CN106699884A - Anti-human C-reactive protein antibody and application thereof - Google Patents

Anti-human C-reactive protein antibody and application thereof Download PDF

Info

Publication number
CN106699884A
CN106699884A CN201710037811.2A CN201710037811A CN106699884A CN 106699884 A CN106699884 A CN 106699884A CN 201710037811 A CN201710037811 A CN 201710037811A CN 106699884 A CN106699884 A CN 106699884A
Authority
CN
China
Prior art keywords
antibody
ser
human
seq
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710037811.2A
Other languages
Chinese (zh)
Other versions
CN106699884B (en
Inventor
马永
赵利利
王安良
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
ZONHON BIOPHARMA INSTITUTE Inc
Original Assignee
CHANGZHOU GENSUN INSTITUTE OF BIOMEDICINE Co Ltd
ZONHON BIOPHARMA INSTITUTE Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CHANGZHOU GENSUN INSTITUTE OF BIOMEDICINE Co Ltd, ZONHON BIOPHARMA INSTITUTE Inc filed Critical CHANGZHOU GENSUN INSTITUTE OF BIOMEDICINE Co Ltd
Priority to CN201710037811.2A priority Critical patent/CN106699884B/en
Publication of CN106699884A publication Critical patent/CN106699884A/en
Application granted granted Critical
Publication of CN106699884B publication Critical patent/CN106699884B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4737—C-reactive protein

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention relates to anti-human C-reactive protein (CRP) antibody, a preparation method thereof and application of the antibody in anti-human C-reactive protein detection. An inventor prepares a variety of antibodies, and antibody combinations (P20 and P02) capable of meeting the sensitivity and specificity demands are obtained through pairing and screening. In addition, large-scale production of the antibodies is promoted, and the future large-scale clinic application demand can be met. A colloidal gold immunochromatography quantitative determination card simple and convenient to operate and having sensitivity, specificity and relevant detection properties capable of meeting human clinic sample detection, of a detected human C-reactive protein can be obtained through the detection system debugging and optimizing work to the antibody combinations.

