CN106754609A - One plant is attenuated the engineered strain of producing rhamnolipid with high yield and its builds and application - Google Patents

One plant is attenuated the engineered strain of producing rhamnolipid with high yield and its builds and application Download PDF

Info

Publication number
CN106754609A
CN106754609A CN201710172680.9A CN201710172680A CN106754609A CN 106754609 A CN106754609 A CN 106754609A CN 201710172680 A CN201710172680 A CN 201710172680A CN 106754609 A CN106754609 A CN 106754609A
Authority
CN
China
Prior art keywords
rhamnolipid
pseudomonas aeruginosa
gene
rhlab
esta
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710172680.9A
Other languages
Chinese (zh)
Inventor
张友明
尹佳
符军
姜婵娟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SUZHOU RESEARCH INSTITUTE SHANDONG UNIVERSITY
Shandong University
Original Assignee
SUZHOU RESEARCH INSTITUTE SHANDONG UNIVERSITY
Shandong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SUZHOU RESEARCH INSTITUTE SHANDONG UNIVERSITY, Shandong University filed Critical SUZHOU RESEARCH INSTITUTE SHANDONG UNIVERSITY
Priority to CN201710172680.9A priority Critical patent/CN106754609A/en
Publication of CN106754609A publication Critical patent/CN106754609A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C12N9/1092—3-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/78—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Pseudomonas
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1081—Glycosyltransferases (2.4) transferring other glycosyl groups (2.4.99)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/01019—3-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of restructuring Pseudomonas aeruginosa engineering bacteria for being attenuated producing rhamnolipid with high yield, PAO1aroA is named as, is the gene aroA (phosphate synthase of 5 enolpyruvyl phthalein shikimic acid 3) of aromatic amino acid synthesis have been knocked out in its genome and has contained the pseudomonas aeruginosa (Pseudomas aeruginosa) of overexpression plasmid pBBR1 oriT rhlAB estA genta；The engineering bacteria is, by one section of resistance gene DNA fragment of the short homology arm of carrying, to be incorporated into the chromosome of pseudomonas aeruginosa, and the aromatic amino acid synthesis related gene aroA in Pseudomonas aeruginosa is knocked out, and builds attenuated strain；Broad spectrum type replicon pBBRI over-express vectors are built again, increase the copy number of key gene EstA and RhlAB in rhamnolipid biological synthesis, obtain producing rhamnolipid with high yield attenuated strain, the bacterial strain may be directly applied to industrial production of rhamnolipid, its yield fully achieves industrial requirement, has broad application prospects.

