CN112876562B - Anti-human serum albumin antibody and application thereof - Google Patents

Abstract

The invention relates to an anti-human serum albumin antibody, a preparation method thereof and application of the antibody in quantitative detection of human urine microalbumin. The sensitivity, specificity and the like of the antibody provided by the invention can meet the requirements; meanwhile, the preparation method is convenient for mass production and can meet the requirement of large-scale clinical application in the future. The antibody is subjected to debugging and optimizing work of a detection system, and the colloidal gold immunochromatographic quantitative detection card for the microalbumin in urine, which is simple and convenient to operate, has sensitivity, specificity and related detection performance and can meet the requirement of human urine sample detection, is obtained.

Description

Anti-human serum albumin antibody and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an anti-Human Serum Albumin (HSA) antibody, a preparation method thereof and application of the antibody in quantitative detection of Human urinary microalbumin.

Background

Human Serum Albumin (HSA) is a normal protein component of human body, is a soluble protein in the human body circulatory system, and plays a great role in regulating colloid osmotic pressure, nourishing, promoting wound healing and the like. HSA can also be used as a carrier substance to participate in the transportation function of the drug in vivo, and the biological half-life period is 14-20 days. HSA has a large molecular weight and normally cannot cross the glomerular basement membrane, and therefore, it contains albumin only at a very low concentration in healthy human urine, specifically, not more than 20mg per liter of urinary albumin. When a disease (such as hypertension or diabetes or both) occurs, the renal blood vessels are diseased to change the function of the kidney filtered proteins (especially albumin), which allows the proteins to leak into the urine, i.e. trace albumin can be detected in the urine. Urinary Microalbumin (MAU) is an indication of early kidney damage in diabetic nephropathy, hypertensive nephropathy, and the like. The microalbumin in urine caused by any disease is the damage of the kidney cells, and is the manifestation of the change of the structure of the kidney cells and the change of the function of the kidney cells along with the change of the structure in urine. In clinic, urinary microalbumin index is often used to monitor the occurrence of renal disease. Urinary microalbumin is the most sensitive and reliable diagnostic index for early detection of nephropathy. The disease condition can be accurately diagnosed by the numerical value of the microalbuminuria and the combination of the disease condition, symptoms and medical history, and the stage of the disease condition is judged, thereby being beneficial to the reasonable design of a treatment scheme by a clinician. Urine microalbumin is also a sign of changes throughout the vascular system and can be considered a "window" for arterial lesions. Based on the huge base, the young and the annual increase of the prevalence rate of diabetes patients in China and the important role of urine microalbuminuria in early kidney damage indication, some domestic authoritative nephrologists advocate that early prevention of microalbuminuria is about to start from young to young.

In view of the important function of urine microalbumin detection, the preparation of the anti-human serum albumin antibody and the preparation of the human urine microalbumin quantitative detection kit have important clinical application value.

Disclosure of Invention

The technical problem to be solved by the invention is to provide an antibody capable of effectively and specifically binding human serum albumin. More specifically:

the first object of the present invention is to provide an anti-human serum albumin antibody, wherein the heavy chain variable region comprises the following complementarity determining regions: the amino acid sequence is shown as the sequence SEQ ID NO:1, HCDR1 as set forth in sequence SEQ ID NO: 2 and/or HCDR2 as shown in SEQ ID NO: HCDR3 shown at 3; and a light chain variable region sequence thereof comprising the following complementarity determining regions: the amino acid sequence is shown as the sequence SEQ ID NO: 4, LCDR1 shown as a sequence SEQ ID NO: 5 and/or LCDR2 as shown in sequence SEQ ID NO: LCDR3 shown in fig. 6.

Preferably, the amino acid sequence of the heavy chain variable region of the antibody is represented by SEQ ID NO. 7, and the nucleotide sequence encoding the heavy chain variable region is represented by SEQ ID NO. 8; the amino acid sequence of the antibody light chain variable region is shown as SEQ ID NO. 9, and the nucleotide sequence for coding the light chain variable region is shown as SEQ ID NO. 10.

Preferably, the invention provides a single-chain antibody, the amino acid sequence of which is shown as SEQ ID NO. 11, and the nucleotide sequence of which is shown as SEQ ID NO. 12 and is used for coding the single-chain antibody.

The second object of the present invention is to provide an expression vector containing the above nucleotide sequence.

The third purpose of the invention is to provide a recombinant host bacterium containing the expression vector.