Description

Anti-human C reactive protein antibody and its application
Technical field
The invention belongs to biological technical field, two kinds of anti-human C reactive protein (CRP) antibody and its preparation are specifically related to The application of method and above-mentioned antibody in Human C-reactiveprotein detection.
Background technology
C reactive protein (C reactive protein, CRP) is a member in protein families, is that a kind of acute stage is anti- Albumen is answered, PC is drastically raised in tissue damage and bacterium infection, be the important defense molecule of body, mainly by liver Produce and secrete.CRP is combined into the disk-like structure of stabilization by five identical spherical monomers with non-covalently bonded, is belonged to just Pentamer family.CRP is in structure symmetrical pentahedron, and monomer is made up of 206 amino acid, and molecular weight is about 23KDa, The total molecular weight of CRP is about 118KDa.CRP participates in internal various inflammation and immune response, is coronary atherosclerotic The important symbol thing of heart disease (coronary heart disease).Numerous studies show：High-caliber CRP is peripheral vascular disease, myocardial infarction, brain The independent risk predictive factor of angiosis and vascular death.
CRP contents are few in normal human serum, and concentration is 0.062-8.2mg/L, and half-life period is about 15 hours.Work as generation Bacterium infection starts to raise after 2 hours, increases within average 8 hours 1 times, reaches peak within 48 hours, and it then will not in virus infection Raise.CRP is persistently raised, and points out body to there is chronic inflammation or autoimmune disease.CRP changes are not by the individuality of patient The influence of difference, fuselage state and medicine.In addition, CRP also plays an important role in other field：1. by chronic The effect of CRP has been found in the independent hazard factor of inflammation initiation angiocardiopathy, and the level of monitoring CRP changes to the heart in time The intervention and prognosis of vascular diseases play an important role.Some scholars are it is even contemplated that the gold that CRP can be assessed as cardiovascular danger is marked Standard, and CRP levels are higher, the danger that cardiovascular and cerebrovascular occurs is bigger；2. CRP can be used to evaluate the serious journey of acute pancreatitis Degree, when there is extensive necrosis pancreatitis, the level of CRP may be up to 250mg/L in serum；3. such as CRP and alpha-fetoprotein are joined Application is closed, can be used to differentiate liver malignancy and benign disease, formulated for clinical treatment and guidance is provided；In addition, CRP is surveyed Fixed treatment and prognosis to tumour also has positive meaning, and malignant tumor patient CRP levels are mostly raised, after ocal resection CRP levels can then decline, and it is very small to carry out the influence of radiotherapy, chemotherapy and corticosteroid therapy to serum CA125, so determining blood The level change of clear CRP contributes to the clinical progression for estimating malignant tumour in each tract.4. patient's prognosis is assessed： CRP levels are higher, point out disease control not good, prognosis mala.
In view of important function of the CRP in various fields, prepares CRP antibody and for preparing CRP immue quantitative detection reagent boxes With important clinical value.CRP is determined typically by antibody nephelometry or immunoturbidimetry, and their detection In more than 3-5mg/L, this level is suitable only for the prediction to infecting to ability, and for coronary artery and cerebrovascular risk prediction It is far from being enough.In addition to above-mentioned technology, using collaurum and the CRP test cards of fluorogenic quantitative detection technology, can meet fast Speed detection and the demand of bed side detection.Wherein the whole CRP detection methods based on the quantitative chromatographic technique of collaurum had both had entirely certainly The accuracy of dynamic biochemical instruments Immunity transmission turbidity reagent, while detection is easier, quick, is adapted to the diagnosis of bed side, it is easy to Carry out in outpatient service, emergency treatment or ICU wards.
The content of the invention
The technical problem to be solved in the present invention is to provide can effective, specific binding Human C-reactiveprotein antibody.More Specifically：
The first object of the present invention is to provide two kinds of anti-human C reactive protein antibody.
The first anti-human C reactive protein antibody (P20),
Its weight chain variable district contains following complementary determining region：Amino acid sequence such as sequence SEQ ID NO：Shown in 1 HCDR1, such as sequence SEQ ID NO：HCDR2 and/or such as sequence SEQ ID NO shown in 2：HCDR3 shown in 3；
Its light-chain variable sequence contains following complementary determining region：Amino acid sequence such as sequence SEQ ID NO：Shown in 4 LCDR1, such as sequence SEQ ID NO：LCDR2 and/or such as sequence SEQ ID NO shown in 5：LCDR3 shown in 6.
The amino acid sequence such as SEQ ID NO of the weight chain variable district of the antibody P20 preferably in the present invention:Shown in 7, gently The amino acid sequence of chain variable region such as SEQ ID NO:Shown in 8.
Second anti-human C reactive protein antibody (P02),
Its weight chain variable district contains following complementary determining region：Amino acid sequence such as sequence SEQ ID NO：Shown in 9 HCDR1, such as sequence SEQ ID NO：HCDR2 and/or such as sequence SEQ ID NO shown in 10：HCDR3 shown in 11；
Its light-chain variable sequence contains following complementary determining region：Amino acid sequence such as sequence SEQ ID NO：Shown in 12 LCDR1, such as sequence SEQ ID NO：LCDR2 and/or such as sequence SEQ ID NO shown in 13：LCDR3 shown in 14.
The amino acid sequence such as SEQ ID NO of the weight chain variable district of antibody P02 preferably in the present invention:Shown in 15, resist The amino acid sequence of body light chain variable district such as SEQ ID NO:Shown in 16.
Second purpose of the invention is to provide two kinds of single-chain antibodies, the amino acid sequence such as SEQ of the single-chain antibody P20 ID NO:Shown in 17；The amino acid sequence of the single-chain antibody P02 such as SEQ ID NO:Shown in 18.
The 3rd purpose of the present invention is to provide two kinds of nucleotide sequences of the above-mentioned single-chain antibody of coding, encodes single-chain antibody The nucleotide sequence of P20 such as SEQ ID NO:Shown in 19, and the nucleotide sequence such as SEQ ID NO for encoding single-chain antibody P02:20 It is shown.
4th purpose of the invention is to provide a kind of expression vector containing above-mentioned nucleotide sequence.
5th purpose of the invention is to provide a kind of recombinant host cell containing above-mentioned expression vector.Affiliated host cell Can be Escherichia coli, yeast or mammalian cell, preferably Escherichia coli.
6th purpose of the invention is to provide a kind of method for producing above-mentioned single-chain antibody, including：
1) above-mentioned recombinant host bacterium expression antibody is cultivated under suitable conditions；
2) and then from Host Strains purify, collect antibody.
7th purpose of the invention is to provide above-mentioned anti-human C reactive protein antibody to contain in detection Human C-reactiveprotein Application in amount.
8th purpose of the invention is to provide one group to be matched and be detected the antibody of Human C-reactiveprotein to group Close P20 and P02；The antibody is high to the detection sensitivity for combining, and specificity is good.
9th purpose of the invention is to provide a kind of using the anti-human C reactive protein antibody test human C-reactive The colloidal gold immunochromatographimethod quantitative test card of albumen, including sample absorption pad, gold standard pad, reaction film and adsorptive pads；The gold mark Pad is coated with the antibody P02 or P20 of colloid gold particle mark, there is detection band and quality control band, detection band position on the reaction film Antibody P20 or P02 are coated with, quality control band position is coated with anti-His tag antibodies or Protein L.The preferred nitric acid of reaction film Cellulose membrane.The anti-anti- His antibody of the preferred mouse of His tag antibodies.
The present invention is prepared for Multiple Antibodies, and carries out pairing screening, and obtaining sensitivity and specificity can meet demand Antibody Combination (P20 and P02)；Its convenient a large amount of production, can meet the demand of larger scale clinical application in the future simultaneously.To above-mentioned anti- Body combination carries out the debugging Optimization Work of detection architecture, obtains easy to operate, sensitivity, specificity and coherent detection performance Meet the colloidal gold immunochromatographimethod quantitative test card of the Human C-reactiveprotein of people's clinical sample detection.
Brief description of the drawings
Fig. 1：PCR identifies P20 and P02 heavy chain of antibody and light chain variable district agarose gel electrophoresis figure.