Description

One plant is attenuated the engineered strain of producing rhamnolipid with high yield and its builds and application
Technical field
The invention belongs to biological technical field, and in particular to one plant of engineered strain and its structure of attenuation producing rhamnolipid with high yield With application.
Background technology
Rhamnolipid is a kind of biosurfactant produced by pseudomonad or Burkholderia class, is also search time A kind of most long, application technology biosurfactant the most ripe.Its all naturally occurring in soil, water body and plant, category In a kind of anion surfactant of glycolipid class, methyl alcohol, chloroform and ether are not only soluble in, shown in alkaline aqueous solution yet Good dissolution characteristics.It has good chemistry and biological nature concurrently, amphipathic with oil, water, can reduce water surface tension, Can be used as wetting agent, emulsifying agent and foaming agent, nontoxic, energy is biodegradable, and extreme shape is in temperature, pH value and salinity Also be can be used under condition.
At present, it is industrial main using pseudomonas aeruginosa (Pseudomonas aeruginosa) fermentation method production sandlwood Glycolipid, and pseudomonas aeruginosa is considered as three kinds of most one of strong man's class conditioned pathogens, therefore limit it in the industrial production Extensive use.Based on this, it is intended that the comparatively safe industrial microorganism of Selection utilization carries out the production of rhamnolipid, to drop Low its potential hazard aborning, expands the range of application of Related product.That has reported for work utilizes Burkholderia The unconditional pathogenic bacteria such as Burkholderia, Pseudomonas chlororaphis Pseudomonas chlororaphis produce rhamnolipid, But because these microorganism hereditary backgrounds are relatively unintelligible and lack easy hereditary behaviour's technology, it is difficult to further improve rhamnose The yield of fat, it is impossible to meet production requirement.People also attempt selection non-pathogenic microorganism such as Escherichia coli by heterogenous expression come Rhamnolipid, and Escherichia coli are produced as a kind of model organism of " it is generally acknowledged that safety (GRAS) ", though have clearly lose Background, ripe Genetic Manipulative Technology and extensive commercial Application are passed, is that heterologous synthesis rhamnolipid is suitably selected, but its Yield does not reach industrial requirement much but.By literature search, about the aromatic series by knocking out pseudomonas aeruginosa Amino acid synthesis related gene 5- enolpyruvyl phthalein shikimic acid -3- phosphate synthase genes aroA realizes attenuation, and this is attenuated Bacterium rhamnolipid synthesis related gene is building up to from esterase gene EstA and rhamnosyltransferase Complex Gene RhlAB is transported On one multicopy plasmid with pBBRI as replicon, increase the copy number of rhamnolipid synthesis related gene, realize increasing mouse The document or patent of Lee's glycolipid yield have not been reported.
The content of the invention
High toxicity or low yield for current rhamnolipid industrialized production bacterial strain, it is an object of the invention to provide one The engineered strain of strain attenuation producing rhamnolipid with high yield --- restructuring Pseudomonas aeruginosa engineering bacteria and its structure and application.
The restructuring Pseudomonas aeruginosa engineering bacteria of attenuation producing rhamnolipid with high yield of the present invention, it is characterised in that：The engineering bacteria is Knocked out in its genome aromatic amino acid synthesis gene aroA (5- enolpyruvyl phthalein shikimic acid -3- phosphate synthases) and Pseudomonas aeruginosa (Pseudomas containing overexpression plasmid pBBR1-oriT-rhlAB-estA-genta Aeruginosa), it is named as PAO1aroA；Wherein, the core of the overexpression plasmid pBBR1-oriT-rhlAB-estA-genta Nucleotide sequence is as shown in SEQ ID No.1.
The construction method of the restructuring Pseudomonas aeruginosa engineering bacteria of attenuation producing rhamnolipid with high yield of the present invention, step is：
The homologous recombination system built using the recombinase of pseudomonad bacteriophage, the carrying of one section of 50bp-100bp is short The resistance gene DNA fragment of homology arm is incorporated on the chromosome of pseudomonas aeruginosa (Pseudomas aeruginosa), real The gene aroA (5- enolpyruvyl phthalein shikimic acid -3- phosphate synthases) of aromatic amino acid synthesis is now knocked out, attenuation copper is obtained Green pseudomonad, then build transhipment esterase gene EstA and rhamnosyltransferase Complex Gene comprising rhamnolipid synthesis RhlAB, gentamicin resistance gene, engagement transfer initiation site oriT and an overexpression matter of broad spectrum type replicon pBBRI Grain pBBR1-oriT-rhlAB-estA-genta, and the overexpression plasmid is transferred in the attenuated pseudomonas aeruginosa of acquisition, i.e., Obtain by multicopy plasmid increase the bacterium rhamnolipid synthesis related gene copy number realize attenuation producing rhamnolipid with high yield Restructuring Pseudomonas aeruginosa engineering bacteria.
The restructuring Pseudomonas aeruginosa engineering bacteria of attenuation producing rhamnolipid with high yield of the present invention is in industrial production of rhamnolipid Application.
The rhamnolipid that the present invention builds is attenuated the pseudomonas aeruginosa strains of high yield, and it can not only improve rhamnolipid Yield, and less toxic.Experiment is confirmed：By knocking out pseudomonas aeruginosa PAO1 (Pseudomas aeruginosa PAO1 after aromatic amino acid synthesis related gene 5- enolpyruvyl phthalein shikimic acid -3- phosphate synthase genes aroA), mutation Strain toxicity detection proves that the bacterium has been attenuated.Meanwhile, the attenuation bacterium rhamnolipid synthesis related gene is transported esterase by the present invention certainly Gene EstA and rhamnosyltransferase Complex Gene RhlAB are building up to a multicopy plasmid with pBBRI as replicon On, so as to increase the copy number of rhamnolipid synthesis related gene, it is finally reached the purpose for increasing rhamnolipid yield.This side Method is also applied for the raising of other bacterium secondary metabolism yield, with very important application value.
The pseudomonas aeruginosa strains of the rhamnolipid attenuation high yield that the present invention builds may be directly applied to industrial metaplasia Rhamnolipid is produced, its yield fully achieves industrial requirement, has broad application prospects.
Brief description of the drawings
The aroA gene knockouts of the efficient homologous recombination system mediations of Fig. 1.
(A) aroA gene knockouts schematic diagram；The celebrating for carrying homology arm and site differential recombination enzyme recognition site (LoxM) is big After mycin resistant gene replaces aroA genes, then inductive site specificity recombinase cre enzymes are big by the celebrating between loxM sites Mycin resistant gene is knocked out.
(B) recon after bacterium colony PCR detections gene knockout, M:DL5000marker；1,2：Gentamicin resistance gene Replace aroA genes, the PCR fragment of amplification, size 1073bp.Primer is aroA-chk-5 and aroA-chk-3.
(C) recon after the restructuring of bacterium colony PCR detection cre locus specificities, M：DL5000；1：The PAO1 conducts of wild type Template amplification size 675bp, 2：The PAO1 that gentamicin gene substituted for after aroA is 1257bp as template amplification size, 3：PAO1 after Cre enzymes knockout gentamicin resistance gene is used as template, amplification size 438bp.Primer used is aroA- Chk-5 and aroA-chk-3.
The growth curve of Fig. 2 wild strains and mutant strain is determined and toxicity detection.
(A) growth curve of PAO1 wild strains and PAO1 mutant strains is determined.In OD600Under conditions of determine thalline concentration. Red line represents PAO1 wild strains, and blue line represents PAO1 mutant strains.Result shows that wild-type strain enters for 2 hours after switching Exponential phase of growth, but saltant needs that exponential phase of growth could be entered in 5 hours after switching.
(B) PAO1 wild strains and PAO1 mutant strain toxicity detections：Blue line represents PAO1 mutant strains, as a result shows mouse Survival rate is 100%.That red line is represented is the PAO1 of wild type, the 9th hour, mouse after wild type PAO1 has been injected Survival rate be 0, mouse is all dead.
The structure of Fig. 3 rhamnolipid high-yield strains.
(A) schematic diagram of pR6K-TnpA-oriT-EstA-RhlAB-Genta-loxM is built.
(B) pR6K-TnpA-oriT-EstA-RhlAB-Genta-lox plasmids PVUII cleavage maps；M：DL5000；1-20 is 20 recons.Wherein 1,3,4,8,9,10,11,16,17,18,20 is correct clone.
(C) pBBRI-EstA-RhlAB-loxM-genta-oriT plasmid figures.
(D) pBBRI-EstA-RhlAB-loxM-genta-oriT plasmids PVUII cleavage maps；M:DL5000；1-10 is 10 Individual recon, wherein 1,2,3,6,7,9,10 is correct clone.
The measure of Fig. 4 rhamnolipid yield.
(A) the rhamnolipid determination of yield of different time points.
(B) rhamnose standard curve：The sandlwood sugar juice of various concentrations is prepared, OD values is determined under 421nm, with rhamnose Concentration is abscissa, and OD values are ordinate, draw standard curve, and the yield of real rhamnolipid should be the 3 of sandlwood candy output Times.
(C) standard curve drawn according to data in (B), we substitute into second day value of four plants of OD421 of bacterium in (A) In the formula for obtaining, the yield of rhamnolipid in second day four plants of bacterium has been calculated.
Fig. 5 rhamnolipid emulsification experiment result photos：The toluene of equal volume and the supernatant of thalline zymotic fluid are blended in one In individual test tube, it is vortexed and mixes, then stands 2 hours.
Wherein：(A) PAO1 mutant strains (pBBR1-rhlAB-estA)；(B) PAO1 mutant strains (pBBR1-genta-kan)； (C) PAO1 wild strains (pBBR1-rhlAB-genta-estA)；(D) PAO1 wild strains (pBBR1-genta-kan).
Fig. 6 .pBBR1-rhlAB-genta-estA plasmid stabilities are detected：Show the continuous six days bars in non-resistant screening Cultivated under part, exogenous plasmid is not lost.
Specific embodiment
It is below instantiation, to more fully understand the present invention.
General explanation：2x PrimerSTAR Max involved by following example, are purchased from the precious biological limited public affairs of TaKaRa Department；Recombinase expression plasmid pBBRI-rha-redgam-BAS-kan is purchased from German GeneBridges companies；Cre expression of enzymes matter Grain pCM157 is purchased from addgene (preserving numbers：Plasmid 45863)；PR6K-TnpA-oriT-kan is purchased from Germany GeneBridges companies；PRK2013-kan is purchased from German DSMZ (preserving numbers：DSM 5599).Operation is fully according to respective description Book is carried out.Gene sequencing is completed by Huada gene company in plasmid construction.Set out bacterium pseudomonas aeruginosa PAO1 (Pseudomas Aeruginosa PAO1) it is purchased from German DSMZ (preserving numbers：DSM 1707)；PAO1 genes are shown in that the genome delivered in NCBI is complete Sequence；Alg44-genta is the pseudomonas aeruginosa PAO1 that gentamicin resistance gene substituted for Alg44 genes；DH10B is purchased from German GeneBridges companies；HB101 is purchased from German DSMZ (preserving numbers：DSM 6201).Other plasmids are by electric conversion side Method is transferred in recipient bacterium.Other reagents and consumptive material are purchased from domestic each Reagent Company.Other experimental techniques and reagent in embodiment Unless otherwise specified, this area conventional method and commercial reagent are.
Embodiment 1：The structure of attenuated pseudomonas aeruginosa PAO1 (Pseudomas aeruginosa PAO1)
1. the gene constructed attenuated strains of aroA are knocked out
The 5- enolpyruvyl phthalein shikimic acid -3- phosphate synthases of aroA gene codes can be catalyzed the conjunction of aromatic amino acid Into.Aromatic amino acid biosynthesis pathway is Gram-negative bacteria and the total approach of positive bacteria, and mammal does not possess After the route of synthesis, therefore knockout aroA genes, PAO1 mutant strains will not infect mammal.Using efficient homologous recombination System, genetic manipulation is carried out to Pseudomonas aeruginosa PAO1 chromosomes, and its principle is：It is big using the celebrating for carrying homology arm and LoxM sites Mycin resistant gene DNA fragmentation is by aroA gene knockouts, and aroA gene knockout processes are as shown in Figure 1.
The present invention is first rotated into Pseudomonas aeruginosa recombinase expression plasmid pBBRI-rha-redgam-BAS-kan electricity In PAO1 bacterial strains, aroA genes are knocked out (Figure 1A).
Electric step of converting is：By PAO1 in added with the LB of 100 μ g/ml ampicillins 37 DEG C of overnight incubation (OD600= 3~4).40 μ l overnight cultures (OD600=3~4) are transferred in the 1.3ml LB added with suitable antibiotic, are placed in Upper 37 DEG C of Eppendorf thermomixer, 950rpm cultivate 2h (OD600=0.35~0.4).It is collected by centrifugation cell, 9, 400g 30sec,2℃.Supernatant is abandoned, precipitation is suspended with 1ml GH Buffer (10% sucrose, 2mM Hepes).It is collected by centrifugation thin Born of the same parents, 9,400g 30sec, 2 DEG C.Supernatant is abandoned, precipitation is suspended with 1ml GH Buffer.Repeated centrifugation, it is resuspended, be centrifuged again, use 20 μ L 1ml GH Buffer suspension cells.2 μ l pBBRI-rha-redgam-BAS-kan plasmids are added, by the mixed of cell and plasmid Close liquid to be transferred in 1mm electric shock cups, shocked by electricity with Eppendorf electroporator 2510, voltage 1350V, the μ of electric capacity 10 F, the Ω of resistance 600.Plus 1ml LB are in electric shock cup, washed cell simultaneously transfers them to the 1.5ml pipes for pricking hole, is placed in Upper 37 DEG C of Eppendorf thermomixer, 950rpm cultivate 1.5h.Finally appropriate bacterium solution is applied to added with suitable antibiosis On the LB flat boards of plain (350 μ g/ml kanamycins), 37 DEG C of incubated overnights.
AroA gene knockout detailed processes are as follows：
PCR amplifications carry homology arm (≈ 75bp) and the celebrating in locus specificity recombinase Cre recognition site LoxM sites is big Mycin resistant gene.
The primer is：
aroA-genta-loxM-3：
cacccgcggcgtagagcccggcgagcaacaggcaggacttcacctgggcgctggccatcggcatgtcgtaatgcaAG CTGAATTACATTCCCAA CCG；
aroA-genta-loxM-5：
caagtcgatttcccatcgctcgatcatgctcggctccctggccgaaggcaccaccgaagtggagggcttcctcgaCA ACTTAAATGTGAAAGTGGGTC
(in primer lowercase be homology arm, this and describe such afterwards).
Then in PCR primer being rotated into the PAO1 of expression recombinase by electricity, under the mediation of recombinase, carry homologous There is homologous recombination in the gentamicin resistance gene of arm, replace on genome with aroA genes on Pseudomonas aeruginosa strains body AroA genes.Then according to the primers aroA-chk-5 on the outside of homology arm：CCTGATTTATCTGGCCCAGC； aroA-chk-3：GCGCTCAACTTGTGCCCGG, the single bacterium colony screened to gentamicin carries out bacterium colony PCR detections (figure 1B).During Cre expression plasmid pCM157 electricity rotated into the correct clone of bacterium colony PCR identifications, 1 μ l IPTG (100mg/ml) are added After inductive site specificity recombinase Cre, under the mediation of Cre, gentamicin resistance gene is deleted from chromosome, picking without Anti- clone carries out bacterium colony PCR identifications (Fig. 1 C).Bacterium colony PCR specific practices are as follows：
PCR amplification system:System 50l
PCR programs：98 DEG C of predegeneration 4min；94 DEG C of denaturation 15s；52-60 DEG C of (being set according to primer Tm) annealing 15s； 72 DEG C extend (extension of time is according to the length determination for being expanded, 1Kb/5s)；Circulation 30 times；Last 72 DEG C, 10min.Tested Primer used is aroA-chk-5 and aroA-chk-3 in journey.Template is the bacterium solution shaken, and bacterium solution can be clearly visible muddiness, Twice of the aseptic washings of 100 μ l 1000ml are then taken out, culture medium is cleaned.Then boiling water boiling 15min is used.Cooling can work as template Use.
2. mutant strain toxicity detection
The growth curve of the PAOI and wild strain PAO1 that knock out aroA deletion mutants is determined respectively：Above-mentioned bacterial strains are existed 37 DEG C in 1300 μ l LB culture mediums, incubated overnight in 950rpm, every plant of bacterium sets three parallel groups.Taken from overnight bacterium within second day Go out 100 μ l bacterium solutions, plus 900 μ l LB dilute 10 times of measure cell concentrations.Two kinds of overnight bacterium unifications are diluted to OD600=0.085, Then OD is determined every two hours600, thalline is measured always and is in stablize growth period.The final sum for determining to knock out aroA genes The growth curve of wild-type P bacillus PAO1.
Result display wild-type strain enters exponential phase of growth for 2 hours after switching, but saltant needs turning Could enter within 5 hours exponential phase of growth (Fig. 2A) after connecing.
After two plants of growth curves of bacterium are determined, we have carried out toxicity detection to wild strain and mutant strain.
Toxicity test BALB/c mouse is purchased from medical college of Shandong University, and 6-8 week old, aseptic condition are raised.With PBS to PAO1 After wild strain and mutant strain are washed, respectively by two kinds of bacterium according to 5 × 108The dosage injection mouse peritoneal of CFU, each experiment 20 mouse of group.After injection in preceding 12 hours, a Survival for mouse is observed every 1 hour.
The experiment mice that can be seen that injection PAO1 wild strains by lab diagram 2B begins with dead mouse in the 5th hour, Death rate highest in 5-6 hours after injection.In the 9th hour, the mouse for injecting PAO1 wild strains is all dead, and injects Still all survivals after 240 hours after the mouse injection of PAO1 mutant strains.It is demonstrated experimentally that the PAO1 for knocking out aroA genes has subtracted Poison.
The structure of the rhamnolipid high-yield strain of embodiment 2
1. the structure of rhamnolipid high-yield strain
Confirm that mutant strain has succeeded on basis of attenuation in experiment, the rhamnolipid for further improving the mutant strain for building is produced Amount.It is specific the process for building again of mutant strain is described in detail with reference to Fig. 3.
Pass through quadruple recombination to construct plasmid pR6K-TnpA-oriT-EstA-RhlAB-Genta-loxM (Fig. 3 A) first：
By pR6K-TnpA-oriT-kan NcoI and MscI double digestions, alcohol precipitation is standby；
Then with RhlAB-5：ttaagacccactttcacatttaagttgcaattgTCAGGACGCAGCCTTCAGCCATC G and RhlAB-3：tcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacctagGCCTTTTCCGC CAACCCCTCGCTG is primer, and PAO1 genomes are template, are expanded by PCR and obtain RhlAB fragments；With RABE-Genta-3： cgatggctgaaggctgcgtcctgacaattgCAACTTAAATGT GAAAGTGGGTCTTAA；RABE-Genta-5： GgtatagccgggaatcagtatctagAGCTGAATTACATTCCCAACCG is primer, and template is that (celebrating is big for Alg44-genta Mycin resistant gene substituted for the Pseudomonas aeruginosa PAO1 of Alg44 genes) genome, amplification obtain RABE-Genta fragments；With EstA-5：cgtaaattcactggccgtcgttttacaacgtcgtgactgggaaactcgaggtaccGTTTCAGAAGTCCAG GCTCAG and EstA-3：CggttgggaatgtaattcagctctagaTACTGATTCCCGGCTATACC is primer, PAO1 genes Group is template, and amplification obtains EstA fragments；The GBdir- that 4 product cotransformations that finally 4 steps above are obtained enter after induction In gyrA462-pir116 bacteriums, product pR6K-TnpA-oriT-EstA-RhlAB-Genta-loxM (Fig. 3 B) is obtained.
Three parent's engagement transfers are carried out after plasmid pR6K-TnpA-oriT-EstA-RhlAB-Genta-loxM is built： First by donor bacterium DH10B (pR6K-TnpA-oriT-EstA-RhlAB-Genta-loxM), bacterium HB101 (pRK2013- are aided in Kan 40 μ l are taken) and respectively after recipient bacterium (PAO1 mutant strains) incubated overnight to be inoculated into 1.3ml LB resistance culture bases, is shaken in 37 DEG C Swing culture 2 hours.Then every kind of culture takes 1ml centrifugations, abandons supernatant, and precipitation is resuspended in 300 μ l fresh LBs.Respectively take The 50 μ resuspended things of l bacteriums, after being mixed in EP pipes, drop in LB-plate centers, dry, and 37 DEG C of incubation 4h are then transferred into 37 DEG C Overnight incubation in constant incubator.A ring bacterium is scraped with oese within second day be coated on PMM (gentamicin 30ug/ml) flat board To there is single bacterium colony, finally choosing monoclonal carries out bacterium colony PCR identifications for upper 37 DEG C of cultures.But correct clone is not identified, Plasmid has been changed a replicon again for we：Expand on pR6K-TnpA-oriT-EstA-RhlAB-Genta-loxM respectively OriT also have pBBRI replicons, digestion obtains EstA-RhlAB-Genta.Triple recombination to construct plasmid pBBRI-EstA- RhlAB-loxM-genta-oriT (Fig. 3 C and 3D).Specific practice：NheI and EcoRI digestions pR6K-TnpA-oriT-EstA- RhlAB-Genta-loxM obtains EstA-RhlAB-Genta, and (large fragment is reclaimed in digestion, and glue goes to bottom and cuts glue, glue reclaim tool again Body way is with reference to Tiangeng kit specification).oriT-ha-3：tttcccagtcacgacgttgtaaaacgacggccagtg AatttacgtagcatgcCTTTTCCGCTGCATAACCCT and oriT-ha-5： CcccgaaaagtgccacctgggatgaCATATGCGGCCAG CCTCGCAGAGCAGGATTC are primer, pR6K-TnpA- OriT-loxM-Genta-ladA is template, expands oriT.pBBRI-ha-5： GcggccggcggggaacagcgaggggttggcggaaaaggcctagggaattcCTACCG GCGCGGCAGCGTGA and pBBRI-ha-3:Gaat cctgctctgcgaggctggccgcatatgTCATCCCAGGTGGCACTTTTCGGGG are primer, matter Grain pBBRI-rha-redgam-BAS-kan is template amplification pBBRI.Three fragments that will be previously obtained are in GB05-dir (transformations RecE, recT, red γ and recA genes of arabinose induction are incorporated from GB2005, chromosome) to do three heavy for the inside Group, gentamicin resistance (4 μ g/ml) screening, obtains pBBRI-EstA-genta-RhlAB-oriT.
Then during electricity rotates into PAO1 mutant strains, the rhamnolipid biological increased by multicopy plasmid in PAO1 mutant strains is closed Into the copy number of middle related gene, the purpose for increasing rhamnolipid yield is reached.