It is a fourth object of the present invention to provide a method for producing the above single-chain antibody, comprising:

1) culturing the recombinant host bacteria under proper conditions to express the antibody;

2) then purifying and collecting the antibody from the host bacteria.

The fifth object of the present invention is to provide the use of the above anti-human serum albumin antibody for detecting the microalbuminuria content.

The sixth purpose of the invention is to provide a colloidal gold immunochromatographic assay quantitative detection card for detecting human urine microalbumin by using the anti-human serum albumin antibody, which comprises a sample absorption pad, a gold label pad, a reaction membrane and a water absorption pad; the gold-labeled pad is sprayed with an antibody labeled by colloidal gold particles, the reaction membrane is provided with a detection zone and a quality control zone, the position of the detection zone is coated with an antigen, and the position of the quality control zone is coated with an anti-His tag antibody or Protein L. The reaction membrane is preferably a nitrocellulose membrane. The anti-His tag antibody is preferably a murine anti-His antibody.

The invention provides an antibody which has sensitivity and specificity meeting the requirements; meanwhile, the preparation method is convenient for mass production and can meet the requirement of large-scale clinical application in the future. The antibody is subjected to debugging and optimizing work of a detection system, and the colloidal gold immunochromatographic quantitative detection card for the microalbumin in urine, which is simple and convenient to operate, has sensitivity, specificity and related detection performance and can meet the requirement of human urine sample detection, is obtained.

Drawings

FIG. 1 is a diagram showing the effect of the antibody MU06 on the specific detection (Western Blot). Lane 1 is the standard protein (Marker) and lane 2 is recombinant human serum albumin.

FIG. 2 is a schematic view of a colloidal gold test card

FIG. 3 example 6 detection Range fitting curves

FIG. 4 example 6 Linear Range fitting Curve

Detailed Description

Definition of

"antibody", also known as immunoglobulin, is a large Y-shaped protein secreted by B lymphocytes, and is an immunoglobulin molecule capable of specifically binding to a target antigen, such as a protein, a sugar, a polynucleotide, a lipid, a polypeptide, a small molecule compound, etc., through complementary sites (antigen-binding sites) at the two bifurcated tips of the Y.

"Single chain antibody" (scFv) refers to the variable region of the heavy chain (V) of an antibody_H) And light chain variable region (V)_L) A single-chain fusion protein is formed by connecting 15-20 amino acid short peptides (linkers), and the linkers used for connection are usually rich in glycine and serine, so that the stability and flexibility of a single-chain antibody are facilitated. The connection mode can be V_LIs connected to V_HC-terminal, or vice versa. Despite the removal of the constant region and the introduction of the linker, the single-chain antibody retains the specificity of the antibody to the antigen, and has the characteristics of small molecular weight, strong penetration, weak antigenicity and the like.

Complementary-determining regions (CDRs), also called hypervariable regions. Patterned at the amino acid end of the antibody monomer is the most critical region for binding of the target antigen to the antibody, and in immune network theory, the complementarity determining regions of each antibody are also called idiotypes or genotypes.

Example 1 preparation of anti-human serum Albumin hybridoma cell lines

1. Animal immunization

BALB/c female mice (purchased from Calvens laboratory animals Co., Changzhou) were immunized with recombinant human serum albumin (purchased from Sigma) following the general immunization protocol. For specific immunization, see "guidelines for antibody preparation and use". And tracking the serum titer of the immune mice by adopting an indirect ELISA method, selecting the immune mice with the highest serum titer, and performing fusion experiments on the spleen cells and myeloma cells of the mice.

2. Cell fusion

(1) Preparation of spleen cells

Immunized mice, eyeballs are picked and blood is taken, after cervical vertebra is cut off, the immunized mice are placed in 75% (v/v) alcohol for soaking for 10 minutes, spleens of the immunized mice are taken out from a sterile operating platform, the spleens are placed in a cell screen, cells are fully ground, the cells are screened, the spleen is centrifugally washed for a plurality of times by using sterile 1640 culture medium (purchased from Gibco company), and then the cells are resuspended to prepare single cell suspension, and the single cell suspension is counted for standby.

(2) Preparation of feeder cells

Taking one female BALB/c mouse 8-10 weeks old, picking an eyeball to obtain negative serum, and immersing the negative serum in 75% (v/v) alcohol for 10 minutes after the cervical vertebra is cut off; the abdominal skin was aseptically peeled, the peritoneum was exposed, and about 10mL of 1640HT medium (purchased from SIGMA) was injected into the abdominal cavity of the mouse with a syringe, and the abdomen was gently massaged and air-blown several times. Sucking the culture medium containing the macrophages and injecting the culture medium into 20% 1640HAT culture medium for later use;

taking one female BALB/c mouse with the age of 2-3 weeks, and immersing the mouse in 75% (v/v) alcohol for 10 minutes after the mouse dies after cervical vertebra breakage; aseptically placing thymus into a cell screen, grinding, sieving to obtain thymocytes, and placing the thymocytes into the 20% 1640HAT culture medium containing macrophages for later use.