Wherein, Lane 1 is 200bp DNA Ladder；Lane 2 is antibody P20 weight chain variable district DNA sequence dnas；Lane 3 It is antibody P20 light chain variable district DNA sequence dnas；Lane 4 is antibody P02 weight chain variable district DNA sequence dnas；Lane 5 is that antibody P02 is light Chain variable region DNA sequence dna.
Fig. 2：Single-chain antibody structural representation.VHRepresent weight chain variabl area sequence, VLRepresent light-chain variable sequence, His marks It is six histidines to sign.
Fig. 3：Induced expression qualification figures of the single-chain antibody P20 and P02 in recombination bacillus coli engineering bacteria.
Wherein, Fig. 3-a are induced expression SDS-PAGEs of the single-chain antibody P20 and P02 in recombination bacillus coli engineering bacteria Gel electrophoresis figure.Swimming lane 1 is the albumen loading Marker of the pre-dyed of (10-230kDa) wide scope；Swimming lane 2 is not add IPTG to lure The single-chain antibody P20 recombination bacillus coli engineering bacteria lysates led；Swimming lane 3 is recombinated for the single-chain antibody P20 for adding IPTG inductions Colibacillus engineering lysate；Swimming lane 4 is that the single-chain antibody P02 recombination bacillus colis engineering bacteria for not adding IPTG to induce is cracked Liquid；Swimming lane 5 is the single-chain antibody P02 recombination bacillus coli engineering bacteria lysates for adding IPTG to induce.
Fig. 3-b are induction expression protein Western blottings of the single-chain antibody P20 and P02 in recombination bacillus coli engineering bacteria Figure.Swimming lane 1 is the albumen loading Marker of the pre-dyed of (10-230kDa) wide scope；Swimming lane 2 is single-stranded for do not add IPTG to induce Antibody P20 recombination bacillus coli engineering bacteria lysates；Swimming lane 3 is the single-chain antibody P20 recombination bacillus colis for adding IPTG to induce Engineering bacteria lysate；Swimming lane 4 is the single-chain antibody P02 recombination bacillus coli engineering bacteria lysates for not adding IPTG to induce；Swimming lane 5 To add the single-chain antibody P02 recombination bacillus coli engineering bacteria lysates of IPTG inductions.
Fig. 4：Single-chain antibody P20 and P02 recombination bacillus coli engineering bacteria lysate are purified by HisTrap HP affinity columns Collect peak and merge sample PAGE gel electrophoretogram.Swimming lane 1 is the albumen loading of the pre-dyed of (10-230kDa) wide scope Marker；Swimming lane 2 is single-chain antibody P20 recombination bacillus coli engineering bacteria lysates by HisTrap HP affinity column purified pools Peak merges sample；Swimming lane 3 is that single-chain antibody P02 recombination bacillus coli engineering bacteria lysates are purified by HisTrap HP affinity columns Collect peak and merge sample.
Fig. 5：Colloidal gold immunochromatographimethod quantitative test card structural representation of the present invention.1 is sample pad, 2 is reaction film, 3 are Absorption pad, 4 be nature controlling line (C lines), 5 be detection line (T lines), 6 be gold standard pad, 7 be PVC sheet.
Fig. 6：CRP colloidal-gold detecting-card detection range matched curves.
Fig. 7：CRP colloidal-gold detecting-card range of linearity matched curves.
Fig. 8：CRP colloidal-gold detecting-cards compare matched curve with reference product.
Specific embodiment
Definition
" antibody " is large-scale Y shape protein that a class is secreted by bone-marrow-derived lymphocyte also known as immunoglobulin, can be by Y shape Two of which bifurcated top complementary site (antigen knot bound site) specifically bind target antigen immunoglobulin molecules, institute State target antigen such as protein, sugar, polynucleotides, fat, polypeptide, micromolecular compound etc..
" single-chain antibody " (scFv) refers to the weight chain variable district (V of antibodyH) and light chain variable district (VL) pass through 15~20 The single chain fusion protein that amino acid short peptide (linker) connection is formed, the linker for connecting is generally rich in glycine and silk Propylhomoserin, is beneficial to the stability and pliability of single-chain antibody.Connected mode can be by VLN-terminal be connected to VHC-terminal, Huo Zhexiang Instead.Although eliminating constant region and introducing linker, single-chain antibody still remains specificity of the antibody to antigen, and it has Molecular weight is small, penetration power is strong and the features such as weak antigenicity.
Complementary determining region (complementarity-determining region, CDR), also referred to as hypervariable region.Shaping It is most critical zone that target antigen is combined with antibody in the end of antibody monomer amino acid, in Artificial Immune Network Theory, each resists The complementary determining region of body is otherwise known as idiotype or genotype.
The preparation of the anti-human C reactive protein hybridoma cell strain of embodiment 1.
1. animal immune
BALB/c is immunized according to general immune programme for children with the C reactive protein for being extracted from human plasma (purchased from HyTest companies) Female mice (is purchased from this experimental animal Co., Ltd of Changzhou Cavan).Specific Immunity referring to《Antibody preparation is tested with use Guide》.Immune serum titre is tracked using indirect elisa method, serum titer highest immune mouse is chosen, mouse is carried out Splenocyte and murine myeloma cell carry out fusion experiment.
2. cell fusion
(1) preparation of spleen cells
By immune mouse, pluck eyeball and take blood, be placed in the alcohol of 75% (v/v) after being put to death through disconnected cervical vertebra and soak 10min, in Its spleen is taken out in aseptic operating platform, is placed in cell screen clothes, be fully ground cell, cross screen cloth, with (the purchase of aseptic 1640 culture medium From Gibco companies) centrifuge washing for several times after, re-suspended cell is counted with being made single cell suspension, standby.
(2) preparation of feeder cells
Female BAl BIc/c the mouse one of 8~10 week old are taken, eyeball is plucked and is obtained negative serum, put to death rearmounted through disconnected cervical vertebra 10min is soaked in 75% (v/v) alcohol；It is aseptic to open skin of abdomen, peritonaeum is exposed, about 10mL 1640HT are trained with syringe Base (be purchased from SIGMA companies) injection mouse peritoneal is supported, gently abdomen massage and piping and druming is for several times.Draw the culture containing macrophage It is standby in base injection 20%1640HAT culture mediums；
Female BAl BIc/c the mouse one of 2~3 week old are taken, is placed in 75% (v/v) alcohol after being put to death through disconnected cervical vertebra and soaked 10min；In cell screen clothes, screen cloth is crossed in grinding for the aseptic thymus gland that takes, obtain thymocyte be placed in it is above-mentioned containing macrophage It is standby in 20%1640HAT culture mediums.
(3) cell fusions
Murine myeloma cell strain SP2/0 of the selection in exponential phase, collects and counts.Take about 108Individual above-mentioned spleen Cell and 2 × 107Individual above-mentioned SP2/0 cell lines mix in adding fusion pipe, and 1000rpm abandons supernatant (as far as possible after being centrifuged 10 minutes Abandon net), fusion pipe is put and gently rubbed back and forth so that precipitation is loose on palm.Add what 1mL was preheated after elder generation is slow in 60 seconds soon PEG1450 (polyethylene glycol 1450, purchased from SIGMA companies), adds 1640HT culture mediums 30mL to terminate, and 1000rpm is centrifuged 10 points Clock, removes supernatant, and gently friction makes precipitation loose, in the 1640HAT culture mediums of add that step 2 obtained 20%.
After above-mentioned HAT culture mediums are fully mixed, dispensed into 96 porocyte culture plates with 200 μ L/ holes, put 37 DEG C, 5% CO2Cell culture incubator in cultivate.20%1640HAT culture mediums are replaced with 10%1640HT culture mediums after one week, is taken after 3 days Detected clearly.
3. anti-human C reactive protein specific hybrid knurl strain screening
(1) preparation of detection plates：CRP (buying in HyTest companies) to 1 μ g/mL is diluted with CB coating buffers, 96 holes are coated with ELISA ELISA Plates, 100 μ L/ holes, 2~8 DEG C of coatings overnight, washed once and pat dry；Containing 2% bovine serum albumin(BSA) (Bovine Serum Albumin, BSA, buy in Yancheng Sai Bao bio tech ltd) PBST buffer blinds (200ul/ holes), 37 DEG C are closed 2 hours；Pat dry, it is standby.
(2) screening of positive colonies：During the μ L/ holes of cells and supernatant to be checked 100 are added into above-mentioned detection plate, in 37 DEG C Effect is washed and patted dry after 30 minutes, adds the sheep anti-mouse igg of the HRP marks in 100 μ L/ holes, is washed after being acted on 30 minutes in 37 DEG C Wash and pat dry, add the TMB nitrite ions in 100 μ L/ holes, developed the color 15 minutes in 37 DEG C of lucifuges, the 2M H of 50 μ L are added per hole2SO4Eventually Only react, and the reading numerical values at OD450.Positive hole determines principle：OD450 values/negative control value >=2.1.Choose positive gram Grand strain carries out Cell-cloned screening.By after the cloning screening of three to four-wheel, monoclonal cell strain positive rate 100% is i.e. true It is set to stable cell line, singling is carried out to cell line.Hybridoma cell strain M20 and M02 are respectively provided with potency higher, subsequently enter then One step carries out antibody variable sequences sequencing analysis to above-mentioned hybridoma cell strain.
The measure of the hybridoma cell strain antibody variable sequences of embodiment 2.
Above-mentioned hybridoma cell strain M20 and M02 antibody variable sequences are measured.
The extraction of a.RNA：Reference cell total serum IgE extraction agent box (being purchased from Roche companies) specification is to above-mentioned hybridoma Cell line M20 and M02 carry out Total RNAs extraction and carry out reverse transcription immediately；
B.RNA reverse transcriptions turn into DNA：With reference to Thermo Scientific Reverted First strand cDNA The total serum IgE of Synthesis Kit (being purchased from Thermo companies) to being extracted in previous step carries out reverse transcription, and cDNA is obtained, and freezes Be stored in -20 DEG C it is standby；
C. the PCR amplifications and recovery of variable region sequences：With in previous step gained cDNA as template, with mouse IgG hypotype lists Clonal antibody variable region sequences universal primer is primer, and the variable region sequences to heavy chain and light chain enter performing PCR amplification, and PCR is produced Thing is reclaimed through DNA glue reclaims kit (being purchased from TIANGEN companies), sees accompanying drawing 1；
D. the clone of variable region sequences and sequencing：According to cloning vector pMD18-T kit (being purchased from Takara companies) Specification, heavy chain and chain variable region gene are attached with pMD18-T carriers respectively, convert bacillus coli DH 5 alpha, picking Positive colony, transfers to Nanjing Genscript Biotechnology Co., Ltd. to be sequenced.
Sequencing obtains antibody (being designated as P20) the heavy chain variable amino acid sequence such as SEQ ID of hybridoma cell strain M20 NO:7 is shown, chain variable region amino acid sequence such as SEQ ID NO：Shown in 8.The above-mentioned sequence of Vbase2 database analysises, its is heavy The amino acid sequence of each complementary determining region of chain variable region is respectively：Such as sequence SEQ ID NO：HCDR1 shown in 1, such as sequence SEQ ID NO：HCDR2 and/or such as sequence SEQ ID NO shown in 2：HCDR3 shown in 3；Each complementation of its light chain variable district Determining the amino acid sequence in area is：Such as sequence SEQ ID NO：LCDR1, such as sequence SEQ ID NO shown in 4：Shown in 5 LCDR2 and/or such as sequence SEQ ID NO：LCDR3 shown in 6.
Sequencing obtains antibody (being designated as P02) the heavy chain variable amino acid sequence such as SEQ ID of hybridoma cell strain M02 NO:15 is shown, chain variable region amino acid sequence such as SEQ ID NO：Shown in 16.The above-mentioned sequence of Vbase2 database analysises, its The amino acid sequence of each complementary determining region of weight chain variable district is respectively：Such as sequence SEQ ID NO：HCDR1 shown in 9, such as sequence Row SEQ ID NO：HCDR2 and/or such as sequence SEQ ID NO shown in 10：HCDR3 shown in 11；Its light chain variable district it is each The amino acid sequence of complementary determining region is：Such as sequence SEQ ID NO：LCDR1, such as sequence SEQ ID NO shown in 12：Shown in 13 LCDR2 and/or such as sequence SEQ ID NO：LCDR3 shown in 14.
The recombination expression of the single-chain antibody of embodiment 3. and purifying
According to sequencing result in embodiment 2, connection will be added between M20 and M02 heavy chain of antibody and light chain variable district respectively Peptide (GGGGS)3, and its full genome is synthesized, carry out the expression vector establishment and recombination expression of single-chain antibody.Expressed To antibody be respectively designated as antibody P20 and antibody P02, its structure composition is as shown in Figure 2.The restructuring table of above-mentioned single-chain antibody Up to specific as follows：
A) single-chain antibody P20 and P02 expression plasmids build
The nucleotide sequence of single-chain antibody P20 such as SEQ ID NO:19 is shown, amino acid sequence such as SEQ ID NO:17, it is single The nucleotide sequence of chain antibody P02 such as SEQ ID NO:20 is shown, amino acid sequence such as SEQ ID NO:Shown in 18.Will be single-stranded anti- Body P20 and P02 full genome is building up in pUC57 plasmids (being provided by Nanjing Genscript Biotechnology Co., Ltd.), obtains one kind Long-term to preserve plasmid, plasmid is designated as pUC57-P20-scFv- (HIS) respectively6With pUC57-P02-scFv- (HIS)6.Enter performing PCR Amplification, wherein the upstream and downstream primer of amplification single-chain antibody P20 is P1 and P2, the upstream and downstream primer of amplification single-chain antibody P02 is P3 And P4
Sense primer P1：CTAGCCATGGAAGTTATGTTGGTTGAATC(SEQ ID NO:21)；
Anti-sense primer P2：CCGCTCGAGTTACTAGTGATGGTGATGG(SEQ ID NO:22).
After Standard PCR program, agarose gel electrophoresis analysis, two kinds of primer sizes of display are in the same size with expection.By PCR After obtaining gene outcome recovery purifying, using NcoI (#R0193S, purchased from New England BioLabs companies) and XhoI (# R0146S, purchased from New England BioLabs companies) double digestion, with T4 ligases be connected to pET28a (69864, be purchased from Merck companies) in plasmid, it is transformed into DH5a competent cells (CB101, purchased from Beijing Tiangeng biochemical technology Co., Ltd), 37 DEG C of overnight incubations in the LB flat boards containing kanamycins (0408, purchased from Amresco companies).Second day screening positive clone Bacterium is sequenced, and compares, completely the same with expected sequence, that is, obtain the expression plasmid of single-chain antibody P20, is designated as pET28a-P20- scFv-(HIS)6With pET28a-P02-scFv- (HIS)6。
B) structure of single-chain antibody P20 and P02 recombination bacillus coli engineered strains, screening and expression
Comprise the following steps that：
Correct pET28a-P20-scFv- (HIS) is compared by being sequenced in the step a of embodiment 36And pET28a-P02- scFv-(HIS)6Plasmid is transformed into e. coli bl21 (DE3) competence bacterial strain, and (CB105 has purchased from Beijing Tiangeng biochemical technology Limit company) in, incubated overnight in 37 DEG C of kanamycins flat boards.Choose within second day positive bacterium colony respectively, access containing 50 μ g/mL cards that The LB nutrient solutions of mycin, 37 DEG C of overnight incubations.Take 50 μ L overnight cultures and access LB inductions of the 5mL containing 50 μ g/mL kanamycins Nutrient solution, 37 DEG C of shaken cultivations.When OD600=1.0, induction table is carried out with the IPTG (being purchased from Amresco companies) of 1mmol/L Reach.Negative control is done with the E. coli broth for not adding IPTG simultaneously.12000rpm after 4h, 3min collect bacterium solution, with pre- Cold PBS precipitation, adds 5 × sds gel sample loading buffer, and 100 DEG C are heated 10min, and room temperature 12000rpm, 1min are at a high speed Centrifugation, takes supernatant.The E. coli broth of IPTG is not added by this step process yet.Respectively to take and do not add IPTG obtained by 5 μ L The sample induced with addition IPTG, 12%SDS-PAGE gel electrophoresises and Western blot analysis expression effect, Western Primary antibody is that (His-Tag (2A8) Mouse mAb, M20001 is purchased from the biological doctors of Shanghai Ai Bimate to anti-HIS-Tag antibody in blot Medicine Co., Ltd) see Fig. 3-a and Fig. 3-b.
C) single-chain antibody P20 and P02 is purified
Using histidine-tagged affinity column purification of single stranded antibody P20 and P02, prepackage pillar selection is HisTrap HP, tool Body step is as follows：
Take single-chain antibody P20 and P02 recombination bacillus coli engineered strain glycerol tube and be inoculated according to 1% inoculum concentration and contain 50 In the LB fluid nutrient mediums of μ g/ml kanamycins, 37 DEG C, 220rpm adds final concentration of 1mM when cultivating to OD600 ≈ 1.0 IPTG carries out induced expression, and thalline is collected by centrifugation after induced expression 4h.PBS with precooling is resuspended, in 4 DEG C with 12000rpm, from Heart 15min；It is repeated once.Supernatant is sucked, claims bacterial sediment weight, every gram (thalline weight in wet base) to add 5mL combination buffers： 300mM NaCl, 20mM NaH2PO4,10mM Imidazole, pH=7.5.After fully mixing, every gram of (thalline weight in wet base) thalline 5 μ L 100mmol/L PMSF, 5 μ L 100mg/mL lysozymes are added to be incubated 20min on ice.Sample is placed on ice, uses sonde-type Ultrasonoscope crushes thalline, and ultrasound 120 times, each 5s is spaced 5s, circulates three times, and wait between cooling sample is recycled to every time 2min, waits sample cooling.4 DEG C, 12000rpm is centrifuged 15min, crosses 0.45 μm of filter membrane.
HisTrap HP affinity columns are purified：With fully-automatic intelligent protein purification system (AKTA avant150, purchased from GE Healthcare companies) affinity purification is carried out respectively to single-chain antibody P20 and the P02 cell pyrolysis liquid that above-mentioned pretreatment is obtained, Pillar is HisTrap HP (17-5248-02, purchased from GE healthcare companies).Combination buffer is 300mM NaCl, 20mM NaH2PO4, 10mM Imidazole, pH7.5, elution buffer is 300mM NaCl, 20mM NaH2PO4, 500mM Imidazole, pH7.5.Linear elution is carried out during wash-out, and collects each eluting peak.
By SDS-PAGE electroresis appraisal purity, merge purity satisfactory single-chain antibody P20 higher and P02 and collect Pipe, changes buffer solution and is PBS solution and is concentrated by ultrafiltration (1mg/ml) that filtration sterilization is saved backup in -20 DEG C.
Those skilled in the art know, recombinant protein can not tape label, also can also add other shapes with other labels The connection peptide of formula.Regardless of whether tape label or the label with multi-form all can be using the affine filler purifying of protein L.
The performance evaluation of the single-chain antibody of embodiment 4.
1. the Western blot identifications of single-chain antibody P20 and P02
A. polyacrylamide gel electrophoresis：It is respectively configured 12% non-denaturing polyacrylamide gel and SDS- polyacrylamides Gel；Difference loading standard protein and natural CRP albumen (buying in HyTest companies), electrophoresis 1 hour under constant pressure；
B. transferring film：Transferring film 1 hour, the protein on polyacrylamide gel is turned respectively under the conditions of constant current (35mA/ films) Move on nitrocellulose filter.Coomassie brilliant blue G250 is dyeed to the polyacrylamide gel for completing transferring film, observes albumen Residual condition；
C. close：TBST buffer blinds (confining liquid) containing 5% defatted milk, 4 DEG C overnight；Cleaning solution after closing (TBST, Refer to TaKaRa company's T BST buffer) wash three times, each 5min；
D. antigen-antibody reaction：Confining liquid dilution (presses 1:400 volume ratios) horseradish peroxidase-labeled P20 (P20- HRP, 1mg/mL, our company are marked using classical Over-voltage protection, similarly hereinafter) and horseradish peroxidase-labeled P02 (P02-HRP, 1mg/mL, our company is marked using classical Over-voltage protection, similarly hereinafter), it is separately added into above-mentioned nitrocellulose filter, room temperature reaction 1h；TBST is washed 5 times, each 5min；
E. develop the color and take pictures：Blot residual liquid on nitrocellulose filter, it is steady that every nitrocellulose filter is separately added into 2mL Sizing Peroxidase Solution (1mL) and the mixed liquor (buying in Thermo companies) of luminol/enhancing agent solution (1mL), The surface of even wetting nitrocellulose filter, room temperature lucifuge is reacted one minute and is clapped after gel imaging system (buying in GE companies) According to leaving and taking result.
Test result indicate that, the natural CRP reactions that two kinds of antibody of the present invention can be extracted with denaturation and non denatured blood, card Understand the adhesion of two kinds of antibody of the present invention and natural CRP.
2. evaluations of the single-chain antibody P20 and P02 in collaurum detection platform
The antibody purified in embodiment 3 is carried out into combinations of pairs, is matched respectively as coated antibody or labelled antibody Detection C reactive protein (CRP), detecting step is as follows：
1) P20 or single-chain antibody P02 are diluted to 1mg/ml with antibody coating buffer, are lined on nitrocellulose filter；
2) it is laid on pad after the P20 of colloid gold label or P02 being diluted into 5 times with 0.01M PB buffer solutions；
3) pad pasting as shown in accompanying drawing 5, slitting, is installed (specifically prepare referring to embodiment 5)
4) with Sample dilution dilute CRP standard items (buying in HyTest companies), to concentration be 50ug/mL, 1ug/mL, The two concentration standards and zero standard's product (i.e. Sample dilution) are added 50ul respectively in colloidal-gold detecting-card (P20 coating-P02 marks or P02 coating-P20 marks), being placed on detection card after 10min carries out reading on readout instrument.As a result It is as shown in the table：
From the above results, it is seen that the double antibody sandwich method that P20 is constituted as coated antibody, P02 as labelled antibody Detecting system can be applied to collaurum detection platform, carry out the detection of natural CRP.
The preparation of the colloid gold immune detection card of the anti-human C reactive protein of embodiment 5
1st, solution is prepared
1) prepared by 0.01M PB buffer solutions：Weigh Na2HPO4·12H2O 3.22g, NaH2PO4·2H2O 0.15g, plus it is pure Change water 1000mL, rotor is stirred to dissolving, counted with ph and determine its pH7.4 ± 0.1,0.45um membrane filtrations.
2) prepared by confining liquid：Bovine serum albumin(BSA) 5g, plus 0.01M PB solution (PH7.4 ± 0.1) 50mL are weighed, rotor is stirred Mix to dissolving.
3) prepared by antibody coating buffer：0.2mL isopropanols are taken, 9.8mL 0.01M PB solution (PH7.4 ± 0.1) is added, turned Son stirring 5-10min.
4) gold labeling antibody is redissolved liquid and is prepared：1g bovine serum albumin(BSA)s are weighed, 5g trehaloses add 100mL 0.01M PB molten Liquid (pH7.4 ± 0.1), rotor is stirred to dissolving, adds 25ul Tween-20, and continuation stirs 5-10min with rotor.
5) prepared by Sample dilution：Weigh 12.5g bovine serum albumin(BSA)s add 500mL 0.01M PB solution (PH7.4 ± 0.1), rotor is stirred to dissolving, adds 0.5ml Proclin300, and continuation stirs 5-10min with rotor.
2nd, prepared by Human C-reactiveprotein colloidal-gold detecting-card
1) mark of collaurum
The colloid gold label (by taking 1ml colloidal gold solutions mark as an example) of antibody P02：Use K2CO3Regulation collaurum pH value is (every 5ul 0.2M K are added in 1ml collaurums2CO3), 5-10min is stirred, to being slowly added to antibody P02 in colloidal gold solution (per 1ml 25ug antibody P02 are added in collaurum), stirring at low speed 30min；Add confining liquid BSA to its final concentration of 10% (quality percentage Than), stir 20min；Stand 12000rpm centrifugations 30min after 30min；Go supernatant 100uL gold labeling antibodies to redissolve liquid and redissolve to sink Shallow lake obtains final product the P02 antibody of colloid gold label.
2) gold standard pad and reaction film preparation
After P02 gold labeling antibodies are diluted into 5 times, it is sprayed in gold standard pad 6, drying for standby；
After antibody P20 antibody diluents are diluted into 1.5mg/mL, the T of reaction film 2 (nitrocellulose filter) is coated in The position of line 5；After anti-His tag antibodies antibody diluent is diluted into 0.2mg/mL, (the nitrocellulose of reaction film 2 is coated in Film) the position of C lines 4, reaction film drying for standby.
3) pad pasting, cut film, assembling
Sample pad 1, gold standard pad 6, the nitrocellulose filter 2 for being coated with antibody, adsorptive pads 3 are set gradually from left to right (as shown in Figure 5), and should contact a little between any two, the T lines 5 of the nitrocellulose filter for being coated with antibody are in left, C lines 4 On the right side, and cut according to shell size, loaded shell, completed detection blocking standby.
4) kit assembling
The detection card that will be assembled, drier is fitted into aluminium foil bag, heat sealing machine sealing, labels；
Sample dilution is dispensed by 1mL/ pipes, and is loaded valve bag according to kit specification, labelled；
According to trimmed size, by the interior bag of certain number, 1 valve bag containing Sample dilution, 1 part of specification, 1 conjunction Case marker label load in packing box, and label is posted outside packing box.
3rd, Human C-reactiveprotein colloidal-gold detecting-card application method
1) external packing is opened, detection card is taken out from sealing aluminium foil bag, be placed on flat table.
2) 2 μ l serum/plasma samples are drawn, is added in Sample dilution, be sufficiently mixed.
3) draw 50ul to be added in the well of detection card through the sample after treatment, 10min is stood at room temperature.
4) detection card is put into immunochromatography quantitative analysis instrument, presses " quick detection " key and start detection, instrument will be automatic Detection card is scanned.
5)/printing testing result is read from the display screen of immunochromatography quantitative analysis instrument.
4th, Human C-reactiveprotein colloidal-gold detecting-card Detection results assessment
1) accuracy：By P20 (coating)-P02 (mark) detection card by the application method detection 1,10,50ug/ml of detection card Each 10 replications of CRP reference materials, reject outlier after calculate detection card precision.Experimental result shows three concentration inspections Survey result coefficient of variation CV<15%.
2) detection range：By P20 (coating)-P02 (mark) detection card detection various concentrations CRP recombinant proteins 0.5, 1.56th, 3.125,6.25,12.5,25,50,100ug/mL, matched curve and detection range are 0.5-100ug/ml (such as accompanying drawings 6)。
3) range of linearity：High level sample and Sample dilution are configured to 5 series concentration samples according to a certain percentage 0.5th, 25,50,75,100ug/mL, card detection, each pattern detection 3 times, by result are detected with P20 (coating)-P02 (mark) Regression calculation is carried out with theoretical concentration, judges whether linear in the concentration range.The range of linearity be 0.5-100ug/ml (such as Accompanying drawing 7).Sensitivity 0.5ug/mL.
4) degree of accuracy：By P20 (coating)-P02 (mark) detection card by the application method detection 1,10,50ug/ml of detection card Each 3 repetitions of CRP reference materials, calculate the relative deviation of average value and theoretical value, experimental result shows three Concentration Testing knots Fruit relative deviation B<15%.
5th, the degree of accuracy-methodology is compared：
The Guangzhou Wondfo Biotech. Co., Ltd. for obtaining good prestige in selection like product in the market is complete Journey C reactive protein (hsCRP+ routines CRP) quantitative detecting reagent (immunochromatographic method) compares product comparison checking.Selection 20 Part clinical patient sample, by 1 to 20 serial number, with reference product and the glue of P20 (coating)-P02 (mark) to be evaluated Body gold detection card is tested simultaneously, according to 1,2,3......18,19,20,20,19,18......3,2,1 sample order It is measured.Control and the testing result coefficient R of product to be evaluated2=0.980, illustrate two methods testing result have compared with Good correlation (such as accompanying drawing 8).
6th, recipe determination
In addition to above-mentioned optimal preparation example 1, applicant also attempts various preparation schemes, such as several groups of detection blockings below it is standby and Using result such as following table：
SEQUENCE LISTING
<110>Jiangsu Zhonghong Biopharma Institute Inc.
<120>Anti-human C reactive protein antibody and its application
<130>Anti-human C reactive protein antibody and its application
<160> 24
<170> PatentIn version 3.3
<210> 1
<211> 8
<212> PRT
<213>Artificial sequence
<400> 1
Gly Phe Thr Phe Ser Ser Tyr Ala
1 5
<210> 2
<211> 8
<212> PRT
<213>Artificial sequence
<400> 2
Ile Ser Thr Ser Gly Ser Asp Arg
1 5
<210> 3
<211> 7
<212> PRT
<213>Artificial sequence
<400> 3
Ala Arg Arg Gly Trp Asp Tyr
1 5
<210> 4
<211> 11
<212> PRT
<213>Artificial sequence
<400> 4
Gln Ser Leu Val His Ser Asn Gly Asn Thr Tyr
1 5 10
<210> 5
<211> 3
<212> PRT
<213>Artificial sequence
<400> 5
Lys Val Ser
1
<210> 6
<211> 9
<212> PRT
<213>Artificial sequence
<400> 6
Ser Gln Asn Thr His Val Pro Pro Thr
1 5
<210> 7
<211> 114
<212> PRT
<213>Artificial sequence
<400> 7
Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Thr Pro Glu Arg Arg Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Thr Ser Gly Ser Asp Arg Tyr Tyr Pro Asp Ser Val
50 55 60
Lys Trp Arg Phe Thr Ile Ser Arg Asp Ser Ala Lys Asn Ile Leu Tyr
65 70 75 80
Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg Arg Gly Trp Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val
100 105 110
Ser Ala
<210> 8
<211> 112
<212> PRT
<213>Artificial sequence
<400> 8
Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly
1 5 10 15
Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser
20 25 30
Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Ser Gly Gln Ser
35 40 45
Pro Lys Leu Leu Leu Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Ser
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Asn
85 90 95
Thr His Val Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105 110
<210> 9
<211> 8
<212> PRT
<213>Artificial sequence
<400> 9
Gly Phe Thr Phe Ser Ser Tyr Ala
1 5
<210> 10
<211> 8
<212> PRT
<213>Artificial sequence
<400> 10
Ile Ser Thr Ser Gly Ser Asp Arg
1 5
<210> 11
<211> 7
<212> PRT
<213>Artificial sequence
<400> 11
Ala Arg Arg Gly Trp Asp Tyr
1 5
<210> 12
<211> 11
<212> PRT
<213>Artificial sequence
<400> 12
Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr
1 5 10
<210> 13
<211> 3
<212> PRT
<213>Artificial sequence
<400> 13
Lys Val Phe
1
<210> 14
<211> 9
<212> PRT
<213>Artificial sequence
<400> 14
Phe Gln Gly Ser Arg Asp Pro Pro Thr
1 5
<210> 15
<211> 114
<212> PRT
<213>Artificial sequence
<400> 15
Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Thr Pro Glu Arg Arg Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Thr Ser Gly Ser Asp Arg Tyr Tyr Pro Asp Ser Val
50 55 60
Lys Trp Arg Phe Thr Ile Ser Arg Asp Ser Ala Lys Asn Ile Leu Tyr
65 70 75 80
Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg Arg Gly Trp Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val
100 105 110
Ser Ser
<210> 16
<211> 112
<212> PRT
<213>Artificial sequence
<400> 16
Asp Val Leu Met Thr Gln Arg Pro Leu Ser Leu Pro Val Ser His Gly
1 5 10 15
Asp Gln Ala Ser Thr Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser
20 25 30
Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Lys Leu Leu Ile Tyr Lys Val Phe Asn Arg Phe Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Gln Gly Val Tyr Tyr Cys Phe Gln Gly
85 90 95
Ser Arg Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105 110
<210> 17
<211> 242
<212> PRT
<213>Artificial sequence
<400> 17
Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Thr Pro Glu Arg Arg Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Thr Ser Gly Ser Asp Arg Tyr Tyr Pro Asp Ser Val
50 55 60
Lys Trp Arg Phe Thr Ile Ser Arg Asp Ser Ala Lys Asn Ile Leu Tyr
65 70 75 80
Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg Arg Gly Trp Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val
100 105 110
Ser Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
115 120 125
Ser Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu
130 135 140
Gly Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His
145 150 155 160
Ser Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Ser Gly Gln
165 170 175
Ser Pro Lys Leu Leu Leu Tyr Lys Val Ser Asn Arg Phe Ser Gly Val
180 185 190
Ser Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys
195 200 205
Ile Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln
210 215 220
Asn Thr His Val Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile
225 230 235 240
Lys Arg
<210> 18
<211> 242
<212> PRT
<213>Artificial sequence
<400> 18
Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Thr Pro Glu Arg Arg Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Thr Ser Gly Ser Asp Arg Tyr Tyr Pro Asp Ser Val
50 55 60
Lys Trp Arg Phe Thr Ile Ser Arg Asp Ser Ala Lys Asn Ile Leu Tyr
65 70 75 80
Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg Arg Gly Trp Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val
100 105 110
Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
115 120 125
Ser Asp Val Leu Met Thr Gln Arg Pro Leu Ser Leu Pro Val Ser His
130 135 140
Gly Asp Gln Ala Ser Thr Ser Cys Arg Ser Ser Gln Ser Ile Val His
145 150 155 160
Ser Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln
165 170 175
Ser Pro Lys Leu Leu Ile Tyr Lys Val Phe Asn Arg Phe Ser Gly Val
180 185 190
Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys
195 200 205
Ile Ser Arg Val Glu Ala Glu Asp Gln Gly Val Tyr Tyr Cys Phe Gln
210 215 220
Gly Ser Arg Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile
225 230 235 240
Lys Arg
<210> 19
<211> 726
<212> DNA
<213>Artificial sequence
<400> 19
gaagttatgt tggttgaatc tggtggtggt ttggttaagc caggtggttc tttgaaattg 60
tcttgtgctg cttctggttt tactttctct tcttacgcta tgtcttgggt tagacaaact 120
ccagagagaa gattggaatg ggttgctact atttctactt ctggttctga tagatactat 180
cctgattctg ttaagtggag attcactatt tccagagatt ctgctaaaaa catcttgtac 240
ttgcaaatgt cttctttgag atctgaggat actgctatgt actattgtgc tagaagaggt 300
tgggattatt ggggtcaagg tacttctgtt actgtttctg ctggtggtgg tggttccgga 360
ggtggtggtt ctggtggtgg tggttctgat gttgttatga cccaaactcc attgtctttg 420
cctgtttctt tgggagatca agcttctatt tcttgtagat cttctcaatc tttggttcat 480
tctaacggta atacttactt gcactggtat ttgcaaaagt ctggtcaatc tcctaagttg 540
ttgttgtaca aagtttctaa cagattttct ggtgtttctg atagattctc tggttctggt 600
tctggtactg atttcacttt gaagatttcc agagttgagg ctgaagattt gggtgtttac 660
ttctgttctc aaaacactca tgttccacct actttcggtg gtggtactaa gttggaaatt 720
aaaaga 726
<210> 20
<211> 726
<212> DNA
<213>Artificial sequence
<400> 20
gaagttatgt tggttgaatc tggtggtggt ttggttaagc caggtggttc tttgaaattg 60
tcttgtgctg cttctggttt tactttctct tcttacgcta tgtcttgggt tagacaaact 120
ccagagagaa gattggaatg ggttgctact atttctactt ctggttctga tagatactat 180
cctgattctg ttaagtggag attcactatt tccagagatt ctgctaaaaa catcttgtac 240
ttgcaaatgt cttctttgag atctgaggat actgctatgt actattgtgc tagaagaggt 300
tgggattatt ggggtcaagg tacttctgtt actgtttctt ctggtggtgg tggatccgga 360
ggtggtggtt ctggtggtgg tggttctgat gttttgatga cccaaagacc attgtctttg 420
cctgtttctc atggagatca agcttctact tcttgtagat cttctcaatc tattgttcac 480
tctaacggta atacttactt ggagtggtat ttgcaaaagc caggtcaatc tcctaagttg 540
ttgatctaca aggtttttaa tagattctct ggtgttcctg atagattttc tggttctggt 600
tctggtactg atttcacttt gaagatttcc agagttgagg ctgaagatca aggtgtttac 660
tattgttttc aaggttccag agatccacct actttcggtg gtggtactaa gttggaaatt 720
aaaaga 726
<210> 21
<211> 29
<212> DNA
<213>Artificial primer
<400> 21
ctagccatgg aagttatgtt ggttgaatc 29
<210> 22
<211> 28
<212> DNA
<213>Artificial primer
<400> 22
ccgctcgagt tactagtgat ggtgatgg 28

Claims (8)

1. anti-human C reactive protein antibody, its weight chain variable district contains following complementary determining region：Amino acid sequence such as sequence SEQ ID NO：HCDR1, such as sequence SEQ ID NO shown in 9：HCDR2 and/or such as sequence SEQ ID NO shown in 10：Shown in 11 HCDR3；
Its light-chain variable sequence contains following complementary determining region：Amino acid sequence such as sequence SEQ ID NO：Shown in 12 LCDR1, such as sequence SEQ ID NO：LCDR2 and/or such as sequence SEQ ID NO shown in 13：LCDR3 shown in 14.
2. the anti-human C reactive protein antibody described in claim 1, it is characterised in that the amino acid sequence of weight chain variable district such as SEQ ID NO:Shown in 15, the amino acid sequence such as SEQ ID NO of light chain variable district:Shown in 16.
3. anti-human C reactive protein single-chain antibody, the amino acid sequence such as SEQ ID NO of the single-chain antibody:Shown in 18.
4. the nucleotide sequence of single-chain antibody described in claims 3, such as SEQ ID NO are encoded:Shown in 20.
5. the expression vector of nucleotide sequence described in claim 4 is contained.
6. the recombinant host cell of expression vector described in claim 5 is contained.
7. the method for producing single-chain antibody described in claim 3, including：
1) above-mentioned recombinant host bacterium expression antibody is cultivated under suitable conditions；
2) and then from Host Strains purify, collect antibody.
8. application of the anti-human C reactive protein antibody described in any one of claims 1 to 3 in Human C-reactiveprotein content is detected.
CN201710037811.2A 2017-01-19 2017-01-19 Anti-human C-reactive protein antibody and application thereof Active CN106699884B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710037811.2A CN106699884B (en) 2017-01-19 2017-01-19 Anti-human C-reactive protein antibody and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710037811.2A CN106699884B (en) 2017-01-19 2017-01-19 Anti-human C-reactive protein antibody and application thereof

Publications (2)

Publication Number Publication Date
CN106699884A true CN106699884A (en) 2017-05-24
CN106699884B CN106699884B (en) 2020-04-17

Family

ID=58907022

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710037811.2A Active CN106699884B (en) 2017-01-19 2017-01-19 Anti-human C-reactive protein antibody and application thereof

Country Status (1)

Country Link
CN (1) CN106699884B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2704128C1 (en) * 2018-08-02 2019-10-24 Федеральное государственное бюджетное учреждение Национальный Медицинский Исследовательский Центр Кардиологии (ФГБУ "НМИЦ кардиологии" Минздрава России) Method for measuring concentration of monomer c-reactive protein on the surface of blood cells
CN112724251A (en) * 2019-10-28 2021-04-30 东莞市朋志生物科技有限公司 Binding protein containing C-reactive protein antigen binding domain
CN114761561A (en) * 2019-11-29 2022-07-15 东洋纺株式会社 Recombinant C-reactive protein
CN114773462A (en) * 2022-04-12 2022-07-22 内蒙古农业大学 Recombinant single-chain antibody for detecting bovine CRP protein and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102866256A (en) * 2012-04-23 2013-01-09 深圳市希莱恒医用电子有限公司 Detection method and detection reagent for hypersensitive C reactive protein
CN104330577A (en) * 2014-11-17 2015-02-04 南方医科大学南方医院 C-reactive protein quantitative determination kit and preparation method thereof
CN104630151A (en) * 2015-01-19 2015-05-20 中国农业大学 Monoclonal antibody for detecting porcine C-reactive protein (CRP)
CN105158476A (en) * 2015-06-03 2015-12-16 南京闻智生物科技有限公司 Full-scale range C-reactive protein latex-enhanced immunoturbidimetry detection kit

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102866256A (en) * 2012-04-23 2013-01-09 深圳市希莱恒医用电子有限公司 Detection method and detection reagent for hypersensitive C reactive protein
CN104330577A (en) * 2014-11-17 2015-02-04 南方医科大学南方医院 C-reactive protein quantitative determination kit and preparation method thereof
CN104630151A (en) * 2015-01-19 2015-05-20 中国农业大学 Monoclonal antibody for detecting porcine C-reactive protein (CRP)
CN105158476A (en) * 2015-06-03 2015-12-16 南京闻智生物科技有限公司 Full-scale range C-reactive protein latex-enhanced immunoturbidimetry detection kit

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2704128C1 (en) * 2018-08-02 2019-10-24 Федеральное государственное бюджетное учреждение Национальный Медицинский Исследовательский Центр Кардиологии (ФГБУ "НМИЦ кардиологии" Минздрава России) Method for measuring concentration of monomer c-reactive protein on the surface of blood cells
CN112724251A (en) * 2019-10-28 2021-04-30 东莞市朋志生物科技有限公司 Binding protein containing C-reactive protein antigen binding domain
CN114761561A (en) * 2019-11-29 2022-07-15 东洋纺株式会社 Recombinant C-reactive protein
CN114761561B (en) * 2019-11-29 2024-04-30 东洋纺株式会社 Recombinant C-reactive protein
CN114773462A (en) * 2022-04-12 2022-07-22 内蒙古农业大学 Recombinant single-chain antibody for detecting bovine CRP protein and application thereof
CN114773462B (en) * 2022-04-12 2023-07-07 内蒙古农业大学 Recombinant single-chain antibody for detecting bovine CRP protein and application thereof

Also Published As

Publication number Publication date
CN106699884B (en) 2020-04-17

Similar Documents

Publication Publication Date Title
CN106699884A (en) Anti-human C-reactive protein antibody and application thereof
CN109734803B (en) Anti-human MYO antibody and application thereof in detection kit
CN106596976B (en) Human C-reactiveprotein colloidal gold quantitative test card
CN110028582A (en) Anti-human d-dimer antibody and its application
CN105713091B (en) Anti-human CRP antibody and its application
CN106093431B (en) Human calcitonin original collaurum quantitative test card
CN110078823A (en) Anti-human D-Dimer antibody and its application
CN106749659A (en) A kind of anti-human CRP antibody and its application
CN108318695A (en) People RBP colloidal gold immunochromatographimethod quantitative testing test paper cards and its clinical application
CN105842440B (en) People&#39;s C reactive protein fluorogenic quantitative detection test cards
CN107383198A (en) A kind of anti-human CysC antibody and its application
CN107607726A (en) Human cystatin C collaurum quantitative test card
CN109608542A (en) Anti-human NGAL antibody and its application in Test paper card
CN109553682A (en) Anti-human neutrophil gelatinase-associated lipocalin antibody and its application in Test paper card
CN105949309B (en) Anti-human C reactive protein antibody and its application
CN111763255B (en) Genetically modified VEGFA protein, monoclonal antibody thereof and application
CN112876562B (en) Anti-human serum albumin antibody and application thereof
CN105440137B (en) The antibody of anti-Ractopamine and its application
CN109721655B (en) Anti-human myoglobin antibody and application thereof in detection kit
CN109725151B (en) Human myoglobin detection test paper card and clinical application thereof
CN110007094A (en) People&#39;s d-dimer quantitative test card and its clinical application
CN105949312B (en) Anti-human PCT antibody and its application
CN108359010A (en) Anti-human RBP ELISA antibody and its application
CN104830805B (en) Anti-human Clonorchiasis Sinensis monoclonal antibody hybridoma and its monoclonal antibody and application
CN109709340A (en) Human neutrophil gelatinase-associated lipocalin quantitative test card and its clinical application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information
CB02 Change of applicant information

Address after: 213125, Yunhe Road, Xinbei District, Jiangsu, Changzhou, 518

Applicant after: ZonHon Biopharma Institute Inc.

Applicant after: Changzhou Gensun Institute of Biomedicine Co., Ltd.

Address before: 213125 Jiangsu city of Changzhou Province Cloud River New District No. 518 Changzhou Qianhong biochemical pharmaceutical biological all red

Applicant before: ZonHon Biopharma Institute Inc.

Applicant before: Changzhou Gensun Institute of Biomedicine Co., Ltd.

CB02 Change of applicant information
CB02 Change of applicant information

Address after: 213125 No. 518 Yunhe Road, Xinbei District, Changzhou City, Jiangsu Province

Applicant after: ZonHon Biopharma Institute Inc.

Applicant after: Jiangsu Jingsen Biomedical New Materials Technology Co., Ltd.

Address before: 213125 No. 518 Yunhe Road, Xinbei District, Changzhou City, Jiangsu Province

Applicant before: ZonHon Biopharma Institute Inc.

Applicant before: Changzhou Gensun Institute of Biomedicine Co., Ltd.

TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20190611

Address after: 213125 No. 518 Yunhe Road, Xinbei District, Changzhou City, Jiangsu Province

Applicant after: ZonHon Biopharma Institute Inc.

Address before: 213125 No. 518 Yunhe Road, Xinbei District, Changzhou City, Jiangsu Province

Applicant before: ZonHon Biopharma Institute Inc.

Applicant before: Jiangsu Jingsen Biomedical New Materials Technology Co., Ltd.

GR01 Patent grant
GR01 Patent grant