrelated (table 1) 0.822).
Kaplan-Meier survival function carries out survival analysis, and it is pre- with NSCLC patient further to inquire into AGAP2-AS1 expression
Correlation between afterwards.According to the expression in opposite AGAP2-AS1 tumor tissues, 80 NSCLC patients are divided into two groups: high
AGAP2-AS1 group (n=40, multiple >=average ratio)；With low AGAP2-AS1 group (n=40, multiple≤average ratio) (figure
1C).Overall survival (OS), the above are 17.8%, low AGAP2-AS1 group is 34.6% to high AGAP2-AS1 group within 3 years.It is high
The AGAP2-AS1 group mean survival time is 24 months, and low AGAP2-AS1 group is then 31 months (Fig. 1 D).Progression free survival
(PFS), high AGAP2-AS1 group is 11.6%, and low AGAP2-AS1 group is 30.2%.Median survival time, high AGAP2-AS1 group
It is 20 months, and low AGAP2-AS1 group is then 29 months (Fig. 1 E).
The clinical phenotypes of table 1NSCLC patient are associated with situation with AGAP2-AS1 expression
*Overall P<0.05.
Embodiment 2 constructs AGAP2-AS1 slow virus interference carrier and transfects cell:
Design the interference sequence for AGAP2-AS1 of specificity, the DNA sequence dna of coding are as follows:
Seq ID NO.2:(5 ' to3 ') CCACTCCACCTCAAACTCTTACCTT,
Seq ID NO.3:(5 ' to3 ') GGGTCATTAAGGGACAGAGTTCAAG.
To interfere the tract of GAPDH gene as control, and (the above carrier and segment are inserted into slow virus carrier
It is synthesized by invitrogen company).Packaged slow virus carrier is infected into non-small cell lung cancer cell strain H1299 and H1975
Cell plays the role of downward AGAP2-AS1 and expresses, screens stably transfected cell line with G418 after 48h, be named as sh-
AGAP2-AS1 (control is sh-NC).
In order to study influence of the AGAP2-AS1 to NSCLC cell phenotype.MTT detection discovery, in H1299 and H1975 cell
In strike low AGAP2-AS1 expression after inhibit cell growth.In contrast, the overexpression of AGAP2-AS1 promotes A549 and SPCA1 thin
Born of the same parents are proliferated (Fig. 2A and 2B).In addition, Clone forming Test the result shows that, lower AGAP2-AS1 after H1299 and H1975 cell gram
Grand Forming ability weakens, and AGAP2-AS1 enhances A549 and SPCA1 Cell clonality (Fig. 2 C) after being overexpressed.This
Outside, EDU dyeing proves, strikes the proliferation of reduction non-small cell lung cancer cell after low AGAP2-AS1, and after being overexpressed AGAP2-AS1
Cell proliferation of NSCLC enhances (Fig. 2 D)
Influence of 3 AGAP2-AS1 of embodiment to non-small cell lung cancer cell period and apoptosis
It is converted to examine whether AGAP2-AS1 to the cell cycle that affects of the proliferation of non-small cell lung cancer cell, I
Use the flow cytometry cell cycle.The result shows that the cell cycle after H1299H1975 cell transfecting si-AGAP2-AS1
It is arrested in G1/G0 phase (Fig. 2 E).In addition, whether We conducted flow cytometers and Tunel staining analysis Apoptosis to participate in
AGAP2-AS1 strike it is low after the cell growth that induces it is suppressed.As shown in Figure 3A, early apoptosis (UR) and late apoptic rate (LR) exist
AGAP2-AS1, which strikes, is higher than cellular control unit in low H1299 and H1975 cell.At the same time, in transfection AGAP2-AS1siRNA
H1299 and H1975 cell in Tunel staining positive cells rate be higher than cellular control unit (Fig. 3 B).These statistics indicate that,
AGAP2-AS1 can promote the proliferation of non-small cell lung cancer cell.
4 AGAP2-AS1 of embodiment participates in non-small cell lung cancer cell migration and invasion
One importance of tumor cell invasion and metastatic tumour malignant phenotype.We are had studied with transwells
AGAP2-AS1 influences NSCLC cell migration and invasive ability.The result shows that after striking low AGAP2-AS1 with cellular control unit phase
Than, it is suppressed that non-small cell lung cancer cell transfer ability about 70% inhibits invasive ability 60% (Fig. 3 C and D).These result tables
It is bright, inhibit malignancy of tumor phenotype after striking low AGAP2-AS1 expression, hinders non-small cell lung cancer cell migration and invasion.
