CN113832235A

CN113832235A - lncRNA marker related to piglet bacterial diarrhea resistance and application thereof

Info

Publication number: CN113832235A
Application number: CN202111035954.2A
Authority: CN
Inventors: 包文斌; 范海瑞; 吴正常; 任战士; 吴圣龙; 殷宗俊; 王海飞
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2021-09-06
Filing date: 2021-09-06
Publication date: 2021-12-24

Abstract

The invention screens out 1 key candidate lncRNA for controlling Escherichia coli F18 infection through omics sequencingFUT3‑AS1，The sequence is SEQ ID NO 1, on the basis, the research carries out deep analysis around the FuT3-AS1 function and regulation mechanism, firstly, qPCR and Northern blot technology are utilized to detect the expression difference of the FUT3-AS1 in duodenum of F18 escherichia coli sensitive and resistant weaned piglets of Meishan pigs and Sutai pigs, and lncRNA-FUT3-AS1 silent is successfully establishedThe interference efficiency of the porcine small intestine epithelial cells reaches 68%, and the silencing of IncRNA-FUT 3-AS1 is found by a series of detection means such AS bacterial counting, gram staining, scanning electron microscopy and indirect immunofluorescence, so that the adhesion capacity of F18 escherichia coli to IPEC-J2 cells can be remarkably reduced. Therefore, the lncRNA-FUT3-AS1 plays an important resistance regulation and control function in the process of resisting the infection of F18 escherichia coli by the weaned piglets, the expression level of the lncRNA-FUT3-AS1 is reduced, the adhesion capability of small intestinal epithelial cells to the F18 escherichia coli is reduced, and the resistance capability of the piglets to the infection of the F18 escherichia coli is improved.

Description

lncRNA marker related to piglet bacterial diarrhea resistance and application thereof

Technical Field

The invention relates to the technical field of biology, and in particular relates to an lncRNA marker lncRNA-FUT3-AS1 related to piglet bacterial diarrhea and application of the lncRNA marker serving AS a target spot in improvement of resistance of a pig to escherichia coli.

Background

F18 colibacillus is one of the important pathogenic bacteria causing bacterial diarrhea of weaned piglets in the pig industry at present, and the colibacillus and the lipopolysaccharide released by the colibacillus are directly combined with receptors on small intestine epithelial cells, so that the small intestine epithelial cells are diseased, and the symptoms of edema, diarrhea and the like of the piglets are caused. Therefore, whether weaned piglets can resist the infection of Escherichia coli F18 is firstly determined by whether Escherichia coli F18 receptor of small intestine mucous epithelial cells is expressed. Foreign research finds that the type 1H antigen is involved in forming ABH blood group antigens, is the minimum antigenic determinant of an F18 escherichia coli adhesion receptor, is mainly catalyzed by alpha- (1,2) fucose transferase (FUT2 enzyme), and the functional activity of the FUT2 enzyme is jointly regulated by FUT1 and FUT2 genes; foreign scholars find that the FUT1 gene can influence the expression of F18 escherichia coli receptor protein, and the genetic mutation of the M307 site of the FUT1 gene can be used as a disease-resistant breeding marker of foreign pig escherichia coli F18 diarrhea, but is not suitable for local pig breeds in China. Therefore, the molecular mechanism of weaned piglets resisting Escherichia coli F18 infection needs to be deeply studied, so as to discover and identify key candidate genes related to the piglets resisting Escherichia coli F18 infection.

With the rapid development of high-throughput sequencing technology, the research on long-chain non-coding RNA is gradually emerging and becomes one of the hot spots of the current life science research. Long non-coding RNA (lncRNA) is non-coding RNA transcribed by RNA polymerase II, not only has time specificity, but also has cell and tissue specificity, and the time specificity and the tissue specificity determine the importance of irreplaceable life activities. LncRNA can participate in the regulation of target gene expression through cis-acting or trans-acting modes, thereby affecting many biological processes including X chromosome inactivation, epigenetic regulation, cell cycle regulation, cell proliferation and differentiation regulation, mRNA degradation, protein translation regulation, and the like. A large number of studies at home and abroad show that the lncRNA has close association and regulation functions with the occurrence and the development of human cardiovascular diseases, tumor diseases, viral infection resistance and other diseases. At present, research on lncRNA is not only limited to people but also begins to be carried out on livestock, but compared with research on the lncRNA of people, research on the functional mechanism of the lncRNA related to important economic traits of the livestock is still in an initial stage, and the research on the regulation and control function and mechanism of the lncRNA is not deep enough. In recent years, with the rapid development of high throughput sequencing technology and lncRNA research technology, research on lncRNA of livestock (such as pigs, cattle, sheep and chickens) has made a better progress, mainly focusing on body physiological life activities such as lipogenesis metabolism, tissue organ development and embryonic development, and some researches find that lncRNA plays an important role in immune response process after animal bodies are infected with pathogens such as bacteria and viruses. At present, relatively few reports about the regulation effect of lncRNA on diarrhea of weaned piglets are reported.

Disclosure of Invention

In order to explore the functions and molecular regulation and control mechanisms of lncRNA when piglets resist E.coli F18 infection, the duodenum tissues of individuals sensitive and resistant to Escherichia coli of Sutai pigs and Meishan pigs F18 are subjected to lncRNA sequencing and transcriptome sequencing (sequencing data are submitted to Sequence Read archives in NCBI databases, and BioProject IDs are PRJNA476718, PRJNA476720, PRJNA476721 and PRJNA476722 respectively), sequencing results are subjected to intersection analysis by utilizing Venny software, and 1 key lncRNA-FUT3-AS1 is screened out according to the comprehensive analysis of target gene prediction results. In order to investigate the functions and the regulation mechanism of the IncRNA-FUT 3-AS1 in the process of resisting escherichia coli infection, the expression level of the IncRNA-FUT 3-AS1 in intestinal tissues of Sutai weaned piglets is detected by Real-time fluorescence quantification (qPCR) and a Northern blot hybridization method, and the mRNA expression levels of the IncRNA-FUT 3-AS1 before and after treatment are detected by treating a small intestinal epithelial cell line (IPEC-J2) of a pig by escherichia coli infection stimulation and LPS induction. Secondly, designing and constructing silencing siRNA of the target pig lncRNA-FUT3-AS1, detecting the silencing efficiency of the transfected IPEC-J2 cells by using a Real-time PCR method, and systematically analyzing the influence of lncRNA-FUT3-AS1 silencing on the adhesion capability of the small intestine epithelial cells to F18 escherichia coli by using methods such AS bacterial counting, pilin gene quantification, gram staining, scanning electron microscopy, indirect immunofluorescence and the like. The research system verifies the expression regulation function of lncRNA when the porcine small intestine epithelial cells are infected by E.coli F18, provides a certain theoretical basis for further research on the action mechanism of lncRNA-FUT3-AS1 in the future, and provides a systematic research strategy for the research on the lncRNA screening and function verification of livestock and poultry.

The invention aims to provide application of IncRNA-FUT 3-AS1 AS a target point in preparation of a reagent for improving resistance of pigs to escherichia coli or bacterial diarrhea.

The invention also aims to provide application of IncRNA-FUT 3-AS1 AS a functional gene for improving the resistance of the porcine bacterial diarrhea.

The invention also aims to provide application of the lncRNA-FUT3-AS1 in molecular breeding of piglets for resisting colibacillosis.

The invention also aims to provide application of a substance for silencing IncRNA-FUT 3-AS1 or a chemical drug which takes IncRNA-FUT 3-AS1 AS a target spot and reduces the expression of IncRNA-FUT 3-AS1 in preparing a reagent for improving the resistance of pigs to escherichia coli or bacterial diarrhea.

The invention also aims to provide a group of sequences and cell lines for targeted knock-down of pig lncRNA-FUT3-AS1 by using siRNA technology and application thereof.

In order to realize the purpose of the invention, the technical scheme adopted by the invention is as follows:

lncRNA-FUT3-AS1, the DNA sequence of which is:

TTCCTGAACATTCCAGAACCTTCTGGAGCTGGGGGAAAGGGGATGCTGTCTGGAGAA GGCCAAGGGAGACTGAGTTGGAAGTGGAGTTTCTCTGAGGCTCAGAGGGGAATAGGAA CTCTCCTTGGCCCCTAGCCACCTGGGTCAACATCAGGAGATGCCAGGGCAAGCACCATC CCTGCACCCCGATCATCTTCCCATTTGCTCCTCATCGCACGTGTGGTTTGTATGGTTTGTT CCTCACCCACTCCAGGCTGGGGGCAGGGGTGCCCTCCTTTTGAGCCACAAGCTGTCAG CTGCCCCTTGGCTCACAGCCCAAGGCCCCAGGGGAAAGCAGTTTCCAGCGGGCTGGCA GCTCCATCACCCACCAGCCCAAGCTGAGCAAGGCCCTGGGGTCTGACCCAGGCAGAGA CCCCAGCGGCAGGGGAGGTGCAGATGCCCCACGTCGCCCCACACGCTGGTTCCAGCTC ATCCCAAGCCTGAGGGCGGGGTCCCCAGGGTCCCCCACTCTAGGCCTTGGGATCAACCC CTTTCTAGGGAGTCAGGAAATCTCTTGGCTCCCTCTGGTTTGGGGCGGGGGATTCCTCTG CCCCAGAAAGGCTGAACCCCAGAGGCTGGTGGTGGATTCTGGTGCACATCCAGGAGGT CTCGGTTCAGATCCTGATTCCCTCCACCCCCGACCCCCCGCTCCACTTCCCAGCTGTGAG AAGCAGGTGAAACTGTCAATAAAATCTGAAATAAAATTGTAGACAGAATAGGTGGTTTG AGGCCATAAAACTAAATGATGGGAGGGACAGTGGCAGGAAGCCTCCTGAAGGTGGTGG CTCTCTGAGAAGGAGGATTGTGAAGGTGGGGGAGGGGATCACTGCGTGAGGTCAGGGT CAGCTCTGCCAGGGGTGGTCTCAGGTGGAGCAGGAGCTCGCTTGGCCAGTCCAGGGGG GCTTTGGATGGATAGGAGGTGACCTGTATCCCTGTTACACATATGGGTTCCTTTTTTTGTT TGTTTTGGCGGTGCTTGTGGCATAGGGAAGTTCTGGGGCAAGGGAGCAAACCGGAGCC ACAGCCCTGAGAGTGCCGGTTCCTTAACCCACTGAGCCACAGTGGGAACTCCACACCT GGGTTTCATTTCCAGTCCCTGTGAAGTGACAGGATTTGCTGGAGGGGTGTGGGTGGGCA GAGTGTTGGTGATCAAGAACCCCAAATGCCCCCTATGAACTCCACTCATCAGCTTCCCCT TCTCTGCAATTGGGGTCATAGCTCGGGATCAGGGCTCAGCCTGGGGTCATTCGGGGGCT GGCTTGAGGTCGGGGTTCCACCTGGCTACAGTTTCTGACCCCGGAAACACCATTGCTGA GGTCAGCCGGGTCATCCAGCCTCCCGTTGCCCTGTGGGGCCAAGTTCAGGCTCGTGAGA GGCTCAGGCAGGCCAGGTTGCACGATTGGCGTCTGGAAAGATCCCTCTCAGTGAGCCG CACCTAGCTGCCTCTGCCCCAGCCCACATCCTACCCATGACCTGGTGACAGATGGCTAG AACTCCCAGGGAATGGAGGGGTCGTGGAGTCCTGAAGCGCCGCAGATGTGTGTGTGGA CCCCCTGGGGATGCACCCCCACCCCCGCCCATCCCCCACACAGTGGCAAGAGGGTCTG GGCCGGGCCAAAGCAGGTGGAGAGGGACAGCATGGGGTGGGGGGGCTCTGGCTGCGG GCCCAGCCCATCAGGATCTGACAGACAGAGGCCTCCTGGAACCTTCCTGCCCCCCTTGG TTCCCCTGAAGCATCTCAAAGGGGGATTCTTTTTTGTTTGGTTGGTTTGGTTTGGTTTGG GTTTTTTGTTTTTTTGGGTTTTTTGGCTACGCCCAAAGCAGGAGGAAGTTCCCAGGCCA GGGATGGAGCCCACGCCACAGCAGTGATAACACCAGATCCTTAACCCACTGAGCCACC AGGGACTCCTCAAAGTGGTTTTTTGGGTTTTTTTGTCTTTTTGCCTTTTCTGGGGCTGCT CCCACAGTATATGGAGGTTCCCAGGCTAGGGGTCTAATCAGAGTTGTAGCTGCCGGCCTA TGTCAGAGCCACAGCAACACAGGATCCAAGCCACATCTGTGACCTGCACCACAGCTCAT GGCAACGCCGGATCCTTAACCCACTGAGCAAGGTCAGGGATCGAACCCACAACCTCAT GGTTCCTAGTCGGATTTGTTAACCACGGAGACACGACAGGAACTCCTCTCAAAGTGGTA TTTAACAGAGAATCCTTCCACAGCTGAACCATCCTGCTTGGCCCCTCCCCTTGTTGGGGA GCTCATTCCCTCTAGAGACAGTAAAGGACACTCCCACAAGGGCCAGCACAGGCCCTGTA TTATATGGGGGGCGCAGGGGGACTGAGGCTGCCAGAAGGGCCATCCCTCTCCTCATATC CCTCTGTGAGTAAAAGGCAAGACTGATGGCCTGGTGGTTAGGACTTGGCGCTTTCACCA CTGCACCCTGGGTTCAATCCCTAGTCTGGGAACTGAGATCCCATATCAAGCTTCTGTAGG CTGCAGCCAAAAAAAAAAAAAAAAAAGAAAGAAAAAAGGCAGGATCAGAGTCCCAA CCCGACACACTTACAGACAGAGGAGGCACAAACTTTGATCACAAGTGTGGTAGGCAGT GCCCTCCAGGCCTTCACGGGAGACCGGCTTTGGGGTTTTAAATCCTGGAGATAGAGCCC AATTTCTTACTCTCTCTTCCGAACTCTTGTGCCCTCCCGGCTTTTCTGTCCTCATGGGGCT GTCAGCACAGCAGAGGAAGTGACAGTGTGTCCAGAGCTGCACTGGGAAACACCAGGC AGCTATGGGAGCCAGAGGAGGGATCTGATCTGGTGCAGGGGATGGGAGGAATCCAGGG AGGCTCCCTGGAGGAGGTGCCTGGCCTGAGCTCTGTGGGATGACTAGGGATTAACAAGT GGGGGAGTGGGGAGGCACAGGGTGTTCCTGGCAGAGCAGCTTTGTGTAGTGGAGACCC CTTCATGCCCTTGAGATTCTGAACGACCCTCTGGGTCTCAGTTTTCATGGCAGGGTGGCT ATGGGAAGGCTGAAGGCCTGGAACTAACCGGATGCTCTGATGGTTAATGTCCAGGCAGC GTGAAGTAGCCTCATCTGGGGACAGGGGAGTCGTGGTACCTGGGAGGTGGACCTCGGG CTTTGGCCCGCCTGCAGTAGCCCCCTCCTTCCCAGCTTCCGTGCCTCTGCCCTGCTCTGG AAGCTTCCCAGGGCTCCCTGTCACTCTTGTATTGAATAGCCATCCCTGACCACAGCCAGA CACAGCTCAGTGAGGCTGACCTCATCTGCTGCTCACGAACACCCAGCCTTACTGGCTTT CCTCCACTGCCGGATTCCTTGCTGCCTCCGGGCCTTTGCACAGGCTGTCCCTTCTGCCTG GAAAGCTCTTGCCTCCTCCTTTTTCCTTAGAGAATTCTTATGAGGCTTTAGCTCCCAGATC ATACATCCAGGAAGTCCAGACCAGGCCACAACCTCCTCAATTTTTGCAAATTATAATTTA TGTTTGTTTATAAGCTTCCTTACGGGTTATTGGTCTCACCCACTTGCTTCCTGCAATATCC CTGGGGCCTGACACGTAGCAGGTATTCAAGAAACGGTTGCTGAGACGGAACAAGGAGG TGGAATCTGCTGGGAGTGAAGGTGGGGAGCTTGAAATTCTGCTCACTGGCCCCTTCGCA CCCTCCAAGGAACCCCTGGTGCCCCCATGGAAACCACTTTGAGAACCAGGGGCTTGGG TCAGCCCTTTCGCTTTCTGGATGGGTCAACTTTACGCCCAGAGCCATATAAGCCTTGGGG CCATGGGGTGGTGACTCCAGCCCCCAGCTTCCTCCACCCTCTCCCTCCTCAGGTCGTATG GTGATTAGGGGAGTCTCACCTTTGCTTGTGGATGATGGCCTGGCTCATGGGACAGGACA CCTTGCGTCACCTAATGGCAGGTGCGGGGGTTGGGCTGAGCCGTGCTGCAGCTATAGGC ACATTTCCTTCTCCTCCCCCGGTGTCGCCTTATCCATACCCAGGGAGACTGTGCCTCCTA AACTTCCTGGTCAGCCACTCACTGCCGCACACGAACGCTGCCCCCTAGGTAAGGCCTCG GGGGCGGGGGGGGCAGGGGATGTACCCTCTCCCAGAAGGCGTGGGTGCCCCCTGGGAA GAGCCTTTGGGCTGCACTCCCAGGGGTCTTTCTGGGTACCCAGCGCACCAGAGTGGGAT GTTTGGGTTGATTTGGGAAACCAGGAGGGATAGCGTTTCTCTCCCTGTGTCTTCCATCTC CACCCCCCACCCCCCCACCCCCCCACCCTCATCTTTTCCTCTCCTTTGCTCCCTCTTTCTC CCTCTCTCATCCCTCTCTCCCACCCTCCATTTCCTTCTTCCCCCCATCTCTCTCTCTCTGAT GAAGTTTTGGATGAGAACCCCCACTGCTCCTGTGCCCCCATCAGCACCCCCAGAGCCGC TCTTCCTTCCTGACCCATCTCATGGAAAAAAAGGACCTGGGATGCTGCGGGCAAGGTGG GGGGCGATGTTTGGATTTTCTTATCTTTGTGGTGTCCCAGCATAGTGGCATTTTAAAAAGT TCCTTTCTAGGAAGAAACATCCTGGGTTCAAATCAGTGGGATCTCAGCCGTAGCCTCCC AAACCTGTCCCCCAGGCTGTGCTCTTCACGGTCACTGTCAGGGGCCCCCATGCCTCCTA GGAGGAGCTGCCATAAACCCAGGACAAACAGACTATATTCATTTTGTATTCATTTTAATTA CATTGCCACGTATTAACCTTCTCTGCATGGCCAAAACCCCCAACAGCACAAAGCAGCTT GGGGTCGAAGTTCACCCCCTGCCTGCTCCTTCCTTGGGCTGTCCCCCCAAAGGCCTGTT TTGGGGACTCATTCCAGAAACTCGGGGGGGGGGACATGGAATTCCAAATCCTGCTCCAT TCTCCTTGCACAGGGCCACCCGTCGACTCCTCCATTCTGCACTCACATGTTTGTAGCAGT TCCACCTAGCAGGAGCCTGCCAACCATCAGTGGTATTATTTTATTTTATTTTTTAATTAAA AAAAATTTTTTTGGCTGCACCCATGGTGTGCAGAAGTTCCCGGGGCCAGGAAGTGAACT CAAGCCACGGCAGTAACAATGCTGGGTCCTTAACTGCTAGGCCACCAGGGAACTCCTAC ATTATTTTTTAAATTGTGATAAACGTGGAGTTCCCATTGTGGCTCAGCAGGTTAGGAACC CAGCTAGTATCCCTGAGGATGCGGGTCTGATCCCTGGCCTCACTCAGTGGGTTAAGGATC CAGCATTGCTGCAAGCTATGATGTAGGTTCGGATCTGGAGTTGCTGTGGCTATGGTGTAG GCTGGTACCTGTAGCTCAGTTTTGACCCCTAGCCTAGGAACCTCCATATGCCATGGTTTC AGCCCTAAAAAAAGAAAAGAAAAGAAAGGAAGGAGGTTACCAGACCAGGGATCAAAC TCATGCCCCTGCAGTGACACCACTGAATCCTTAATTACTAGGACACCAGGGAACTCCTAC ATTATTTTTTAAAATTGTGGTAAAATATATATGACCTAGGAGTTCCCGTCGTGGCTCAGTG GTTAATGAATCCGACTAGGAGCCATGAGGTTGCGGGTTCGATCCCTGGCCTTGCTTAGTG GGTTAAGGATCCGGCATTGCCGTGAGCTGTGATGTAGGTCGCAGGTGTGGCTCGGATCC CTCATTGCTGTGGCTCTGGCGCAGGCCGGTGGCTACGGCTCCAATTGGACCCCTAGCCT GGGAACCTCCATATGCCGCAGGAGCAGCCCAAGAAATC(SEQ ID NO:1)。

application of lncRNA-FUT3-AS1 AS a target point in preparing a reagent for improving resistance of pigs to escherichia coli or bacterial diarrhea.

Application of lncRNA-FUT3-AS1 AS a functional gene for improving pig bacterial diarrhea resistance.

The application of lncRNA-FUT3-AS1 in molecular breeding of piglets for resisting colibacillosis.

The application of silent IncRNA-FUT 3-AS1 substance or chemical drug taking IncRNA-FUT 3-AS1 AS a target to reduce the expression of FUT3 gene in preparing a reagent for improving the resistance of pigs to escherichia coli or bacterial diarrhea.

In the application, the lncRNA-FUT3-AS1 is used AS a target spot, and a gene silencing or knockout technology or a chemical drug is adopted to reduce the expression of the pig lncRNA-FUT3-AS1, improve the resistance of the pig to escherichia coli or bacterial diarrhea, or culture a piglet variety resisting escherichia coli diarrhea.

The reagent for improving the resistance of the pig to the Escherichia coli is a substance capable of interfering, inhibiting, silencing or knocking out lncRNA-FUT3-AS 1.

The substance for interfering, inhibiting, silencing or knocking out lncRNA-FUT3-AS1 gene comprises at least one of the following (1) to (3):

(1) an interference sequence against lncRNA-FUT3-AS 1;

(2) a transgenic cell line comprising lncRNA-FUT3-AS1 interference vector;

(3) a chemical drug which takes lncRNA-FUT3-AS1 AS a target spot to reduce the expression of lncRNA-FUT3-AS 1.

The interference sequence aiming at the lncRNA-FUT3-AS1 gene is any group of RNAi-1-4:

the preparation method of the lncRNA-FUT3-AS1 interfering cell line for interference comprises the following steps: designing a sense strand and an antisense strand of the designed interference sequence against IncRNA-FUT 3-AS 1;

the cell line containing the lncRNA-FUT3-AS1 sequence is obtained by transfecting a target cell IPEC-J2.

The invention has the beneficial effects that:

the invention detects the tissue expression profile of lncRNA-FUT3-AS1 on piglets and the expression difference between resistant and sensitive populations of escherichia coli by a qPCR technology, and detects the positioning and expression condition of FUT3 in the intestinal tissues of the resistant and sensitive populations by an Immunohistochemistry (IHC) technology; meanwhile, an F18 escherichia coli stimulation and lipopolysaccharide induction treatment porcine intestinal epithelial cell line (IPEC-J2) is used for detecting the expression levels of IncRNA-FUT 3-AS1 before and after treatment, and the expression rule of IncRNA-FUT 3-AS1 under the conditions of F18 escherichia coli infection and LPS induction is analyzed. Selecting the transfected cells with the highest efficiency for next functional verification, and comprehensively analyzing the influence of lncRNA-FUT3-AS1 silencing on the adhesion capability of the small intestine epithelial cells to F18 escherichia coli through bacterial counting, pilin gene quantification, indirect immunofluorescence and gram staining. The research systematically discusses the important function of lncRNA-FUT3-AS1 in the process of resisting F18 escherichia coli infection of piglets from mRNA, protein and cell level, so AS to determine that the lncRNA-FUT3-AS1 can be used AS an important resistance candidate functional gene for bacterial diarrhea, and provide scientific basis for later molecular breeding for resisting escherichia coli diarrhea of piglets in pig production.

Drawings

FIG. 1 results of fluorescence quantification of the tissues of duodenum of resistant and sensitive individuals using LncRNA-FUT3-AS1 (P <0.01 and P < 0.001);

FIG. 2 Northern blot results of duodenal tissues of resistant and sensitive individuals with IncRNA-FUT 3-AS 1;

FIG. 3 expression levels of IncRNA-FUT 3-AS1 after LPS induction of IPEC-J2 cells;

FIG. 4 shows the expression level of IncRNA-FUT 3-AS1 after the Escherichia coli is infected with IPEC-J2 cells;

FIG. 5 lncRNA-FUT3-AS1 interferes with the establishment of the IPEC-J2 cell line;

fig. 6 quantitative determination of pilin gene of bacterial adhesion (. about.p <0.05,. about.p <0.01,. about.p < 0.001);

FIG. 7 bacterial count results for bacterial adhesion (data unit 10)³CFU·mL^-1)；

FIG. 8 gram stain results (1000X) for bacterial adhesion;

FIG. 9 scanning electron microscope results (1000X) of bacterial adhesion;

FIG. 10 shows the results of indirect immunofluorescence of bacterial adhesion (100 ×) (the upper results are indirect immunofluorescence of bacterial adhesion after bacterial infection with F18ac, and the lower results are indirect immunofluorescence of bacterial adhesion after bacterial infection with F18 ab).

Detailed Description

1.1 test materials

The tested Sutai pigs are from the Sutai pig Escherichia coli F18 sensitive and resistant resource groups (Sutai pig breeding center in Suzhou city) established in the early stage of a subject group, 35-day-old Sutai weaned piglets of 5 families are selected and combined with a receptor binding test and a V-type secretion system development functional adhesin test method, and finally 5 heads of each of the F18 Escherichia coli sensitive and resistant weaned piglets are strictly screened^[136]. The Meishan pigs are from Meishan pig breed conservation Co., Ltd (Kunshan city, Jiangsu province), and 5 heads of Meishan pig F18 Escherichia coli sensitive and resistant individuals are obtained by comprehensive analysis of phenotype after virus attack, in-vitro adhesion test and the like^[137]. The piglet feeding environment is the same, the body weight and the body shape are similar, and the health condition is good. Collecting duodenum tissue samples of the piglets after slaughtering, storing the duodenum tissue samples in liquid nitrogen on site, and then transferring the piglets to a laboratory for freezing and storing at-70 ℃ for later use. The porcine small intestinal epithelial cell line (IPEC-J2) was preserved and cultured in this laboratory; coli strains F18ab, F18ac were given by professor Zhu nationality of veterinary college of Yangzhou university.

1.2 test reagents

DMEM/F12(1:1) medium, Opti-MEM medium, Trypsin-EDTA Solution, fetal bovine serum were purchased from Gibco BRL (USA); penicillin streptomycin mixed solution (100 ×), DAPI solution, crystal violet staining solution, and lugol iodine solution were purchased from Solarbio (beijing, china); LPS (Sigma, usa); lipofectaminene^TM3000 transfection reagent, 10 Xdenaturing gel buffer and northern Max^TMFormaldehydeload dye was purchased from Invitrogen corporation (usa); the RNAscope total RNA extraction kit, the blood/tissue/cell DNA extraction kit, the endotoxin-free plasmid small-extraction medium-amount kit, the lnRcute lncRNA cDNA first strand synthesis kit and the lnRcute lncRNA fluorescent quantitative detection kit are purchased from Tiangen biotechnology limited (Beijing, China); the AceQ qPCR SYBR Green Master Mix kit was purchased from Vazyme corporation (south kyo, china); [ alpha-³²P]CTP was purchased from Perkinelmer; the Riboprobe in vitro transcription marker system was purchased from Promega; coli antibodies from GeneTeX (usa); the secondary antibody anti-rabbitlgG was purchased from R&D Systems (usa); other enzymes such as T4 DNA ligase were purchased from New England Biolabs (NEB) Inc. (USA); reagents such as tryptone, yeast powder, sodium chloride, isopropyl alcohol, chloroform, absolute ethanol, DEPC water (diethyl pyrocarbonate), EDTA agarose, 10 XMOPS gel electrophoresis buffer, and 20 XSSC buffer were purchased from Shanghai Biotech engineering Co., Ltd.

1.3 sources and sequence characteristics of key IncRNA-FUT 3-AS1 for controlling Escherichia coli resistance

Subjects groups had previously performed IncRNA sequencing and transcriptome sequencing of E.coli resistant and sensitive individual duodenal tissues of Sutai pigs and Meishan pigs F18 (data have been presented at NCBI, BioProject ID: PRJNA476718, PRJNA476720, PRJNA476721, PRJNA476722), and previously performed intersection analysis of differentially expressed IncRNAs and mRNAs using Venny software (), and based on the prediction of target genes, 1 key IncRNA-FUT 3-AS1 was selected, on which basis genomic distribution and characteristic analysis of key IncRNA-FUT 3-AS1 was performed using IGV software.

1.4 primer design and Synthesis

2 siRNA interference sequences (silncRNA-FUT3-AS1-1 and silncRNA-FUT3-AS1-2) and 1 negative control sequence (NC) aiming at the lncRNA-FUT3-AS1 gene are designed by using Invitrogen RNAi Designer software according to the provided pig lncRNA-FUT3-AS1 gene sequence, wherein the siRNA sequences are shown in Table 1; in addition, mRNA sequences of ACTB genes (also called beta-actin) and lncRNA-FUT3-AS1 genes are used AS templates, real-time fluorescent quantitative PCR primers are designed, the ACTB genes are used AS reference genes, the length of the fragments of the fluorescent quantitative primers is 100-200 bp and the fluorescent quantitative primers are designed across exons, so that the pollution of genome DNA during amplification is avoided; meanwhile, DNA sequences of escherichia coli PILIN genes PILIN and beta-actin are used as templates to design fluorescent quantitative primers for bacterial adhesion quantitative detection, and cell genes beta-actin are used for homogenizing the bacterial PILIN genes PILIN. For the convenience of differentiation, the primer for quantitative detection of cDNA was labeled ACTB, and the primer for detection of adhered DNA sample was labeled beta-actin. All primers were synthesized by Biotechnology, Inc. (Shanghai). The specific information of the primers is shown in table 2.

TABLE 1 siRNAs sequences

TABLE 2 Real-time PCR primer information

1.5 Escherichia coli F18ab, F18ac thallus infection and LPS induced IPEC-J2 cell

1.5.1 cell Resuscitation

(1) Before the test, the ultra-clean bench is irradiated by ultraviolet for 30min, the water bath kettle is preheated to 37 ℃, and relevant test articles are prepared.

(2) Control cell storage note the IPEC-J2 cell cryopreservation tube was taken out of the liquid nitrogen tank, quickly immersed in warm water at 37 ℃ and quickly shaken to melt it as soon as possible, and completed within 2min as much as possible.

(3) Taking out the freezing tube after melting, and wiping the outer wall by using an alcohol cotton ball; placing in a centrifuge and centrifuging at 1000rpm for 5 min.

(4) Discarding the liquid, adding DMEM/F12 culture solution containing 10% fetal calf serum to resuspend the cell pellet, inoculating to cell cultureBottle, 5% CO at 37 ℃₂And (5) standing and culturing in an incubator.

(5) Observing the cell state in time the next day, and replacing the culture solution to continue culturing.

1.5.2 cell subculture

(1) When the cell density reached around 90%, the old medium was aspirated and washed 2 times with PBS.

(2) PBS is discarded, a proper amount of trypsin digestion solution is added dropwise, and digestion is carried out for 4min in an incubator at 37 ℃.

(3) Observing the digestion state of the cells under a microscope, adding fresh culture solution, blowing, beating and uniformly mixing to disperse the cells into single cells.

(4) The cell suspension is divided into 3 cell T25 culture bottles and added with proper amount of fresh culture medium, and the culture is kept still in an incubator at 37 ℃.

1.5.3 Escherichia coli infection IPEC-J2 cell

When the cells grow to 90%, the cells are digested and plated to a 6-well cell culture plate, and when the coverage rate reaches 80%, a bacterial infection test is carried out, and the bacteria need to be cultured 12 hours in advance. Respectively inoculating Escherichia coli F18ab and F18ac strains in LB liquid culture solution (1:1000), and culturing at 220rpm for 12 h; centrifuging at 4000rpm for 5min, collecting bacterial thallus precipitate, re-suspending the precipitate with PBS buffer solution, mixing, centrifuging, and washing repeatedly for 3 times; finally, the bacterial thallus sediment is diluted to 1.0 multiplied by 10 by DMEM/F12 culture solution⁹CFU·mL^-12mL of diluent (3 replicates per group) was added to each cell culture well, while a blank group of cells, i.e., cell culture medium alone, was set and cells were harvested after 4h stimulation.

1.5.4 LPS-induced stimulation of IPEC-J2 cells

LPS was diluted to 1. mu.g/mL with DMEM/F12 cell culture medium^-1Used for induction experiments. When the cells in the 6-well plate grow to 80%, 1mL of LPS diluent is added to the corresponding well for induction, and blank negative control groups containing only cell culture solution are set, wherein each group contains 3 parallel replicates. Finally, cells were collected 4, 8, and 12h after induction, respectively.

1.6 LncRNA interference assay

Transfection of LncRNA interference siRNA with stringent reference to lipofectamine^TM3000 instructions for transfection reagents, the specific steps are as follows:

(1) by ddH₂O dilution of interfering siRNA and Control (final concentration 20. mu. mol. L)^-1) And (4) uniformly mixing.

(2) Before transfection, cells are subcultured and plated on a 24-well plate, and cultured at 37 ℃ until the cells grow to 40% for siRNA transfection.

(3) Lipofectamine was diluted with 25. mu.L of Opti-MEM medium^TM3000 (1. mu.L), and thoroughly mixed with a pipette, and allowed to stand at room temperature for 5 min.

(4) Meanwhile, 1.25. mu.L of siRNA was diluted with 25. mu.L of Opti-MEM culture medium, mixed well, and allowed to stand at room temperature for 5 min.

(5) Then diluting the lipofectamine^TMAdding diluted siRNA (1:1) into a reagent 3000, lightly blowing, beating and mixing, and standing for 10-15 min at room temperature.

(6) Adding the mixed solution into corresponding cell culture holes, shaking uniformly, and placing into a carbon dioxide cell culture box at 37 ℃ for culture.

(7) The expression level of lncRNA-FUT3-AS1 was measured after 36 h.

1.7 extraction and quality detection of tissue and cell RNA

Total RNA of intestinal tissues, thallus infection and LPS induced cells of Sutai pigs and Meishan pigs and cells before and after lncRNA-FUT3-AS1 silencing are extracted strictly according to the kit instructions. The method comprises the following specific steps:

1.7.1 RNA extraction

(1) For tissues, 50-100 mg of tissue samples are put into a 5mL centrifuge tube, 1mL of lysis solution RZ is added into the centrifuge tube, the centrifuge tube is placed on ice, a German FLUKO homogenizer is used for tissue homogenization to ensure that the tissues are fully cracked, and then the tissue samples are quickly transferred into a precooled 1.5mL enzyme-free Ep tube; for cells, the collected cells were centrifuged to remove the supernatant, and 1mL of lysate RZ was added directly.

(2) The tissue homogenate was allowed to stand at room temperature for 5min to completely separate the complexes formed between the nucleic acids and the proteins. Add 200. mu.L chloroform, vortex for 15s, centrifuge at 12000rpm for 10min at 4 ℃ for 3min at room temperature, transfer the aqueous phase to a new enzyme-free tube.

(3) 0.5 volume of absolute ethanol was added, the mixture was mixed by inversion, and the mixture was transferred to an adsorption column CR3 and centrifuged at 12000rpm at 4 ℃ for 30 seconds.

(4) mu.L of deproteinized solution RD was added to the column, and the mixture was centrifuged at 12000rpm at 4 ℃ for 30 seconds, and the waste liquid was discarded.

(5) Add 500. mu.L of the washing solution RW to the column, let stand at room temperature for 2min, centrifuge at 12000rpm at 4 ℃ for 30s, discard the waste solution, and repeat this step once.

(6) The column was placed in a collection tube and centrifuged at 12000rpm at 4 ℃ for 2min to remove the liquid remaining before.

(7) The adsorption column was put into a new centrifuge tube, and 30. mu.L of RNase-Free ddH was added thereto₂And O, standing at room temperature for 2min, and centrifuging at 12000rpm at 4 ℃ for 2 min.

1.7.2 RNA quality testing

(1) The concentration of RNA was measured using a NanoDrop1000 instrument. The ratio of A260/A280 is 1.7-2.1, which preliminarily shows that the purity of the extracted RNA is high, and the RNA can be used for carrying out the next experiment.

(2) A 1.2% formaldehyde agarose gel was prepared for RNA purity: dissolving 0.6g agarose in 36mL sterilized water, heating with middle fire in microwave oven for 2min, and taking out; and when the temperature of the solution is reduced to about 55 ℃, adding 5mL of 10 XMOPS electrophoresis buffer solution and 9mL of deionized formamide, mixing uniformly, pouring the gel, and standing at room temperature until the gel is finished for later use.

(3) Configuring an RNA denaturation reaction system for loading: 2. mu.L of 10 XMOPS electrophoresis buffer, 10. mu.L of deionized formamide, 3.6. mu.L of 37% formaldehyde, 4.4. mu.L of RNA and 0.2. mu.L of EB.

(4) Placing the RNA denaturation mixed reaction system at 65 ℃ for incubation for 10min, placing the sample on ice for cooling for 10min, and then slightly throwing the centrifugal tube to settle the liquid at the bottom.

(5) Add 10 Xformaldehyde gel loading buffer 2.5. mu.L, flick and mix well.

(6) An appropriate volume of 1 XMOPS buffer was added to the RNA electrophoresis tank, and the above electrophoresis gel was placed in the buffer and pre-electrophoresed for 5 min. And (3) uniformly mixing the RNA denaturation system solution, and then completely adding the mixture into the gel hole by using a pipette gun.

(7) After 40min at 50V, the RNA bands were carefully observed under UV light.

1.8 reverse transcription of RNA and fluorescent quantitative PCR detection

Carrying out reverse transcription on the RNA obtained in the last step, and then carrying out fluorescent quantitative PCR detection on lncRNA-FUT3-AS1 to detect the expression level of lncRNA-FUT3-AS1 in intestinal tissues, thallus infection and LPS induced cells of Sutai pigs and Meishan pigs and cells before and after lncRNA-FUT3-AS1 silencing, and specifically comprising the following steps:

1.8.1 reverse transcription

Taking tissue and cell RNA as a template, and strictly performing cDNA synthesis according to the experimental steps of the first strand cDNA synthesis kit of the lnRcute lncRNA. Configuring a genome DNA removal reaction system, wherein each 10 μ L system contains 5 XgRNA Buffer 2 μ L, the total RNA amount should not exceed 2000ng, and finally adding RNase-free ddH₂O is complemented to 10 mu L; after mixing, the mixture was centrifuged briefly and incubated at 42 ℃ for 3 min. Configuring reverse transcription system, adding 10 XlnR RT Buffer 2. mu.L, lnR RT Enzyme Mix 2. mu.L, lnR RT Primer Mix 2. mu.L and RNase-free ddH into the above mixed system₂O5 mu L; the reverse transcription procedure was 42 ℃ for 15min, 95 ℃ for 3min, ice cooling and the cDNA obtained was used for subsequent experiments or cryo-preservation.

1.8.2 fluorescent quantitative PCR detection

20 mul of real-time fluorescent quantitative PCR amplification system: cDNA (100-500 ng) 1. mu.L, upstream and downstream primers (10. mu. mol. L)^-1) 0.5. mu.L each, 50 XROX Reference Dye 2. mu.L, 2 XlnR lncRNA Premix 10. mu.L, ddH₂O6. mu.L. The PCR amplification procedure was as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 5s, annealing and extension at 60 ℃ for 32s, and 40 cycles; and (3) performing melting curve analysis after the amplification is completed, wherein the program comprises the following steps: 95 ℃ for 15s and 60 ℃ for 1 min; 95 ℃ for 15s, 60 ℃ for 15 s. Has a temperature T of (85 +/-0.8) DEG C according to a melting curve_mAnd (3) judging the specificity of the primers according to the amplified specificity, carrying out repeated detection on each sample to be detected for 3 times, and taking an average value.

1.9 Northern blot detection

Extracting total RNA from IPEC-J2 cells for Northern hybridization test, and detecting the RNA expression level of lncRNA-FUT3-AS1 in intestinal tissues of Sutai pigs and Meishan pigs. The method comprises the following specific steps:

(1) preparing denatured glue: adding 1g of agarose into 90mL of enzyme-free water, heating and melting by a microwave oven, adding 10 Xdenatured gel buffer solution 10mL when the temperature is reduced to 55 ℃, uniformly mixing, and preparing the gel. After the gel is completely solidified, placing the gel in a 1 XMOPS gel electrophoresis buffer solution for pre-electrophoresis for 5 min.

(2) Preparing a sample: mu.L (20. mu.g) of total RNA sample was taken and northern Max added^TMFormaddehydeload dye 15. mu.L, incubated at 65 ℃ for 15min and rapidly iced for 5 min. EB is added into the mixed system to a final concentration of 10-50 mug.mL^-1For viewing during electrophoresis (which may be omitted).

(3) Electrophoresis: carefully load the sample at 5V cm^-1Carrying out electrophoresis; after electrophoresis, the gel block was removed, placed under an ultraviolet lamp to observe the integrity of the RNA, and the position of each band (distance from the well) was recorded.

(4) Film transfer: shearing a nylon membrane with proper size, soaking the nylon membrane in DEPC water, and placing the nylon membrane in 20 times SSC for 1 hour; the gel blocks were also soaked 2 times in 20 XSSC (15 min each). Putting the organic glass plate on a large baking dish as a platform, putting a piece of filter paper on the organic glass plate, and pouring 20 XSSC into the baking dish to ensure that the liquid level is slightly lower than the platform; then the inverted gel (surrounded by Parafilm), soaked nylon membrane, 2 pieces of wet filter paper, a stack of (5-6 cm thick) paper towels and glass were placed on top in the order from bottom to top, no air bubbles were noticed between each layer, and finally a weight was placed against the glass plate. After the transfer of the membrane lasted for 12h, the membrane was placed in 6 XSSC for 5min and then vacuum-dried at 80 ℃ for 30 min. The baked film is sealed and stored at 4 ℃ for later use.

(5) Labeling a probe: cloning of a DNA sequence (nt 2693-3635) specific to lncRNA-FUT3-AS1 into pcDNA4/my-chi B vector using [. alpha. -³²P]The CTP and RiboProbe in vitro transcription labeling system produced a radioactive RNA probe of 942 nt in length. A probe sequence primer: lncRNA-FUT3-AS 1-F: GATAGAGCCCAATTTCTTACTCT, lncRNA-FUT3-AS 1-R: CAGCAACCGTTTCTTGAATACCT are provided.

(6) And (3) hybridization: soaking the membrane in 2 XSSC at room temperature for 15 min; discarding the liquid, adding 5mL of prehybridization liquid, and prehybridization for 3h in a shaking table at 42 ℃; the labeled probe is denatured at 100 ℃ for 5min, cooled on ice for 4min, added to the prehybridization solution, and hybridized at 42 ℃ for 16 h.

(7) Washing the membrane: discarding the hybridization solution, adding 2 XSSC/0.1% SDS, washing at room temperature for 15min, adding 0.2 XSSC/0.1% SDS, washing at 55 deg.C for 2 times, each time for 15 min.

(8) Tabletting: rinsing the membrane with double distilled water, and absorbing water on the membrane by using filter paper; placing the film in a dark box, covering an X-ray film in the dark room, placing the dark box in an autoradiography at-70 ℃ for about 5 days, and recording the result after the autoradiography is finished.

1.10 measurement of adhesion Capacity between Escherichia coli and porcine Small intestine epithelial cell

1.10.1 bacteria counting method for detecting adhesion of Escherichia coli to cells

The above 3 groups of cells and blank cells were each 5.0X 10⁵A hole^-1The cells were plated on 12-well cell culture plates and cultured until the cell coverage reached about 90%. Respectively inoculating the E.coli strains F18ab and F18ac to LB liquid culture solution, culturing at 37 ℃ with a shaker at 220rpm for 12h, centrifuging at 4000rpm for 5min to collect bacterial thallus precipitates, resuspending the precipitates with PBS buffer solution, centrifuging, and repeatedly washing for 3 times. The cell pellet was diluted to 1.0X 10 with DMEM/F12 cell culture medium⁹CFU·mL^-11.0mL of bacterial dilution was added to the cell culture wells, 3 replicates each, 5% CO at 37 ℃₂Incubate for 2 h. The wells were aspirated and washed 3 times with PBS buffer. Immediately treating the cells with 0.5% Triton X-100 (prepared with ultrapure water) solution for 20min, collecting bacterial suspension by blowing with a pipette, diluting the bacterial suspension by 10 times gradient, spreading on LB solid plate, and culturing at 37 deg.C overnight. Finally, the plate coated with 1000 times of the bacterial dilution solution was subjected to bacterial counting, and the colony count on the plate was counted using Image J software to determine the final adhered bacterial count (CFU. mL)^-1) It is equal to the number of colonies on the plate X10³。

1.10.2 method for detecting adhesion of Escherichia coli to cells by pilin gene quantification method

The procedure for adhering bacteria is the same as 1.10.1, after PBS washing, 200 mu L of DNA extraction lysate is added into the culture hole, and cell and bacteria are extracted strictly according to the test procedure of the DNA extraction kitTotal DNA. The extracted mixed DNA is used as an amplification template, and relative quantitative analysis is carried out through fluorescent quantitative PCR detection, wherein 3 replicates are arranged in each sample. Real-time fluorescent quantitative PCR amplification system 10. mu.L: DNA 100-500 ng, upstream and downstream primers (10. mu. mol. L)^-1) 0.2. mu.L each, 50 × ROX Reference Dye I0.2. mu.L, 2 × AceQTM qPCR SYBR Green Master Mix 5. mu.L, ddH₂Make up to 10. mu.L of O. The PCR amplification procedure was as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 34s, and 40 cycles; and (3) performing melting curve analysis after the amplification is completed, wherein the program comprises the following steps: 95 ℃ for 15s and 60 ℃ for 1 min; 95 ℃ for 15s, 60 ℃ for 15 s. And (3) judging the specificity of the primers according to the specificity of the melting curve with (85 +/-0.8) DEG C Tm amplification, carrying out repeated detection on each sample to be detected for 3 times, and averaging.

1.10.3 Observation of adhesion of Escherichia coli to cells by Indirect immunofluorescence

When the indirect immunofluorescence method is used for detection, a sterile cell slide is required to be added into a hole before bacteria are adhered, and the test is carried out when the density is close to 90%. After rinsing gently with PBS buffer for 3 times, a suitable amount of 4% paraformaldehyde was added and fixed in refrigerator formaldehyde at 4 ℃ for 20 min. Washing with PBS buffer solution for 5min for 3 times; performing membrane rupture treatment for 10min by using 1% Trtion X-100; carefully wash 3 times with PBS buffer for 5 minutes each time; sucking the waste liquid, adding a blocking liquid (containing 5% BSA) and blocking for 1h at 37 ℃; adding primary anti-E.coli antibody (concentration of 1:50, prepared with PBS containing 5% FBS), incubating at 37 deg.C for 2h, and refrigerating at 4 deg.C overnight; the primary antibody was aspirated the next day, carefully washed 3 times with PBS buffer, 5min each time; adding a red fluorescence-labeled secondary antibody (concentration of 1:200, prepared by using 5% FBS PBS) and incubating for 1h at 37 ℃ in the dark (from the beginning of the step, so the operation is careful to the operation in the dark); antibody was aspirated off, carefully washed 3 times 5min each with PBST buffer; DAPI solution (1 mg. mL) was added^-1) Staining the core, and incubating at 37 ℃ for 5 min; carefully wash 3 times with PBST buffer for 5min each time; the mounting is carried out by using an anti-fluorescence quenching mounting agent, and the observation is carried out under a confocal microscope as soon as possible.

1.10.4 gram microscopic method for observing adhesion of Escherichia coli to cells

After the bacteria adhered for 2 hours, the cells were gently washed 3 times with PBS buffer to remove the non-adhered bacteria. Adding crystal violet staining solution for primary dyeing for 1min, quickly washing with water, spin-drying, adding Lugol iodine solution for mordant dyeing for 1min, washing with water, decolorizing with 95% alcohol (about 0.5min) until the added solution has no color, and adding modified carbolic acid reddening diluent for counterdyeing for 0.5 min. And (5) washing, drying, naturally drying, and observing the adhesion condition of bacteria under a microscope.

1.10.5 observing adhesion condition of Escherichia coli to cells by scanning electron microscope

The cells were plated (15 mm cell slide in 6-well or 12-well plates) and E.coli infection was carried out until 80% of the length was reached. After the cells were infected with E.coli, the cells were gently washed 3 times with sterile PBS buffer to remove non-adherent bacteria. Adding 1mL of 2.5% glutaraldehyde solution into each hole to completely immerse a monolayer of cells, and standing for 1h at the aseptic temperature of 4 ℃ to fix the cells; washing the fixed sample with PBS for 3 times, each time at 4 deg.C for 10 min; the sample was sequentially placed at concentrations of 30%, 50%, 70%, 80%, 90%, 95%, 100% and 100% (with anhydrous Na added)₂SO₄) The rest time of each gradient is 10min, the first three gradients are carried out at 4 ℃, and 80% of the gradients are carried out at room temperature; immersing the sample into 1mL of tertiary butanol after dehydration, covering the sample, standing the sample in a28 ℃ incubator for 15min, and repeating the step for 3 times to ensure that the tertiary butanol permeates into the sample; adding 1mL of tert-butyl alcohol into each hole, capping, and cooling in a refrigerator at 4 ℃ for 25 min; directly placing 6-hole cell plate into a vacuum drier after removing the cover, and continuously vacuumizing for 30 min; and adhering the silicon chip and the sample supporting plate by using a double-sided adhesive tape with conductivity, and detecting by using a scanning electron microscope after spraying gold.

1.11 data processing and analysis

By using 2^-ΔΔCtThe method treats relatively quantitative results and uses an internal reference gene to homogenize the expression level. The following formula is applied: delta CT (average Ct value of target gene in test group-average Ct value of reference gene in test group) - (average Ct value of target gene in control group-average Ct value of reference gene in control group). Comparison of differences in Gene expression of IncRNA-FUT 3-AS1 among Sutai resistant susceptible populations Using independent sample T test of SPSS 16.0 softwareAnd analyzing the expression difference of the lncRNA-FUT3-AS1 gene of the cell before and after interference and the adhesion of the bacteria before and after interference by using a General Linear Model (GLM) of SPSS 16.0 software before and after the bacteria infect the cell, different induction time of LPS, and the cell before and after the interference.

Results and analysis

2.1 LncRNA-FUT3-AS1 screening and sequence characterization

The early stage of the subject group is based on lncRNA sequencing and mRNA sequencing between duodenum of Sutai pigs and Meishan pigs, intersection analysis is carried out on lncRNA and mRNA which are differentially expressed by two varieties, and 3 common differentially expressed lncRNA and 46 common differentially expressed mRNA are screened out. Combined with target gene prediction, 1 key antisense long-chain non-coding RNA-TCONS _00183659 was found on chromosome 2 of pig (Sus scrofa): 73642050 and 73663391, and located on the antisense strand of the target gene FUT3, they were named lncRNA-FUT3-AS1 according to the current universal naming principle, and were used AS lncRNA molecules for the focus of the study.

2.2 differential expression of LncRNA-FUT3-AS1 in duodenal tissues of E.coli resistant and sensitive weaned piglets

The fluorescent quantitative result shows that the mRNA transcription level of the IncRNA-FUT 3-AS1 in duodenum of Meishan sensitive piglets is very higher than that of the resistant type (P <0.01), and the transcription level of the IncRNA-FUT 3-AS1 in duodenum of Sutai sensitive piglets is also very higher than that of the resistant type (P <0.01) (figure 1); northern blot further verified that the expression level of lncRNA-FUT3-AS1 of the sensitive piglet is obviously higher than that of the resistant piglet (figure 2).

2.3 expression changes of lncRNA-FUT3-AS1 after LPS induction and thallus infection of IPEC-J2 cells

Fluorescence quantification results show that compared with blank control cells, the expression of the cells is not significantly changed after 4h of LPS induction, and is extremely significantly increased after 8h (P <0.01), and begins to decrease after 12h, but is still extremely different from the blank cells (P <0.01) (FIG. 3); after the F18ab and F18ac escherichia coli are infected, the expression of IncRNA-FUT 3-AS1 is remarkably up-regulated (P <0.01) (figure 4).

2.4 establishment of LncRNA-FUT3-AS1 interfering IPEC-J2 cell line

The cell observed fluorescence 24h after lncRNA-FUT3-AS1 interfering siRNA was transfected into IPEC-J2 cells, indicating that the interfering siRNA has been transfected into the cell to exert its interfering effect. The expression level of lncRNA-FUT3-AS1 is detected quantitatively by fluorescence, and the result shows that the expression level of lncRNA-FUT3-AS1 in a siFUT3-AS1-1 group is 0.32 relative to a blank group, namely the interference efficiency reaches 68%, which indicates that an IPEC-J2 cell line interfering with lncRNA-FUT3-AS1 is successfully established (figure 5).

2.5 Effect of interfering IncRNA-FUT 3-AS1 on the adhesion ability of Escherichia coli and IPEC-J2 cells

In order to investigate the influence of the expression level of lncRNA-FUT3-AS1 on the in vitro adhesion capacity of escherichia coli, a series of detections such AS pilin gene fluorescence quantification (fig. 6), bacterial counting (fig. 7), gram staining (fig. 8), scanning electron microscopy (fig. 9) and indirect immunofluorescence observation (fig. 10) are respectively carried out in the research, and the results show that compared with a control group, after lncRNA-FUT3-AS1 expression silencing, the pilin gene expression level is remarkably or extremely remarkably reduced (P <0.05 or P <0.01), and the F18 escherichia coli number adhered to the lncRNA-FUT3-AS1 silencing group is extremely remarkably reduced (P < 0.01); meanwhile, the gram staining, scanning electron microscope and indirect immunofluorescence observation results show that the capacities of F18 escherichia coli and IPEC-J2 cells are obviously reduced.

Sequence listing

<110> Yangzhou university

<120> lncRNA marker related to piglet bacterial diarrhea and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 2

<211> 5833

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttcctgaaca ttccagaacc ttctggagct gggggaaagg ggatgctgtc tggagaaggc 60

caagggagac tgagttggaa gtggagtttc tctgaggctc agaggggaat aggaactctc 120

cttggcccct agccacctgg gtcaacatca ggagatgcca gggcaagcac catccctgca 180

ccccgatcat cttcccattt gctcctcatc gcacgtgtgg tttgtatggt ttgttcctca 240

cccactccag gctgggggca ggggtgccct ccttttgagc cacaagctgt cagctgcccc 300

ttggctcaca gcccaaggcc ccaggggaaa gcagtttcca gcgggctggc agctccatca 360

cccaccagcc caagctgagc aaggccctgg ggtctgaccc aggcagagac cccagcggca 420

ggggaggtgc agatgcccca cgtcgcccca cacgctggtt ccagctcatc ccaagcctga 480

gggcggggtc cccagggtcc cccactctag gccttgggat caaccccttt ctagggagtc 540

aggaaatctc ttggctccct ctggtttggg gcgggggatt cctctgcccc agaaaggctg 600

aaccccagag gctggtggtg gattctggtg cacatccagg aggtctcggt tcagatcctg 660

attccctcca cccccgaccc cccgctccac ttcccagctg tgagaagcag gtgaaactgt 720

caataaaatc tgaaataaaa ttgtagacag aataggtggt ttgaggccat aaaactaaat 780

gatgggaggg acagtggcag gaagcctcct gaaggtggtg gctctctgag aaggaggatt 840

gtgaaggtgg gggaggggat cactgcgtga ggtcagggtc agctctgcca ggggtggtct 900

caggtggagc aggagctcgc ttggccagtc caggggggct ttggatggat aggaggtgac 960

ctgtatccct gttacacata tgggttcctt tttttgtttg ttttggcggt gcttgtggca 1020

tagggaagtt ctggggcaag ggagcaaacc ggagccacag ccctgagagt gccggttcct 1080

taacccactg agccacagtg ggaactccac acctgggttt catttccagt ccctgtgaag 1140

tgacaggatt tgctggaggg gtgtgggtgg gcagagtgtt ggtgatcaag aaccccaaat 1200

gccccctatg aactccactc atcagcttcc ccttctctgc aattggggtc atagctcggg 1260

atcagggctc agcctggggt cattcggggg ctggcttgag gtcggggttc cacctggcta 1320

cagtttctga ccccggaaac accattgctg aggtcagccg ggtcatccag cctcccgttg 1380

ccctgtgggg ccaagttcag gctcgtgaga ggctcaggca ggccaggttg cacgattggc 1440

gtctggaaag atccctctca gtgagccgca cctagctgcc tctgccccag cccacatcct 1500

acccatgacc tggtgacaga tggctagaac tcccagggaa tggaggggtc gtggagtcct 1560

gaagcgccgc agatgtgtgt gtggaccccc tggggatgca cccccacccc cgcccatccc 1620

ccacacagtg gcaagagggt ctgggccggg ccaaagcagg tggagaggga cagcatgggg 1680

tgggggggct ctggctgcgg gcccagccca tcaggatctg acagacagag gcctcctgga 1740

accttcctgc cccccttggt tcccctgaag catctcaaag ggggattctt ttttgtttgg 1800

ttggtttggt ttggtttggg ttttttgttt ttttgggttt tttggctacg cccaaagcag 1860

gaggaagttc ccaggccagg gatggagccc acgccacagc agtgataaca ccagatcctt 1920

aacccactga gccaccaggg actcctcaaa gtggtttttt gggttttttt gtctttttgc 1980

cttttctggg gctgctccca cagtatatgg aggttcccag gctaggggtc taatcagagt 2040

tgtagctgcc ggcctatgtc agagccacag caacacagga tccaagccac atctgtgacc 2100

tgcaccacag ctcatggcaa cgccggatcc ttaacccact gagcaaggtc agggatcgaa 2160

cccacaacct catggttcct agtcggattt gttaaccacg gagacacgac aggaactcct 2220

ctcaaagtgg tatttaacag agaatccttc cacagctgaa ccatcctgct tggcccctcc 2280

ccttgttggg gagctcattc cctctagaga cagtaaagga cactcccaca agggccagca 2340

caggccctgt attatatggg gggcgcaggg ggactgaggc tgccagaagg gccatccctc 2400

tcctcatatc cctctgtgag taaaaggcaa gactgatggc ctggtggtta ggacttggcg 2460

ctttcaccac tgcaccctgg gttcaatccc tagtctggga actgagatcc catatcaagc 2520

ttctgtaggc tgcagccaaa aaaaaaaaaa aaaaagaaag aaaaaaggca ggatcagagt 2580

cccaacccga cacacttaca gacagaggag gcacaaactt tgatcacaag tgtggtaggc 2640

agtgccctcc aggccttcac gggagaccgg ctttggggtt ttaaatcctg gagatagagc 2700

ccaatttctt actctctctt ccgaactctt gtgccctccc ggcttttctg tcctcatggg 2760

gctgtcagca cagcagagga agtgacagtg tgtccagagc tgcactggga aacaccaggc 2820

agctatggga gccagaggag ggatctgatc tggtgcaggg gatgggagga atccagggag 2880

gctccctgga ggaggtgcct ggcctgagct ctgtgggatg actagggatt aacaagtggg 2940

ggagtgggga ggcacagggt gttcctggca gagcagcttt gtgtagtgga gaccccttca 3000

tgcccttgag attctgaacg accctctggg tctcagtttt catggcaggg tggctatggg 3060

aaggctgaag gcctggaact aaccggatgc tctgatggtt aatgtccagg cagcgtgaag 3120

tagcctcatc tggggacagg ggagtcgtgg tacctgggag gtggacctcg ggctttggcc 3180

cgcctgcagt agccccctcc ttcccagctt ccgtgcctct gccctgctct ggaagcttcc 3240

cagggctccc tgtcactctt gtattgaata gccatccctg accacagcca gacacagctc 3300

agtgaggctg acctcatctg ctgctcacga acacccagcc ttactggctt tcctccactg 3360

ccggattcct tgctgcctcc gggcctttgc acaggctgtc ccttctgcct ggaaagctct 3420

tgcctcctcc tttttcctta gagaattctt atgaggcttt agctcccaga tcatacatcc 3480

aggaagtcca gaccaggcca caacctcctc aatttttgca aattataatt tatgtttgtt 3540

tataagcttc cttacgggtt attggtctca cccacttgct tcctgcaata tccctggggc 3600

ctgacacgta gcaggtattc aagaaacggt tgctgagacg gaacaaggag gtggaatctg 3660

ctgggagtga aggtggggag cttgaaattc tgctcactgg ccccttcgca ccctccaagg 3720

aacccctggt gcccccatgg aaaccacttt gagaaccagg ggcttgggtc agccctttcg 3780

ctttctggat gggtcaactt tacgcccaga gccatataag ccttggggcc atggggtggt 3840

gactccagcc cccagcttcc tccaccctct ccctcctcag gtcgtatggt gattagggga 3900

gtctcacctt tgcttgtgga tgatggcctg gctcatggga caggacacct tgcgtcacct 3960

aatggcaggt gcgggggttg ggctgagccg tgctgcagct ataggcacat ttccttctcc 4020

tcccccggtg tcgccttatc catacccagg gagactgtgc ctcctaaact tcctggtcag 4080

ccactcactg ccgcacacga acgctgcccc ctaggtaagg cctcgggggc ggggggggca 4140

ggggatgtac cctctcccag aaggcgtggg tgccccctgg gaagagcctt tgggctgcac 4200

tcccaggggt ctttctgggt acccagcgca ccagagtggg atgtttgggt tgatttggga 4260

aaccaggagg gatagcgttt ctctccctgt gtcttccatc tccacccccc acccccccac 4320

ccccccaccc tcatcttttc ctctcctttg ctccctcttt ctccctctct catccctctc 4380

tcccaccctc catttccttc ttccccccat ctctctctct ctgatgaagt tttggatgag 4440

aacccccact gctcctgtgc ccccatcagc acccccagag ccgctcttcc ttcctgaccc 4500

atctcatgga aaaaaaggac ctgggatgct gcgggcaagg tggggggcga tgtttggatt 4560

ttcttatctt tgtggtgtcc cagcatagtg gcattttaaa aagttccttt ctaggaagaa 4620

acatcctggg ttcaaatcag tgggatctca gccgtagcct cccaaacctg tcccccaggc 4680

tgtgctcttc acggtcactg tcaggggccc ccatgcctcc taggaggagc tgccataaac 4740

ccaggacaaa cagactatat tcattttgta ttcattttaa ttacattgcc acgtattaac 4800

cttctctgca tggccaaaac ccccaacagc acaaagcagc ttggggtcga agttcacccc 4860

ctgcctgctc cttccttggg ctgtcccccc aaaggcctgt tttggggact cattccagaa 4920

actcgggggg ggggacatgg aattccaaat cctgctccat tctccttgca cagggccacc 4980

cgtcgactcc tccattctgc actcacatgt ttgtagcagt tccacctagc aggagcctgc 5040

caaccatcag tggtattatt ttattttatt ttttaattaa aaaaaatttt tttggctgca 5100

cccatggtgt gcagaagttc ccggggccag gaagtgaact caagccacgg cagtaacaat 5160

gctgggtcct taactgctag gccaccaggg aactcctaca ttatttttta aattgtgata 5220

aacgtggagt tcccattgtg gctcagcagg ttaggaaccc agctagtatc cctgaggatg 5280

cgggtctgat ccctggcctc actcagtggg ttaaggatcc agcattgctg caagctatga 5340

tgtaggttcg gatctggagt tgctgtggct atggtgtagg ctggtacctg tagctcagtt 5400

ttgaccccta gcctaggaac ctccatatgc catggtttca gccctaaaaa aagaaaagaa 5460

aagaaaggaa ggaggttacc agaccaggga tcaaactcat gcccctgcag tgacaccact 5520

gaatccttaa ttactaggac accagggaac tcctacatta ttttttaaaa ttgtggtaaa 5580

atatatatga cctaggagtt cccgtcgtgg ctcagtggtt aatgaatccg actaggagcc 5640

atgaggttgc gggttcgatc cctggccttg cttagtgggt taaggatccg gcattgccgt 5700

gagctgtgat gtaggtcgca ggtgtggctc ggatccctca ttgctgtggc tctggcgcag 5760

gccggtggct acggctccaa ttggacccct agcctgggaa cctccatatg ccgcaggagc 5820

agcccaagaa atc 5833

<210> 2

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cccugugaag ugacaggaut t 21

<210> 3

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

auccugucac uucacagggt t 21

<210> 4

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcuagaacuc ccagggaaut t 21

<210> 5

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

auucccuggg aguucuagct t 21

<210> 6

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

uucuccgaac gugucacgut t 21

<210> 7

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acgugacacg uucggagaat t 21

Claims

lncRNA-FUT3-AS1, with the sequence of SEQ ID NO. 1.
2. Use of lncRNA-FUT3-AS1 of claim 1 AS a target for the preparation of an agent for increasing resistance of swine to e.
3. The lncRNA-FUT3-AS1 of claim 1, for use AS a functional gene for increasing resistance to bacterial diarrhea in swine.
4. The lncRNA-FUT3-AS1 of claim 1, for use in molecular breeding of piglets against e.
5. Use of a substance that interferes with, inhibits, silences or knockdown incrna-FUT 3-AS1 of claim 1 or a chemical that reduces the expression of the FUT3 gene using incrna-FUT 3-AS1 of claim 1 AS a target for the preparation of a reagent for increasing resistance of a pig to escherichia coli or bacterial diarrhea.
6. Use according to any one of claims 2 to 4, wherein: the lncRNA-FUT3-AS1 gene is used AS a target spot, the gene interference technology is adopted to reduce the expression of the pig lncRNA-FUT3-AS1, or a chemical drug is adopted to inhibit the expression of the pig lncRNA-FUT3-AS1, so that the resistance of piglets to escherichia coli or bacterial diarrhea is improved, or piglet varieties resisting escherichia coli diarrhea are bred.
7. Use according to claim 2, characterized in that: the agent for improving the resistance of the pig to escherichia coli or bacterial diarrhea comprises a substance capable of interfering, inhibiting, silencing or knocking lncRNA-FUT3-AS 1.
8. An agent that interferes with, inhibits, silences or knockdown the lncRNA-FUT3-AS1 of claim 1,

it contains at least one of the following (1) to (3):

(1) an interference sequence against lncRNA-FUT3-AS 1;

(2) a transgenic cell line comprising lncRNA-FUT3-AS1 interference vector;

(3) a chemical drug which takes lncRNA-FUT3-AS1 AS a target spot to reduce the expression of lncRNA-FUT3-AS 1.
9. The agent for interfering, inhibiting, silencing or knocking out lncRNA-FUT3-AS1 of claim 8, wherein the interference sequence for lncRNA-FUT3-AS1 is any one of RNAi-1-4:

name (R) oligo sequence (5 '→ 3') silncRNA-FUT3-AS1-1F CCCUGUGAAGUGACAGGAUTT silncRNA-FUT3-AS1-1R AUCCUGUCACUUCACAGGGTT silncRNA-FUT3-AS1-2F GCUAGAACUCCCAGGGAAUTT silncRNA-FUT3-AS1-2R AUUCCCUGGGAGUUCUAGCTT NC-F UUCUCCGAACGUGUCACGUTT NC-R ACGUGACACGUUCGGAGAATT

。
10. The substance for interfering, suppressing, silencing or knocking out lncRNA-FUT3-AS1 gene of claim 8, wherein the method for preparing the interfering cell line of lncRNA-FUT3-AS1 for interference comprises: designing a sense strand and an antisense strand of the designed interference sequence against IncRNA-FUT 3-AS 1;

the cell line containing the lncRNA-FUT3-AS1 sequence is obtained by transfecting a target cell IPEC-J2.