(3) Cell fusion

Mouse myeloma cell line SP2/0 was selected at the logarithmic growth phase and collected and counted. Get about 10⁸The above spleen cells were combined with 2X 10⁷Each of the above SP2/0 cell lines was mixed in a fusion tube, centrifuged at 1000rpm for 10 minutes, and the supernatant was discarded (discarded as clean as possible), and the fusion tube was gently rubbed back and forth on the palm of the hand to loosen the pellet. 1mL of preheated PEG1450 (polyethylene glycol 1450, available from SIGMA) was added slowly and quickly over 60 seconds, 30mL of 1640HT medium was added and stopped, centrifuged at 1000rpm for 10 minutes, the supernatant was removed, the precipitate was loosened by gentle rubbing, and added to 20% of 1640HAT medium obtained in step 2.

Mixing the HAT culture medium, subpackaging at 200 μ L/well into 96-well cell culture plate, standing at 37 deg.C and 5% CO₂Cultured in a cell culture box. After one week, 20% 1640HAT medium was replaced with 10% 1640HT medium, and after 3 days, the supernatant was examined.

3. Screening of anti-human serum albumin specific hybridoma

(1) Preparation of the test plate: diluting recombinant human serum albumin (purchased from Sigma) to 1 mu g/mL by using CB coating solution, coating a 96-hole ELISA (enzyme-linked immunosorbent assay) plate at 100 mu L/hole, coating overnight at 2-8 ℃, washing and patting dry once; PBST buffer containing 2% casein was blocked (200 ul/well), at 37 ℃ for 2 hours; patting dry for later use.

(2) Screening of positive clones: adding 100 mu L/hole of cell culture supernatant to be detected into the detection plate,subjecting to 37 deg.C for 30min, washing, drying, adding 100 μ L/well HRP-labeled goat anti-mouse IgG, subjecting to 37 deg.C for 30min, washing, drying, adding 100 μ L/well TMB developing solution, developing at 37 deg.C in dark for 15 min, adding 50 μ L of 2M H per well₂SO₄The reaction was stopped and the value read at OD 450. Positive well determination principle: OD450 value/negative control value is not less than 2.1. Selecting positive clone strains to carry out cell cloning screening. After three to four rounds of cloning screening, the positive rate of the monoclonal cell strain is determined to be a stable cell strain with 100 percent of positive rate, and the cell strain is determined. The hybridoma cell strain H06 has high titer, and then the hybridoma cell strain is further subjected to antibody variable region sequence sequencing analysis.

Example 2 determination of variable region sequences of antibodies of hybridoma cell lines

The sequences of the antibody variable regions of the hybridoma cell line H06 were determined.

Extraction of RNA: the hybridoma cell line H06 was subjected to total RNA extraction and immediately reverse transcription with reference to the instructions of a cell total RNA extraction kit (purchased from Roche);

reverse transcription of RNA into DNA: performing reverse transcription on the total RNA extracted in the previous step by referring to Thermo Scientific reversed First strand cDNA Synthesis Kit (purchased from Thermo company), preparing cDNA, and freezing and storing at-20 ℃ for later use;

c. PCR amplification and recovery of variable region sequences: taking the cDNA obtained in the previous step as a template, taking a universal primer of a mouse IgG subtype monoclonal antibody variable region sequence as a primer, carrying out PCR amplification on the variable region sequences of the heavy chain and the light chain, and recovering a PCR product by a DNA gel recovery kit (purchased from TIANGEN company);

d. cloning and sequencing of variable region sequences: the heavy and light chain variable region genes were ligated to pMD18-T vector, respectively, according to the instructions of the cloning vector pMD18-T kit (available from Takara), E.coli DH 5. alpha. was transformed, and positive clones were picked and submitted to Kingsry Biotech Ltd. for sequencing.

The amino acid sequence of the heavy chain variable region of the antibody of the hybridoma cell strain H06 obtained by sequencing is shown as SEQ ID NO 7, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO: shown in fig. 8. The Vbase2 database analyzes the above sequences, and the amino acid sequences of the complementarity determining regions of the heavy chain variable region are: as shown in sequence SEQ ID NO:1, HCDR1 as set forth in sequence SEQ ID NO: 2 and/or HCDR2 as shown in SEQ ID NO: HCDR3 shown at 3; the amino acid sequence of each complementarity determining region of the light chain variable region is: as shown in sequence SEQ ID NO: 4, LCDR1 shown as a sequence SEQ ID NO: 5 and/or LCDR2 as shown in sequence SEQ ID NO: LCDR3 shown in fig. 6.

Example 3 recombinant expression and purification of Single chain antibodies

According to the sequencing results in example 2, a linker peptide (GGGGS) was added between the heavy and light chain variable regions of the antibody of hybridoma cell line H06₃Six histidines are introduced, and the whole gene is subjected to a codon optimization method according to the preference of a pichia pastoris expression system to carry out the recombination expression of the single-chain antibody. The expressed antibody was designated antibody MU06, and its structural composition is shown. The recombinant expression of the single-chain antibody is specifically as follows:

1. construction of expression plasmid for fusion protein Gene

The gene sequence of the antibody MU06 after codon optimization is shown as SEQ ID NO. 12, and the amino acid sequence is shown as SEQ ID NO. 11. Introducing the upstream of the optimized fragment synthesized by the MU06 whole gene of the antibody into a DNA sequence after an XhoI sequence in a pPICZ alpha A Vector, introducing an XbaI restriction site at the downstream, and constructing into a pMD19-T Simple Vector plasmid (purchased from Invitrogen company) to obtain a long-term storage plasmid, wherein the plasmid is marked as pMD19-MU06-scFv- (HIS)₆. Performing PCR amplification, wherein

The upstream primer P1 is CGCCAGGGTTTTCCCAGTCACGAC;

the downstream primer P2 is AGCGGATAACAATTTCACACAGGA.

After a conventional PCR procedure, agarose gel electrophoresis analysis revealed that the product size was consistent with the expected size (790 bp). After recovery and purification of the PCR-derived gene products, XhoI (# R0146S, available from New England Biolabs) and XbaI (# R0145V, available from New England Biolabs) were used for double digestion, ligated into pPICZ. alpha.A (V19520, available from Invitrogen) plasmid using T4 ligase, and transformedTo DH 5. alpha. competent cells, they were cultured overnight at 37 ℃ in LB plates containing Zeocin (R250-01, purchased from Invitrogen). The next day, positive clone bacteria are screened, sequenced, compared and completely consistent with the expected sequence, and the expression plasmid of the antibody MU06 is obtained and is marked as pPICZ alpha-MU 06-scFv- (HIS)₆。

2. Construction, screening and expression of fusion protein gene in pichia host engineering strain

YPDS solid medium preparation: refer to the Invitrogen company EasySelectPichia Expression Kit Specification; pichia competent cells: refer to the EasySelectPichia Expression Kit Specification; preparing a BMGY culture medium: refer to the Multi-Copy Pichia Expression Kit Specification by Invitrogen; preparing a BMMY culture medium: refer to the Multi-Copy Pichia Expression Kit Specification by Invitrogen.

Mixing pPICZ alpha-MU 06-scFv- (HIS)₆The plasmid was linearized by restriction with SacI restriction enzyme. After ethanol precipitation, the linearized vector is electrically transformed into X-33 competent yeast cells, spread on YPDS solid medium containing Zeocin and cultured at 30 ℃ for 3-5 days, and then positive clones are generated.

The single clone obtained above was picked up and cultured to OD at 30 ℃ in 5mL of BMGY medium₆₀₀When the bacterial strain is 2.0-6.0, taking 1mL of the preserved strain, re-suspending the residual bacterial liquid, transferring the residual bacterial liquid to BMMY for small-amount induction expression, and supplementing methanol every 24 hours until the final concentration is 1% (v/v). After one week, the supernatant of the bacterial liquid is collected by centrifugation, and the expression condition of the target protein is observed by SDS-PAGE gel electrophoresis and protein immunoblot analysis (Western blot). The primary antibody in Western blot was an anti-HIS-Tag antibody (His-Tag (2A8) Mouse mAb, M20001, available from Eibogam biopharmaceutical (Shanghai) Co., Ltd.).

Inoculating the obtained MU06 recombinant fusion protein gene engineering strain in BMGY culture medium, culturing at 30 deg.C and 220rpm until the thallus density reaches OD₆₀₀Methanol was added every 24 hours to a final concentration of 1.0% (v/v) 2.0 to 6.0. After one week, the fermentation broth was collected.

3. Purification of fusion proteins

The antibody MU06 fusion protein was purified using a histidine-tag affinity column, and HisTrap HP was selected as the pre-packed column, and the specific steps were as follows:

(1) impurity removal pretreatment of fermentation liquor: supernatant of antibody MU06 fusion protein fermentation liquid obtained by the expression is centrifuged and collected, and binding buffer is added to make the final concentration of the supernatant 300mM NaCl and 20mM NaH₂PO₄10mM Imidazole, pH7.5 adjusted, and filtered through a 0.45 μm filter.

(2) HisTrap HP affinity column purification: the antibody MU06 fusion protein fermentation broth obtained from the pretreatment was subjected to affinity purification using a fully automated intelligent protein purification system (AKTA avant150, available from GE healthcare Co.), and the column was HisTrap HP (17-5248-02, available from GE healthcare Co.). The binding buffer was 300mM NaCl, 20mM NaH₂PO₄10mM Imidazole, pH7.5, and elution buffer 300mM NaCl, 20mM NaH₂PO₄500mM Imidazole, pH 7.5. Linear elution was performed during elution and the individual elution peaks were collected. The purity is identified by SDS-PAGE electrophoresis, and the purified protein has the purity of more than 95 percent; the collection tubes meeting the requirements are combined, the buffer solution is changed into a PBS solution, ultrafiltration concentration (1mg/ml) is carried out, and the mixture is filtered and sterilized and stored at the temperature of minus 20 ℃ for standby.

Example 4 evaluation of antibody Performance

1. Western blot identification of antibody MU06

a. Polyacrylamide gel electrophoresis: preparing 12% separation gel and 5% concentrated gel, loading standard protein and human serum albumin (purchased from Sigma company), and performing electrophoresis at constant pressure for 1 hr;

b. film transfer: the membrane was rotated for 1 hour under constant current (35 mA/membrane) to transfer the proteins on the polyacrylamide gel to a nitrocellulose membrane. Staining SDS-PAGE gel subjected to membrane transfer by Coomassie brilliant blue G250, and observing the residual condition of protein;

c. and (3) sealing: TBST buffer containing 5% skimmed milk was blocked (blocking solution) overnight at 4 ℃; washing with a washing solution (TBST, for details, TBST buffer of TaKaRa) once for 10 minutes after blocking;

d. antigen-antibody reaction: diluting a blocking solution (according to a volume ratio of 1: 1000), labeling MU06(MU06-HRP, 1mg/mL, the company adopts a classic sodium periodate method for labeling), adding the diluted blocking solution into the nitrocellulose membrane, and reacting for 1 hour at room temperature; TBST washes 5 times for 10 minutes each;

e. and (3) color development and photographing: sucking up residual liquid on the nitrocellulose membrane, adding a mixed solution (purchased from Thermo company) of 2mL of a stable peroxidase solution (1mL) and a luminol/enhancer solution (1mL) into the nitrocellulose membrane, uniformly wetting the surface of the nitrocellulose membrane, carrying out a reaction at room temperature in a dark place for one minute, and then photographing in a gel imaging system (purchased from GE company) (figure 1) to obtain a result.

The detection result shows that the antibody MU06 has better specificity and can specifically detect human serum albumin.

Example 5 evaluation of the Single chain antibody MU06 on a colloidal gold assay platform

The purified antibody in example 3 is paired with a coating antigen, the purified antibody is used as a labeled antibody, and pairing detection of the urine Microalbumin (MAU) is carried out, wherein the detection steps are as follows:

1) diluting MAU Antigen to 0.2mg/ml with streaking coating solution, streaking on nitrocellulose membrane;

2) re-dissolving the colloidal gold-labeled MU06 to the original volume by using Tris-HCl buffer solution, and spraying gold;

3) pasting, slitting and clipping the film as shown in the figure (see example 6 for concrete preparation)

4) Diluting MAU standard substance (manufactured by Zhonghong) with sample diluent to concentration of 100mg/L and 30mg/L, respectively adding 50ul of the two concentration standard substances and zero concentration standard substance (namely sample diluent) into a colloidal gold detection card, and after 10min, placing the detection card on a reading instrument for reading. The results are shown in the following table:

from the above results, it can be seen that the competitive assay detection system composed of MAU Antigen as a coating Antigen and MU06 as a labeled antibody can be applied to a colloidal gold detection platform for MAU detection.

EXAMPLE 6 preparation of anti-human urine microalbumin colloidal gold immunoassay card

1. Solution preparation

1)0.01M PBS buffer preparation: weighing Na₂HPO₄ 1.44g，KH₂PO₄0.24g, KCl 0.2g, NaCl 8g, adding purified water 1000ml, rotor stirring to dissolve, with pH meter to determine its pH7.4 + -0.1.

2)0.05M Tris-HCl solution is prepared by weighing 6.06g Tris, adding 1000ml purified water, adding 2.1ml concentrated hydrochloric acid, stirring with a rotor until dissolved, and measuring its pH value with a pH meter to 8.0 + -0.1.

3) Preparing a sealing liquid: weighing 5g of bovine serum albumin, adding 50ml of purified water, and stirring by a rotor until the bovine serum albumin is dissolved.

4) Preparing an antigen diluent: 0.2ml of isopropanol was aspirated and added to 9.8ml of 0.01M PBS (pH 7.4. + -. 0.1) solution and mixed well.

5) Preparing a gold-labeled antibody re-solution: weighing 1g bovine serum albumin and 8g trehalose, adding 100ml 0.05M Tris-HCl solution (pH8.0 + -0.1), stirring with rotor until dissolved, adding 100ul Tween-20, and stirring with rotor for 5-10 min.

6) Preparation of sample diluent: 500ml of 0.05M Tris-HCl solution (pH 8.0. + -. 0.1) was measured, and 0.5ml of Proclin300 was added thereto, followed by stirring with a rotor for 5 to 10 min.

2. Preparation of human urine microalbumin colloidal gold test card

1) Labeling of colloidal gold

Colloidal gold labeling of antibody MU06 (example labeled with 1ml colloidal gold solution): by K₂CO₃Adjusting the pH value of the colloidal gold (9 ul of 0.2M K is added into each 1ml of the colloidal gold)₂CO₃) Stirring for 5-10min, slowly adding antibody MU06 (10 ug antibody MU06 per 1ml colloidal gold), and stirring at low speed for 30 min; adding the blocking solution BSA to the solution until the final concentration is 10% (mass percent), and stirring for 20 minutes; standing for 30min, and centrifuging at 12000rpm for 30 min; removing supernatant, and re-dissolving the precipitate with 70ul of gold-labeled antibody re-solution to obtain colloidal gold-labeled MU06 antibody.

2) Gold label pad and reaction film preparation

Spraying the re-dissolved MU06 gold-labeled antibody on the gold-labeled pad 6, and drying for later use;

MAU Antigen is diluted to 0.2mg/ml by using an Antigen diluent and then coated on the position of a T line 5 of a reaction membrane 2 (a nitrocellulose membrane); after the anti-His tag antibody is diluted to 0.15mg/ml with an antibody diluent, the antibody is coated on the position of the C line 4 of the reaction membrane 2 (nitrocellulose membrane), and the reaction membrane is dried for later use.

3) Sticking, cutting and assembling film

The sample pad 1, the gold-labeled pad 6, the nitrocellulose membrane 2 coated with the antibody and the absorbent pad 3 are sequentially arranged from left to right (as shown in figure 2), and are slightly contacted with each other, the T line 5 of the nitrocellulose membrane coated with the antibody is arranged on the left, the C line 4 is arranged on the right, the nitrocellulose membrane coated with the antibody is cut according to the size of the shell, and the nitrocellulose membrane is loaded into the shell, so that the preparation of the detection card is completed.

4) Kit assembly

Packing the assembled detection card and drying agent into an aluminum foil bag, sealing the aluminum foil bag by a heat sealing machine, and labeling;

subpackaging the sample diluent according to 450 ul/tube, filling the sample diluent into a self-sealing bag according to the specification of the kit, and labeling;

according to the specification of a finished product, putting a certain number of parts of inner bags, 1 self-sealing bag containing sample diluent, 1 part of specification and 1 qualified label into a packaging box, and sticking the label outside the packaging box.

3. Method for using human urine microalbumin colloidal gold detection card

1) The outer package was opened and the test card was removed from the sealed aluminum foil pouch and placed on a flat table.

2) Draw 50 μ l urine sample, add to sample dilution, mix well.

3) 50ul of the treated sample was taken and added to the well of the test card, and allowed to stand at room temperature for 10 min.

4) The detection card is put into an immunochromatographic quantitative analyzer, the detection is started by pressing a 'quick detection' key, and the detection card is automatically scanned by the analyzer.

5) The detection result is read/printed from the display screen of the immunochromatographic quantitative analyzer.

4. Evaluation of detection effect of human urine microalbumin colloidal gold detection card

1) Precision: the MAU detection card is used for detecting 20 and 100mg/L MAU reference substances according to the using method of the detection card, the repeated measurement is carried out for 10 times respectively, and the precision of the detection card is calculated after outliers are removed. The experimental result shows that the coefficient of variation CV of the two concentration detection results is less than 15%.

Concentration point (mg/L)	30	100
			CV	7.17％	12.05％

2) Detection range: the MAU detection card is used for detecting MAU recombinant proteins with different concentrations of 10, 20, 40, 80 and 160mg/L, and the fitting curve and the detection range are 10-160mg/L (as shown in figure 3).

3) Linear range: preparing 5 series concentration samples from the high-value sample and the sample diluent according to a certain proportion, detecting each sample for 3 times by using an MAU (multi-analyte unit) detection card, performing regression statistics on the result and the theoretical concentration, and judging whether the concentration is linear within the concentration range. The linear range is 10-160mg/L (as shown in figure 4).

4) Accuracy: the MAU detection card is used for detecting 30 and 100mg/L MAU reference substances for 3 times respectively according to the using method of the detection card, the relative deviation between the average value and the theoretical value is calculated, and the experimental result shows that the relative deviation B of three concentration detection results is less than 15%.

Concentration point (mg/L)	30	100
			B	10.7％	11.5％

5. Formulation screening

In addition to the above-mentioned best preparation example 1, the applicant tried various preparation schemes, for example, the following sets of test cards were prepared and applied as follows:

sequence listing

<110> Jiangsu Zhonghong bioengineering drug creation research institute Co., Ltd

<120> anti-human serum albumin antibody and application thereof

<130> anti-human serum albumin antibody and application thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10

<212> PRT

<213> Mus musculus

<400> 1

Gly Phe Ser Leu Ser Thr Ser Ser Val Gly

1 5 10

<210> 2

<211> 7

<212> PRT

<213> Mus musculus

<400> 2

Ile Trp Trp Asp Asp Val Lys

1 5

<210> 3

<211> 9

<212> PRT

<213> Mus musculus

<400> 3

Ala Arg Ile Asp Asp Tyr Phe Asp Tyr

1 5

<210> 4

<211> 11

<212> PRT

<213> Mus musculus

<400> 4

Leu Ser Leu Val His Ser Asp Gly Asn Thr Tyr

1 5 10

<210> 5

<211> 3

<212> PRT

<213> Mus musculus

<400> 5

Lys Val Ser

1

<210> 6

<211> 9

<212> PRT

<213> Mus musculus

<400> 6

Ser Gln Ser Thr His Val Pro Phe Thr

1 5

<210> 7

<211> 117

<212> PRT

<213> Mus musculus

<400> 7

Gln Val Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Gln Pro Ser Gln

1 5 10 15

Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu Ser Thr Ser

20 25 30

Ser Val Gly Val Gly Trp Leu Arg Gln Pro Ser Gly Lys Gly Leu Glu

35 40 45

Trp Leu Ala His Ile Trp Trp Asp Asp Val Lys Arg Tyr Asn Pro Val

50 55 60

Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Ser Ser Gln Val

65 70 75 80

Phe Leu Lys Ile Ala Ser Val Asp Thr Ala Asp Ala Ala Thr Tyr Tyr

85 90 95

Cys Ala Arg Ile Asp Asp Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Thr

100 105 110

Leu Thr Val Ser Ser

115

<210> 8

<211> 351

<212> DNA

<213> Mus musculus

<400> 8

caggttactc tgaaagagtc tggccctggg atattgcagc cctcccagac cctcagtctg 60

acttgttctt tctctaggtt ttcactgagc acttctagtg tgggtgttgg ctggcttcgt 120

cagccatcgg ggaagggtct ggagtggctg gcacacattt ggtgggatga tgtcaagcgc 180

tataacccag tcctgaagag ccgactgact atctccaagg atacctccag cagccaggta 240

ttcctcaaga tcgccagtgt ggacactgca gatgctgcca catactactg tgctcgaata 300

gatgattact ttgactactg gggccaaggc accactctca cagtctcctc a 351

<210> 9

<211> 112

<212> PRT

<213> Mus musculus

<400> 9

Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly

1 5 10 15

Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Leu Ser Leu Val His Ser

20 25 30

Asp Gly Asn Thr Tyr Leu His Trp Phe Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser

85 90 95

Thr His Val Pro Phe Thr Phe Gly Ser Gly Thr Lys Phe Glu Ile Arg

100 105 110

<210> 10

<211> 336

<212> DNA

<213> Mus musculus

<400> 10

gatgttgtga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60

atctcttgca gatctagtct gagccttgta cacagtgatg gaaacaccta tttacattgg 120

ttcctgcaga agccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180

tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240

agcagagtgg aggctgagga tctgggagtt tatttctgct ctcaaagtac acatgttcca 300

ttcacgttcg gctcggggac aaagtttgaa ataaga 336

<210> 11

<211> 244

<212> PRT

<213> Mus musculus

<400> 11

Gln Val Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Gln Pro Ser Gln

1 5 10 15

Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu Ser Thr Ser

20 25 30

Ser Val Gly Val Gly Trp Leu Arg Gln Pro Ser Gly Lys Gly Leu Glu

35 40 45

Trp Leu Ala His Ile Trp Trp Asp Asp Val Lys Arg Tyr Asn Pro Val

50 55 60

Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Ser Ser Gln Val

65 70 75 80

Phe Leu Lys Ile Ala Ser Val Asp Thr Ala Asp Ala Ala Thr Tyr Tyr

85 90 95

Cys Ala Arg Ile Asp Asp Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Thr

100 105 110

Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro

130 135 140

Val Ser Leu Gly Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Leu Ser

145 150 155 160

Leu Val His Ser Asp Gly Asn Thr Tyr Leu His Trp Phe Leu Gln Lys

165 170 175

Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe

180 185 190

Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe

195 200 205

Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe

210 215 220

Cys Ser Gln Ser Thr His Val Pro Phe Thr Phe Gly Ser Gly Thr Lys

225 230 235 240

Phe Glu Ile Arg

<210> 12

<211> 735

<212> DNA

<213> Mus musculus

<400> 12

caggttactc tgaaagagtc tggccctggg atattgcagc cctcccagac cctcagtctg 60

acttgttctt tctctaggtt ttcactgagc acttctagtg tgggtgttgg ctggcttcgt 120

cagccatcgg ggaagggtct ggagtggctg gcacacattt ggtgggatga tgtcaagcgc 180

tataacccag tcctgaagag ccgactgact atctccaagg atacctccag cagccaggta 240

ttcctcaaga tcgccagtgt ggacactgca gatgctgcca catactactg tgctcgaata 300

gatgattact ttgactactg gggccaaggc accactctca cagtctcctc aggtggtggt 360

ggatccggag gtggtggttc tggtggtggt ggttctgatg ttgtgatgac ccaaactcca 420

ctctccctgc ctgtcagtct tggagatcaa gcctccatct cttgcagatc tagtctgagc 480

cttgtacaca gtgatggaaa cacctattta cattggttcc tgcagaagcc aggccagtct 540

ccaaagctcc tgatctacaa agtttccaac cgattttctg gggtcccaga caggttcagt 600

ggcagtggat cagggacaga tttcacactc aagatcagca gagtggaggc tgaggatctg 660

ggagtttatt tctgctctca aagtacacat gttccattca cgttcggctc ggggacaaag 720

tttgaaataa gataa 735

Claims (8)

1. An anti-human serum albumin antibody characterized by: the heavy chain variable region comprises the following complementarity determining regions: the amino acid sequence is shown as the sequence SEQ ID NO:1, HCDR1 as set forth in sequence SEQ ID NO: 2 and HCDR2 as shown in sequence SEQ ID NO: HCDR3 shown at 3; and a light chain variable region sequence thereof comprising the following complementarity determining regions: the amino acid sequence is shown as the sequence SEQ ID NO: 4, LCDR1 shown as a sequence SEQ ID NO: 5 and LCDR2 as shown in sequence SEQ ID NO: LCDR3 shown in fig. 6.

2. The antibody of claim 1, wherein the heavy chain variable region of said antibody has the amino acid sequence set forth in SEQ ID NO. 7 and the light chain variable region of said antibody has the amino acid sequence set forth in SEQ ID NO. 9.

3. The antibody of claim 1, wherein the antibody is a single chain antibody having the amino acid sequence set forth in SEQ ID No. 11.

4. A nucleotide encoding the antibody of claim 3.

5. An expression vector comprising the nucleotide of claim 4.

6. A recombinant host bacterium comprising the expression vector of claim 5.

7. The antibody of claim 3, wherein said antibody is expressed by a method comprising:

1) cultivating the recombinant host bacterium of claim 6 under suitable conditions;

2) then purifying and collecting the antibody from the host bacteria.

8. Use of an antibody according to any one of claims 1 to 3 in the manufacture of a kit for the detection of urinary microalbumin content.

Images