Embodiment 5 inhibits non-small cell lung cancer cell in-vivo tumour to be formed after striking low AGAP2-AS1
Explore whether AGAP2-AS1 also will affect in-vivo tumour, we use sh-AGAP2-AS1 (1#) or empty carrier
Stable transfection H1299 cell.MTT is analysis shows inhibit the growth of H1299 cell, Clone formation after in-vitro transfection sh-AGAP2-AS1
Experiments have shown that H1299 Cell clonality weakens after transfection sh-AGAP2-AS1#1.Next, by sh-AGAP2-AS1
It is subcutaneous that (1#) or empty carrier stable transfection H1299 cell inject mouse.After injection after 18 days, tumour formational situation is observed.sh-
AGAP2-AS1 group is significantly less than control group (Fig. 4 A).At the same time, sh-AGAP2-AS1 group tumor weight (0.22 ± 0.09g)
It is significantly reduced compared with empty carrier group (0.085 ± 0.02g) (Fig. 4 B).In addition, detecting AGAP2- with qPCR in tumor tissues
AS1 expression, transfection sh-AGAP2-AS1 cell form AGAP2-AS1 expression in tumor and are lower than cellular control unit formation tumor
(Fig. 4 C).In addition, sh-AGAP2-AS1 transfection H1299 cell, which forms the Ki67 decrease of positive Tunel positive in tumor, increases (Fig. 4 D).
These statistics indicate that, strike the growth that can inhibit tumour after low AGAP2-AS1 in vivo.
Claims (1)
1. the use that the primer sets for detecting long non-coding RNA judge the kit of Treatment for Non-small Cell Lung prognosis situation in preparation
On the way, the long non-coding RNA is nucleotide sequence AGAP2-AS1 as shown in SEQ ID NO.1, the core of the primer sets
Nucleotide sequence is as shown in SEQ ID NO.4 and SEQ ID NO.5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610299374.7A CN105969846B (en) | 2016-05-06 | 2016-05-06 | A kind of long non-coding RNA and its application in diagnosis/treatment non-small cell lung cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610299374.7A CN105969846B (en) | 2016-05-06 | 2016-05-06 | A kind of long non-coding RNA and its application in diagnosis/treatment non-small cell lung cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105969846A CN105969846A (en) | 2016-09-28 |
| CN105969846B true CN105969846B (en) | 2019-09-27 |
Family
ID=56992420
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610299374.7A Active CN105969846B (en) | 2016-05-06 | 2016-05-06 | A kind of long non-coding RNA and its application in diagnosis/treatment non-small cell lung cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105969846B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109030835B (en) * | 2018-09-06 | 2021-06-22 | 江苏省人民医院（南京医科大学第一附属医院） | Method for analyzing effect of Rab8 on Klotho expression regulation in non-small cell lung cancer |
| CN111154858B (en) * | 2020-01-14 | 2022-08-12 | 江苏省人民医院（南京医科大学第一附属医院） | Long non-coding RNA and application thereof in diagnosis/treatment of preeclampsia |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146412A (en) * | 2011-01-11 | 2011-08-10 | 中山大学 | Small molecular non-coding RNA gene hsa-miR-29b and use thereof |
| CN103146693A (en) * | 2013-02-26 | 2013-06-12 | 中南大学 | Long chain non-coding RNA (Ribonucleic Acid) gene and application method thereof |
| CN103316359A (en) * | 2013-07-11 | 2013-09-25 | 南京医科大学第二附属医院 | Application of long-chain non-coding RNA in preparation of non-small cell lung cancer treatment drugs |
| CN105177005A (en) * | 2015-10-13 | 2015-12-23 | 南京医科大学第二附属医院 | Long non-coding RNA (Ribonucleic Acid) and application thereof |
-
2016
- 2016-05-06 CN CN201610299374.7A patent/CN105969846B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146412A (en) * | 2011-01-11 | 2011-08-10 | 中山大学 | Small molecular non-coding RNA gene hsa-miR-29b and use thereof |
| CN103146693A (en) * | 2013-02-26 | 2013-06-12 | 中南大学 | Long chain non-coding RNA (Ribonucleic Acid) gene and application method thereof |
| CN103316359A (en) * | 2013-07-11 | 2013-09-25 | 南京医科大学第二附属医院 | Application of long-chain non-coding RNA in preparation of non-small cell lung cancer treatment drugs |