2. rhamnolipid determination of yield
The attenuation PAO1 of rhamnolipid synthesis related gene will be increased first in LB culture mediums (low salt, 1% Triptone；0.5%yeast extract；Culture, obtains seed liquor in 0.1%NaCl).Then 1：20 transfer into MS fermentations Culture medium (perL:15g NaNO3；1.1g KCl；1.1g NaCl；0.00028g FeSO4·7H2O；3.4g KH2PO4；4.4g K2HPO4；0.5g MgSO4·7H2O；0.5g yeast extract and 5mL of a trace element solution containing(per L):0.29g ZnSO4·7H2O；0.24g CaCl2·4H2O；0.25g CuSO4·5H2O and 0.17g MnSO4·H2O), three kinds of aromatic amino acids, phenylalanine, tryptophan and tyrosine are with the addition of in fermentation medium (each 50 μ g/ml).In the case where non-resistant is screened, 2 experimental groups and 2 parallel groups are set, experimental group is PAO1 mutant strains (pBBR1-rhlAB-genta-estA) and PAO1 wild strains (pBBR1-rhlAB-genta-estA), control group is PAO1 mutation Strain (pBBRI-genta-kan) and PAO1 wild strains (pBBRI-genta-kan).Fermentation 6 days, takes out 1ml zymotic fluids and comes daily Rhamnolipid is extracted, the rhamnolipid yield highest time is determined.Ferment to second day four plants of bacterium OD421Value in six days all Highest, and PAO1 mutant strains (pBBRI-rhlAB-genta-estA) rhamnolipid yield highest (Fig. 4 A).
The concentration of rhamnose is calculated according to rhamnose standard curve, the concentration conversion of rhamnolipid is rhamnose in zymotic fluid 3 times of concentration.The OD that second day is surveyed421Value bring into the formula of obtained standard curve (Fig. 4 B), calculate second day PAO1 mutant strains (pBBRI-rhlAB-genta-estA), PAO1 mutant strains (pBBRI-genta-kan), PAO1 wild strains (pBBRI-rhlAB-genta-estA), the yield (Fig. 4 C) of the rhamnolipid of PAO1 wild strains (pBBRI-genta-kan).
3. rhamnolipid emulsification experiment
Compare after the rhamnolipid yield that four plants of bacterium are fermented six days, the toluene emulsification for further having done rhamnolipid is real Test.
PAO1 mutant strains (pBBRI-rhlAB-genta-estA), the PAO1 mutant strains (pBBRI- that 37 DEG C have been fermented 2 days Genta-kan), PAO1 wild strains (pBBRI-rhlAB-genta-estA) and PAO1 wild strains (pBBRI-genta-kan) Four plants of bacterium respectively take out 3ml zymotic fluids, and then centrifuging and taking supernatant is vortexed with the toluene of same volume and mixes, then stand observation in 2 hours Four plants of emulsification situations (Fig. 5) of fermented liquid supernatant.
PAO1 (pBBR1-rhlAB-genta-estA) rhamnolipid of aroA gene knockouts is may further determine that by Fig. 5 Yield significantly be increased than the Pseudomonas aeruginosa PAO1 of wild type.
4. exogenous plasmid Detection of Stability
Above-mentioned experiment has confirmed that PAO1 mutant strains increase copying for rhamnolipid biological synthesis related gene by plasmid Shellfish number, can significantly improve rhamnolipid yield.We are in the case where non-resistant is screened to the saltant type containing exogenous plasmid Bacterial strain is cultivated, and further determines that the stability of exogenous plasmid.
Specific practice：0.1ml zymocyte liquids are taken out daily applies LB's and LB gentamicin resistances (20 g/ml) to dilute Plate, it is continuous to apply 6 days, determine the loss situation of plasmid after zymotic fluid culture six days, as a result show exogenous plasmid pBBR1-rhlAB- EstA can be with middle stable existence (Fig. 5) in saltant.Confirmation has successfully constructed one plant of attenuation of producing rhamnolipid with high yield Restructuring Pseudomonas aeruginosa engineering bacteria (Pseudomas aeruginosa) PAO1.The bacterium preferably can produce work in rhamnolipid It is commonly used in industry.
Sequence table
<110>Shandong University
<120>One plant is attenuated the engineered strain of producing rhamnolipid with high yield and its builds and application
<141> 2017-3-10
<160> 1
<210> 1
<211> 8781
<212> DNA
<213>Artificial sequence
<221>Overexpression plasmid pBBR1-oriT-rhlAB-estA-genta
<222>（1）…（8781）
<400>1
ctaccggcgc ggcagcgtga cccgtgtcgg cggctccaac ggctcgccat cgtccagaaa 60
acacggctca tcgggcatcg gcaggcgctg ctgcccgcgc cgttcccatt cctccgtttc 120
ggtcaaggct ggcaggtctg gttccatgcc cggaatgccg ggctggctgg gcggctcctc 180
gccggggccg gtcggtagtt gctgctcgcc cggatacagg gtcgggatgc ggcgcaggtc 240
gccatgcccc aacagcgatt cgtcctggtc gtcgtgatca accaccacgg cggcactgaa 300
caccgacagg cgcaactggt cgcggggctg gccccacgcc acgcggtcat tgaccacgta 360
ggccgacacg gtgccggggc cgttgagctt cacgacggag atccagcgct cggccaccaa 420
gtccttgact gcgtattgga ccgtccgcaa agaacgtccg atgagcttgg aaagtgtctt 480
ctggctgacc accacggcgt tctggtggcc catctgcgcc acgaggtgat gcagcagcat 540
tgccgccgtg ggtttcctcg caataagccc ggcccacgcc tcatgcgctt tgcgttccgt 600
ttgcacccag tgaccgggct tgttcttggc ttgaatgccg atttctctgg actgcgtggc 660
catgcttatc tccatgcggt agggtgccgc acggttgcgg caccatgcgc aatcagctgc 720
aacttttcgg cagcgcgaca acaattatgc gttgcgtaaa agtggcagtc aattacagat 780
tttctttaac ctacgcaatg agctattgcg gggggtgccg caatgagctg ttgcgtaccc 840
ccctttttta agttgttgat ttttaagtct ttcgcatttc gccctatatc tagttctttg 900
gtgcccaaag aagggcaccc ctgcggggtt cccccacgcc ttcggcgcgg ctccccctcc 960
ggcaaaaagt ggcccctccg gggcttgttg atcgactgcg cggccttcgg ccttgcccaa 1020
ggtggcgctg cccccttgga acccccgcac tcgccgccgt gaggctcggg gggcaggcgg 1080
gcgggcttcg ccttcgactg cccccactcg cataggcttg ggtcgttcca ggcgcgtcaa 1140
ggccaagccg ctgcgcggtc gctgcgcgag ccttgacccg ccttccactt ggtgtccaac 1200
cggcaagcga agcgcgcagg ccgcaggccg gaggcttttc cccagagaaa attaaaaaaa 1260
ttgatggggc aaggccgcag gccgcgcagt tggagccggt gggtatgtgg tcgaaggctg 1320
ggtagccggt gggcaatccc tgtggtcaag ctcgtgggca ggcgcagcct gtccatcagc 1380
ttgtccagca gggttgtcca cgggccgagc gaagcgagcc agccggtggc cgctcgcggc 1440
catcgtccac atatccacgg gctggcaagg gagcgcagcg accgcgcagg gcgaagcccg 1500
gagagcaagc ccgtagggcg ccgcagccgc cgtaggcggt cacgactttg cgaagcaaag 1560
tctagtgagt atactcaagc attgagtggc ccgccggagg caccgccttg cgctgccccc 1620
gtcgagccgg ttggacacca aaagggaggg gcaggcatgg cggcatacgc gatcatgcga 1680
tgcaagaagc tggcgaaaat gggcaacgtg gcggccagtc tcaagcacgc ctaccgcgag 1740
cgcgagacgc ccaacgctga cgccagcagg acgccagaga acgagcactg ggcggccagc 1800
agcaccgatg aagcgatggg ccgactgcgc gagttgctgc cagagaagcg gcgcaaggac 1860
gctgtgttgg cggtcgagta cgtcatgacg gccagcccgg aatggtggaa gtcggccagc 1920
caagaacagc aggcggcgtt cttcgagaag gcgcacaagt ggctggcgga caagtacggg 1980
gcggatcgca tcgtgacggc cagcatccac cgtgacgaaa ccagcccgca catgaccgcg 2040
ttcgtggtgc cgctgacgca ggacggcagg ctgtcggcca aggagttcat cggcaacaaa 2100
gcgcagatga cccgcgacca gaccacgttt gcggccgctg tggccgatct agggctgcaa 2160
cggggcatcg agggcagcaa ggcacgtcac acgcgcattc aggcgttcta cgaggccctg 2220
gagcggccac cagtgggcca cgtcaccatc agcccgcaag cggtcgagcc acgcgcctat 2280
gcaccgcagg gattggccga aaagctggga atctcaaagc gcgttgagac gccggaagcc 2340
gtggccgacc ggctgacaaa agcggttcgg caggggtatg agcctgccct acaggccgcc 2400
gcaggagcgc gtgagatgcg caagaaggcc gatcaagccc aagagacggc ccgagacctt 2460
cgggagcgcc tgaagcccgt tctggacgcc ctggggccgt tgaatcggga tatgcaggcc 2520
aaggccgccg cgatcatcaa ggccgtgggc gaaaagctgc tgacggaaca gcgggaagtc 2580
cagcgccaga aacaggccca gcgccagcag gaacgcgggc gcgcacattt ccccgaaaag 2640
tgccacctgg gatgacatat gcggccagcc tcgcagagca ggattcccgt tgagcaccgc 2700
caggtgcgaa taagggacag tgaagaagga acacccgctc gcgggtgggc ctacttcacc 2760
tatcctgccc gggtcgacgc cgttggatac accaaggaaa gtctacacga accctttggc 2820
aaaatcctgt atatcgtgcg aaaaaggatg gatataccga aaaaatcgct ataatgaccc 2880
cgaagcaggg ttatgcagcg gaaaaggcat gctacgtaaa ttcactggcc gtcgttttac 2940
aacgtcgtga ctgggaaact cgaggtaccg tttcagaagt ccaggctcag cgccaggctg 3000
acgctctgct gggtatcgtc ctcgcccttg cgccagttgt agccgccgcg cagcgacagc 3060
tccggcgcca gcttctggct gaagccgagt gagacgcggt tgagatggtc ctgcggggtg 3120
tagccttcga gggtgaagcg attgcccggc aggctgttga gggacatggt caggtcctgg 3180
gtgtcgtcct cgtactcacg ttcgtgggcg tactcggcga acagctgggt atcgctgccg 3240
aacgcgtact tgccttgcag gccggcgccc aggcgcttcg agctgcgctt ctggtcgtcg 3300
tagtcgagcg cggtggcgct ggcgcccttc tcggaatagc cgtcgacctc gacccgtgca 3360
tagtcggcgc tgacgaacgg cgacaggtgc cagggactgt cggcctgctg ggcgatgtcg 3420
tagcccaggc gcgcgctgaa cgcccacagg tggccgttgg tgtcgccttt ctcgctgcgc 3480
tcgccgccgc ccagggcgaa cttgcgcttc aggtcgtcgt agtcgaggta gccgccggtc 3540
aacgccgcgt cggcccacca gcggttttcc tggtactgca cgaaggcgct ggccatgtag 3600
ctgttcatcc ggtagtcgga atccttggcg ccggcttcca gcttctgccg gtagaaaccg 3660
gcggcgaccc cggcgcgcca ggcctcgtcg atgcggtagc tgccaccaag ggtcaggttg 3720
tagccgttgc cgtcgccgct ggcggcgctg tcctgggagt cgaagtccag gcgctggcca 3780
ccgccgccga cgaagccgcg ccactggccg acgttctgcc agttctccca gtccgcctgc 3840
cactggctgc gcagttcgtc ctggtaggca cgcagggtgc cgtgggccat ttccggcagc 3900
agggtcagct cccagggcgc cgacagcagc gaataggtgt agtcggcgat caggcgctgg 3960
ccggtgatgg tcgggtgcac gctgtcgttg aacagcaatt tgctcgggtc gggcgtgctg 4020
ccgttgatcc cgtaggtcgg gttcatggtg cagccgttgc cgctgaaaca ggtgccgatc 4080
aggttctggt cggcggccag gccgaaggaa gccgggttgg ccatgccttc cttgagcagc 4140
agcgggatgt tcaacggaat gacgttggcg ccggcctggc tcaactgggc ggtcagctcg 4200
gcgttgaacg tgccgctgag ttggctggcg aaaggctgca agggaccacc gaaggtagcc 4260
ggggtcaggc ccaggtcggg caacagccag accacgatgt agcgcgcgcc ggcctgctgc 4320
agggcctgca cgctatccac caggcgaccg gcggcctgtt gggcctggac gtcgttgagg 4380
atgcgcccct ggagaaagtc gttgccgccg ccggtgatgt agtacaacgc gttcgggtcg 4440
gcacccaggc cctggcgggc acggtccacc aggtagccat cgcggctgcg caggagggta 4500
ttgtcgcgct cgatcagcga gccgttggcc gcggtgatcg agtcgtagat ctgatcggtc 4560
cggtagccgc ccaccgccca gttgttgccg tcggcgatgc cctgctgggc gttgaccggc 4620
gaggtcgagg cagccaggtc acccggggcg atgccgagct gattgccgag cagcatgggc 4680
gcggtcggtc cgaagatctc gccgctgccg ttctggtagg tcgggccgac ccggttggtg 4740
aaacgcgagg tgcttccggc ggggccggca ggatcgggga actgcccggc atcgctgagg 4800
ctgtcgccga acaccaccag cgtcgaatag ggcgaaggag cagcctgcgg ggcggtggac 4860
agcgaagcca gcaggcaggc cgctaccagt ggcttgagcg ccattctgat cattctctta 4920
ctccatgatt tgtttttatt gtcgggccgc cgcgtcgtcg gcatgcgccc cggggcccgt 4980
cgtaaagcct cctcagccga acagcatagc gcggaaccgg ctcatggctt gttcggcgag 5040
gaacgcagca ggctcattgc cattattacc agcagagcga cccccagcag aagtaccgcc 5100
cacaggccga tcttcttcca gtcgctaccc ggtgccggcg ccgcgaccgc catggccacc 5160
tccagcggtt cgcccaggct ggcgctaccc agggtggcgc gcttgctctc ggtatagccg 5220
ggaatcagta tctagagctg aattacattc ccaaccgcgt ggcacaacaa ctggcgggct 5280
accgttcgta taatgtatgc tatacgaagt tatgaaggca cgaacccagt tgacataagc 5340
ctgttcggtt cgtaaactgt aatgcaagta gcgtatgcgc tcacgcaact ggtccagaac 5400
cttgaccgaa cgcagcggtg gtaacggcgc agtggcggtt ttcatggctt gttatgactg 5460
tttttttgta cagtctatgc ctcgggcatc caagcagcaa gcgcgttacg ccgtgggtcg 5520
atgtttgatg ttatggagca gcaacgatgt tacgcagcag caacgatgtt acgcagcagg 5580
gcagtcgccc taaaacaaag ttaggtggct caagtatggg catcattcgc acatgtaggc 5640
tcggccctga ccaagtcaaa tccatgcggg ctgctcttga tcttttcggt cgtgagttcg 5700
gagacgtagc cacctactcc caacatcagc cggactccga ttacctcggg aacttgctcc 5760
gtagtaagac attcatcgcg cttgctgcct tcgaccaaga agcggttgtt ggcgctctcg 5820
cggcttacgt tctgcccagg tttgagcagc cgcgtagtga gatctatatc tatgatctcg 5880
cagtctccgg cgagcaccgg aggcagggca ttgccaccgc gctcatcaat ctcctcaagc 5940
atgaggccaa cgcgcttggt gcttatgtga tctacgtgca agcagattac ggtgacgatc 6000
ccgcagtggc tctctataca aagttgggca tacgggaaga agtgatgcac tttgatatcg 6060
acccaagtac cgccacctaa caattcgttc aagccgaata acttcgtata atgtatgcta 6120
tacgaacggt attaagaccc actttcacat ttaagttgca attgtcagga cgcagccttc 6180
agccatcgag catccccctc cctatgacaa cgttcgacca cctgggccgc tttaccgcaa 6240
gcgatactgt gcggttgtga caattccatg aaacgccgac aggccgccgc catggccggg 6300
tcctcgagca agcgccacag cgccccgcgc aactcctgct cgcgcaacgg cacgcccagg 6360
cgcatcccgc agccgagccg gaccagccgt tcggcattgt cgaactggtc gtgggcacag 6420
ggcagcagca cctgcggcac ccccgccgcc aaggctaggc tcatggcgcc gataccgccc 6480
ggatggacca gcccggcgca cgatggcagc aaggctccca gtggcgcgta ggcgcgctgc 6540
agcacgtggt tcggcaagcc gcgcagcggt tcctggccgg cgccggtgag gaagatccca 6600
cgcgcgccga ggcgttccag cgcgcgcagg gccatggcgt agaagtcgcc ctgcaggtgt 6660
tcggtcgagc cctgggtgaa caccagcggc cggctgccct gatcgagaaa gcgttgcagt 6720
tcgtcgtcga gcggggtccc cgggatactg ccgtcgaaca gcgggaagcc ggtcatgtgc 6780
aggggttgcg gccaatcctg ctggggcggc gcgaaccagg ccgggaacag gcagaccacg 6840
ccctgcggcg aatgcatcca ttgggtgaag atgcgcttca ccggcgtttc caggccgacc 6900
ttgcggcgca ccgcgttgat ctccggcgcg caggtgcgat ccagcttgaa gcgctcgatg 6960
cagcgccaga gcagcttgcg catcgccagc ggcatctgct cgggcacgtt gaacttgggg 7020
tgtaccggcg gcaggtgcgc cgacaacagg gtcgatggcg agacctgcgc ggacaggtag 7080
ggaatcccgt acttctcgtg agcgatgcgt gcgcccagcg cccatagcga gccgaccacc 7140
acgatgtcgt catggcgctg cgccgagacg tactcgtaga ccggctcgat catcccggcg 7200
atggcttgcc agagcacgcc gaaggacgtc ttggggtccc acaggcgcgg atcgcccatg 7260
gtccggcggt aggtcagttc gtcgctcagc gggacgaacg cgatgccgtg ctgctccacc 7320
gcgtcgcgaa acaccgggat ggtgcagagg ctcacgcggt gcccgcgcag tttcagggtc 7380
cgggccaggc cgatgaaggg aaatacgtcg ccggccgagc cgatggcgat gaggatggcg 7440
tgcatggggc tactccgtgc gttatgcaac cgcaaagccc ggccaggccg ggtcttcgca 7500
ggtcaagggt tcaggcgtag ccgatggcca tctcgtggaa tcccgccgcg cgttccgccc 7560
gctgcggctc cggttgcttc agcaggtgct cgagcagggc gcggtgcacg cgtaccgctg 7620
ccagcttgga ctccaggtcg aggaaatgcc cggtgccctc cacccgcgag aaactgcagt 7680
gcggcaggta gtcgcggaac tggcgggcgt cctcggcggt ggtgtattcg tcccagctgc 7740
cgttgatgaa atgcacgtgg ctctggatcc gctccaggca agccaagtag ccccgatcgt 7800
tgagcgccag cacctggtcg atgtgaaagc gcgcctgctc gtattcgccg gtggccagcg 7860
aagccatgtg ctgatggttg ctggctttca ggcgctgcgg caggtatttg ccgacggtct 7920
cgttgagcag atggccgatc gccgacttgt cgtccagctc gatcagcgcc tgcgcccgcc 7980
cgacgtagtc gagcatcgcc tggttcagtc caggggcgaa tgccatcacc accgagctgc 8040
ggatgccgcg cggattgcgc gacagcgcca gcagcgtgga gataccgccc caggacgcgg 8100
agaccaggtg attgacctcg aagcgctcga tcagcgccag gaggatttcc acctcgtcgt 8160
ccttggtgat caacccgcgc tgcgggttgt gctgacgcga ctgcccggcg aagggcaggt 8220
cgaacagcac cacgttgaaa tgttcggcca ggcacttgca ggtccgggcg aacgaggcgg 8280
tggtcgccat cgcgccgttg accagcatca ccgtgctgcg cccgggatcc tgcccaacgc 8340
gctcgacatg tacccgcagg cccttgcaaa ccgataccaa cagactttcg cgccgcattt 8400
cacacctccc aaaaattttc gaacaggcaa acagctatcg ctgccacggg tatcccggca 8460
ttacgtagag ttcgttctta ttgttcgaac ggcagacaag taactcagcg gccatccgcg 8520
cggaccagcc acggcggatg cgtacccctt caggcgaggg gcttgtgtgg gtcttgcaga 8580
tcggcctgcg caaacgattg gcgtccgtgt tcacgcgtag ccgatgaaca ctttttagcc 8640
aattcgaaag ctaacggtaa ctgccagatt tcacaggacg ggcggccgcc tgcgcataag 8700
cccctgcccg cccgcgataa ggcgtgccag agcggccggc ggggaacagc gaggggttgg 8760
cggaaaaggc ctagggaatt c 8781
<210> 2
<211> 97
<212> DNA
<213>Artificial sequence
<221>Primer aroA-genta-loxM-3
<222>（1）…（97）
<400> 2
cacccgcggc gtagagcccg gcgagcaaca ggcaggactt cacctgggcg ctggccatcg 60
gcatgtcgta atgcaagctg aattacattc ccaaccg 97
<210> 3
<211> 98
<212> DNA
<213>Artificial sequence
<221>Primer aroA-genta-loxM-5
<222>（1）…（98）
<400> 3
caagtcgatt tcccatcgct cgatcatgct cggctccctg gccgaaggca ccaccgaagt 60
ggagggcttc ctcgacaact taaatgtgaa agtgggtc 98
<210> 4
<211> 57
<212> DNA
<213>Artificial sequence
<221>Primer RhlAB-5
<222>（1）…（57）
<400> 4
ttaagaccca ctttcacatt taagttgcaa ttgtcaggac gcagccttca gccatcg 57
<210> 5
<211> 79
<212> DNA
<213>Artificial sequence
<221>Primer RhlAB-3
<222>（1）…（79）
<400> 5
tcacgctgcc gcaagcactc agggcgcaag ggctgctaaa ggaagcggaa cctaggcctt 60
ttccgccaac ccctcgctg 79

Claims (4)

1. it is a kind of be attenuated producing rhamnolipid with high yield restructuring Pseudomonas aeruginosa engineering bacteria, it is characterised in that：The engineering bacteria is its gene The gene aroA (5- enolpyruvyl phthalein shikimic acid -3- phosphate synthases) of aromatic amino acid synthesis is knocked out in group and had been contained The pseudomonas aeruginosa (Pseudomas aeruginosa) of expression plasmid pBBR1-oriT-rhlAB-estA-genta, name It is PAO1aroA；Wherein, the nucleotide sequence such as SEQ ID of the overexpression plasmid pBBR1-oriT-rhlAB-estA-genta Shown in No.1.
2. the construction method of the restructuring Pseudomonas aeruginosa engineering bacteria of producing rhamnolipid with high yield is attenuated described in claim 1, and step is：
The homologous recombination system built using the recombinase of pseudomonad bacteriophage, the carrying of one section of 50bp-100bp is short homologous The resistance gene DNA fragment of arm is incorporated on the chromosome of pseudomonas aeruginosa (Pseudomas aeruginosa), realizes striking Except the gene aroA (5- enolpyruvyl phthalein shikimic acid -3- phosphate synthases) of aromatic amino acid synthesis, attenuation verdigris is obtained false Monad, then build transhipment esterase gene EstA and rhamnosyltransferase Complex Gene comprising rhamnolipid synthesis RhlAB, gentamicin resistance gene, engagement transfer initiation site oriT and an overexpression matter of broad spectrum type replicon pBBRI Grain pBBR1-oriT-rhlAB-estA-genta, and the overexpression plasmid is transferred in the attenuated pseudomonas aeruginosa of acquisition, i.e., Obtain by multicopy plasmid increase the bacterium rhamnolipid synthesis related gene copy number realize attenuation producing rhamnolipid with high yield Restructuring Pseudomonas aeruginosa engineering bacteria.
3. it is a kind of for build attenuation producing rhamnolipid with high yield restructuring Pseudomonas aeruginosa engineering bacteria recombinase expression plasmid, its feature It is：The plasmid is overexpression plasmid pBBRI-rha-redgam-BAS-kan, and the plasmid turns comprising rhamnolipid synthesis Fortune esterase gene EstA and rhamnosyltransferase Complex Gene RhlAB, gentamicin resistance gene, engagement transfer start bit A point oriT and broad spectrum type replicon pBBRI, its nucleotide sequence is as shown in SEQ ID No.1；The plasmid need not resist The selection pressure of raw element, stabilization can replicate in the pseudomonas aeruginosa of the attenuation for building.
4. the restructuring Pseudomonas aeruginosa engineering bacteria of attenuation producing rhamnolipid with high yield described in claim 1 is in industrial production of rhamnolipid Application.
CN201710172680.9A 2017-03-21 2017-03-21 One plant is attenuated the engineered strain of producing rhamnolipid with high yield and its builds and application Pending CN106754609A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710172680.9A CN106754609A (en) 2017-03-21 2017-03-21 One plant is attenuated the engineered strain of producing rhamnolipid with high yield and its builds and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710172680.9A CN106754609A (en) 2017-03-21 2017-03-21 One plant is attenuated the engineered strain of producing rhamnolipid with high yield and its builds and application

Publications (1)

Publication Number Publication Date
CN106754609A true CN106754609A (en) 2017-05-31

Family

ID=58966201

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710172680.9A Pending CN106754609A (en) 2017-03-21 2017-03-21 One plant is attenuated the engineered strain of producing rhamnolipid with high yield and its builds and application

Country Status (1)

Country Link
CN (1) CN106754609A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108060111A (en) * 2017-10-27 2018-05-22 中国科学院微生物研究所 A kind of pseudomonas aeruginosa for improving rhamnolipid yield and its construction method
CN112410365A (en) * 2020-10-21 2021-02-26 山东大学 Burkholderia homologous recombination system and application thereof
CN113249419A (en) * 2021-04-28 2021-08-13 南京工业大学 Method for synthesizing rhamnolipid by extracellular enzyme catalysis
CN113249284A (en) * 2021-04-28 2021-08-13 南京工业大学 Pseudomonas putida genetic engineering bacterium and construction method and application thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2573172A1 (en) * 2011-09-21 2013-03-27 Heinrich-Heine-Universität Düsseldorf Means and methods for rhamnolipid production
CN104498526A (en) * 2015-01-09 2015-04-08 西北大学 Method for rapidly and efficiently screening rhamnolipid producing bacteria nutrition system
CN104762313A (en) * 2015-02-13 2015-07-08 中国科学院微生物研究所 Rhamnolipid yield increasing genetic engineering method and special strain
CN104830889A (en) * 2015-03-06 2015-08-12 西安海格生物技术研究所有限公司 Genetic recombinant method of pseudomonas aeruginosa for high-yield producing rhamnolipid
WO2016131801A1 (en) * 2015-02-19 2016-08-25 Evonik Degussa Gmbh Rhamnolipid synthesis

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2573172A1 (en) * 2011-09-21 2013-03-27 Heinrich-Heine-Universität Düsseldorf Means and methods for rhamnolipid production
CN104498526A (en) * 2015-01-09 2015-04-08 西北大学 Method for rapidly and efficiently screening rhamnolipid producing bacteria nutrition system
CN104762313A (en) * 2015-02-13 2015-07-08 中国科学院微生物研究所 Rhamnolipid yield increasing genetic engineering method and special strain
WO2016131801A1 (en) * 2015-02-19 2016-08-25 Evonik Degussa Gmbh Rhamnolipid synthesis
CN104830889A (en) * 2015-03-06 2015-08-12 西安海格生物技术研究所有限公司 Genetic recombinant method of pseudomonas aeruginosa for high-yield producing rhamnolipid

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GREGORY P. PRIEBE ET AL: "Construction and Characterization of a Live, Attenuated aroA Deletion Mutant of Pseudomonas aeruginosa as a Candidate Intranasal Vaccine", 《INFECTION AND IMMUNITY》 *
SUSANNE WILHELM ET AL: "The Autotransporter Esterase EstA of Pseudomonas aeruginosa Is Required for Rhamnolipid Production, Cell Motility, and Biofilm Formation", 《JOURNAL OF BACTERIOLOGY》 *
沈萍: "《微生物遗传学》", 30 September 1995, 武汉大学出版社 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108060111A (en) * 2017-10-27 2018-05-22 中国科学院微生物研究所 A kind of pseudomonas aeruginosa for improving rhamnolipid yield and its construction method
CN112410365A (en) * 2020-10-21 2021-02-26 山东大学 Burkholderia homologous recombination system and application thereof
CN112410365B (en) * 2020-10-21 2022-08-26 山东大学 Burkholderia homologous recombination system and application thereof
CN113249419A (en) * 2021-04-28 2021-08-13 南京工业大学 Method for synthesizing rhamnolipid by extracellular enzyme catalysis
CN113249284A (en) * 2021-04-28 2021-08-13 南京工业大学 Pseudomonas putida genetic engineering bacterium and construction method and application thereof
CN113249419B (en) * 2021-04-28 2023-10-27 南京工业大学 Method for synthesizing rhamnolipid by extracellular enzyme catalysis
CN113249284B (en) * 2021-04-28 2024-01-12 南京工业大学 Pseudomonas putida genetically engineered bacterium, construction method and application thereof

Similar Documents

Publication Publication Date Title
CN106754609A (en) One plant is attenuated the engineered strain of producing rhamnolipid with high yield and its builds and application
EP1543105B1 (en) New mutant strains of pseudomonas fluorescens and variants thereof, methods for their production, and uses thereof in alginate production
KR20190068536A (en) Improved process for the production of fucosylated oligosaccharides
US20060057726A1 (en) Method for the positive selection of chromosomal mutations in C1 metabolizing bacteria via homologous recombination
CN112301049B (en) Recombinant plasmid and genetic engineering strain for high yield of heme, construction method thereof and method for high yield of heme
JP7544351B2 (en) A novel strain of Pseudozyma antarctica
US20220056457A1 (en) Cis conjugative plasmid system
Peralta et al. Engineering the nifH promoter region and abolishing poly-β-hydroxybutyrate accumulation in Rhizobium etli enhance nitrogen fixation in symbiosis with Phaseolus vulgaris
Racharaks et al. Development of CRISPR-Cas9 knock-in tools for free fatty acid production using the fast-growing cyanobacterial strain Synechococcus elongatus UTEX 2973
CN106480082A (en) A kind of gene knockout method for pseudomonas putida NBRC 14164
CN107881140A (en) The Leuconostoc mesenteroides mutant strain of one plant height production mannitol and its application process
Suwanto et al. A self-transmissible, narrow-host-range endogenous plasmid of Rhodobacter sphaeroides 2.4. 1: physical structure, incompatibility determinants, origin of replication, and transfer functions
CN111996185B (en) Bonding transfer enhancing liquid and application thereof in improving bacterial bonding transfer efficiency
Clarke The Leeuwenhoek Lecture, 1979 Experiments in microbial evolution: new enzymes, new metabolic activities
Paget et al. Development of engineered genomic DNA to monitor the natural transformation of Pseudomonas stutzeri in soil-like microcosms
Janczarek et al. Regulation of pssA and pssB gene expression in Rhizobium leguminosarum bv. trifolii in response to environmental factors
CN108865945B (en) Herbicide-tolerant 2,4-D Guilin Paenibacillus and application thereof
Kyslik et al. Plasmid burden in chemostat culture of Escherichia coli: its effect on the selection for overproducers of host enzymes
CN113801834B (en) Gene engineering streptomyces diastatochromogenes for high yield of toyocamycin and construction method and application thereof
US20060105432A1 (en) Method for the production of vitamin b12
CN100395328C (en) Plasmid-free clone of E. coli strain DSM 6601
Aird et al. Identification of the exo loci required for exopolysaccharide synthesis in Agrobacterium radiobacter NCIB 11883
Smith et al. R-plasmid-mediated chromosome mobilization in Bordetella pertussis
CN110904019B (en) Construction and application of strain with high yield of antifungal active substances
KR100953104B1 (en) A Novel plasmid from Leuconostoc sp. and Shuttle Vector comprising the plasmid

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20170531