| CN105177005A (en) * | 2015-10-13 | 2015-12-23 | 南京医科大学第二附属医院 | Long non-coding RNA (Ribonucleic Acid) and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| Arf GTPase-activating Protein AGAP2 Regulates Focal Adhesion Kinase Activity and Focal Adhesion Remodeling;Yunjuan Zhu等;《THE JOURNAL OF BIOLOGICAL CHEMISTRY》;20090515;第284卷(第20期);13489-13496 * |
| Homo sapiens AGAP2 antisense RNA 1 (AGAP2-AS1), long non-coding RNA;NR_027032.1;《NCBI》;20151224;1 * |
| Identification of Novel Long Noncoding RNAs Underlying Vertebrate Cardiovascular Development;Leo Kurian等;《Circulation》;20150407;第131卷(第14期);1278-1290 * |
| Study on expression of lncRNA RGMB-AS1 and repulsive guidance molecule b in non-small cell lung cancer;Ping Li等;《Diagnostic Pathology》;20151231;第10卷;1-7 * |
| Upregulated long non-coding RNA AGAP2-AS1 represses LATS2 and KLF2 expression through interacting with E ZH2 and LSD1 in non-small-cell lung cancer cells;W Li等;《Cell Death and Disease》;20160519;第7卷;1-11 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105969846A (en) | 2016-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | Radiosensitizing effects of miR‐18a‐5p on lung cancer stem‐like cells via downregulating both ATM and HIF‐1α | |
| Shi et al. | miR-145 inhibits migration and invasion of glioma stem cells by targeting ABCG2 | |
| Teoh-Fitzgerald et al. | Epigenetic reprogramming governs EcSOD expression during human mammary epithelial cell differentiation, tumorigenesis and metastasis | |
| Kang et al. | EGFL7 is an intercellular EGFR signal messenger that plays an oncogenic role in glioma | |
| Jiang et al. | TPX2 regulates tumor growth in human cervical carcinoma cells | |
| Qadir et al. | miRNA in hepatocellular carcinoma: pathogenesis and therapeutic approaches | |
| Chen et al. | Effect of miR-29b on the proliferation and apoptosis of pulmonary artery smooth muscle cells by targeting Mcl-1 and CCND2 | |
| Kim et al. | Role of EphA2‑PI3K signaling in vasculogenic mimicry induced by cancer‑associated fibroblasts in gastric cancer cells | |
| Cui et al. | MiR-483 suppresses cell proliferation and promotes cell apoptosis by targeting SOX3 in breast cancer | |
| Wang et al. | Overexpression of serine/threonine‑protein kinase-1 in pancreatic cancer tissue: Serine/threonine-protein kinase-1 knockdown increases the chemosensitivity of pancreatic cancer cells | |
| CN109652545A (en) | ZNF750 is in screening for treating the purposes in esophageal squamous cell carcinoma targeted drug | |
| Liu et al. | MiR-601 inhibits the proliferation and metastasis of esophageal squamous cell carcinoma (ESCC) by targeting HDAC6. | |
| CN109468382A (en) | Application of the lncRNA in adenocarcinoma of lung diagnosis and treatment | |
| CN105969846B (en) | A kind of long non-coding RNA and its application in diagnosis/treatment non-small cell lung cancer | |
| Qi et al. | Long non-coding RNA SNHG1 promotes cell proliferation and tumorigenesis in colorectal cancer via Wnt/β-catenin signaling | |
| Dong et al. | Long intergenic non-protein coding RNA 1094 promotes initiation and progression of glioblastoma by promoting microRNA-577-regulated stabilization of brain-derived neurotrophic factor | |
| Liu et al. | Antioral squamous cell carcinoma effects of carvacrol via inhibiting inflammation, proliferation, and migration related to Nrf2/Keap1 pathway | |
| Chen et al. | Lentivirus mediated γ-interferon-inducible lysosomal thiol reductase (GILT) knockdown suppresses human glioma U373MG cell proliferation | |
| Lu et al. | RETRACTED ARTICLE: LINC01436 Promotes the Progression of Gastric Cancer via Regulating miR-513a-5p/APE1 Axis | |
| Li et al. | RETRACTED ARTICLE: Knockdown of hsa_circ_0058124 inhibits the proliferation of human lung cancer cells by up-regulation of miR-1297 | |
| CN110251529A (en) | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament | |
| CN108034655B (en) | Application of long non-coding RNA and composition thereof in diagnosis/treatment of colorectal cancer | |
| CN110066875A (en) | A kind of application of long-chain non-coding RNA lncLCIR-1 as lung cancer molecular marker | |
| Lin et al. | The expression profile of miRNA in glioma and the role of miR-339-5p in glioma | |
| Fan et al. | Roles of circular RNAs in regulating the development of glioma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |