CN107607726A - Human cystatin C collaurum quantitative test card - Google Patents
Human cystatin C collaurum quantitative test card Download PDFInfo
- Publication number
- CN107607726A CN107607726A CN201710784640.XA CN201710784640A CN107607726A CN 107607726 A CN107607726 A CN 107607726A CN 201710784640 A CN201710784640 A CN 201710784640A CN 107607726 A CN107607726 A CN 107607726A
- Authority
- CN
- China
- Prior art keywords
- antibody
- seq
- amino acid
- sequence
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to new human cystatin C colloidal gold fast detecting test paper card and application thereof, belong to immunochemistry field.The present invention is prepared for Multiple Antibodies, and carries out pairing screening, obtains the Antibody Combination (C12 and C14) of sensitivity and specificity energy meet demand;Its convenient a large amount of production simultaneously, can meet the needs of larger scale clinical application in the future.The debugging Optimization Work of detection architecture is carried out to above-mentioned Antibody Combination, obtains easy to operate, sensitivity, specificity and coherent detection performance can meet the colloidal gold fast detecting test paper card of the human cystatin C of people's clinical sample detection.And targetedly screening has obtained preparing all kinds of buffer solutions that test card is applicable, the detection card coefficient of variation CV through preparation<10%th, deviations in accuracy B<5%th, sensitivity 0.2mg/L.
Description
Technical field
The invention belongs to immunochemistry field, is specifically related to two kinds of anti-human bladder chalone C (CysC) antibody and its preparation side
The application of method and above-mentioned antibody in human cystatin C detection.
Background technology
Bladder chalone C (Cystatin C, CysC) is made up of, molecular weight 13.3KD 122 amino acid, is a kind of half Guang ammonia
Pepsin inhibitor, also referred to as γ-trace of albumin or γ-postglobulin.CysC is produced and deposited with constant speed in vivo
In various body fluid, especially using content in cerebrospinal fluid and refining as height.CysC in circulation is only eliminated through glomerular filtration,
And in proximal convoluted tubule reabsorption, but blood is not returned to by complete metabolic breakdown after reabsorption, therefore, its blood level is small by kidney
Ball filtration rate is determined independent of the influence of any foeign element (such as sex, age and diet), is a kind of reflection glomerulus
The ideal marker of filtration rate change.The kidneys such as serum creatinine (Scr), urea (Urea), endogenous creatinine clearance rate (Ccr) are removed
Rate index is by many kidney other factors, and such as age, sex, height, muscle mass, diet structure, medicine and renal tubule are to creatinine
Secretion influence, and CysC is not influenceed by above-mentioned factor.Research shows, after blood CysC reference concentrations are one-year-old it is stable into
People is horizontal, until threescore or so, and asexuality difference.Also there are some researches show compared with other indexs, CysC detects glycosuria
The sensitivity of sick nephrosis is 40%, and specificity is 100%, therefore can pass through CysC concentration in periodic detection diabetic's blood
Change to see whether the generation of diabetic microvascular complication.In addition, in serum CysC room temperatures can stable in two days, 0 DEG C to 20
It DEG C can stablize 7 days, can stablize 6 months at -80 DEG C, and multigelation does not make significant difference to measured value.To sum up various indexs cause
CysC turns into the important sensitive indicator of reflection glomerular filtration situation.
In view of superiority of the CysC in terms of glomerular filtration rate(GFR is reflected, prepares CysC antibody and is quantified for preparing CysC
Detection kit has important clinical value.Collaurum quantitative assay is easy to use easy to spread and cost is relatively low,
The quantitative detection of disease indicators can be met, be suitable for the real-time test of primary care system.
The content of the invention
The technical problem to be solved in the present invention is to provide can effective, specific binding human cystatin C antibody.More specifically
Say on ground:
The first object of the present invention is to provide two kinds of anti-human bladder chalone C antibody.
The first anti-human bladder chalone C antibody (C12),
Its weight chain variable district contains following complementary determining region:Amino acid sequence such as sequence SEQ ID NO:Shown in 1
HCDR1, such as sequence SEQ ID NO:HCDR2 and/or such as sequence SEQ ID NO shown in 2:HCDR3 shown in 3;
And its light-chain variable sequence contains following complementary determining region:Amino acid sequence such as sequence SEQ ID NO:4
Shown LCDR1, such as sequence SEQ ID NO:LCDR2 and/or such as sequence SEQ ID NO shown in 5:LCDR3 shown in 6.
Preferable HCDR1~HCDR3, the nucleotide sequence such as sequence SEQ ID NO of LCDR1~3:Shown in 17~22.
The amino acid sequence such as SEQ ID NO of C12 heavy chain of antibody variable region preferably in the present invention:Shown in 7, light chain
The amino acid sequence of variable region such as SEQ ID NO:Shown in 8, weight chain variable district and light chain variable district are directly melted by connecting small peptide
Close, its amino acid sequence such as SEQ ID NO:Shown in 35.
It is furthermore preferred that C12 heavy chain of antibody variable region nucleotides sequence such as SEQ ID NO:Shown in 23, the core of light chain variable district
Nucleotide sequence such as SEQ ID NO:Shown in 24, weight chain variable district and light chain variable district are directly merged by connecting small peptide, its nucleosides
Acid sequence such as SEQ ID NO:Shown in 36.
Second of anti-human bladder chalone C antibody (C14),
Contain following complementary determining region in its heavy chain of antibody variable region:Amino acid sequence such as sequence SEQ ID NO:Shown in 9
HCDR1, such as sequence SEQ ID NO:HCDR2 and/or such as sequence SEQ ID NO shown in 10:HCDR3 shown in 11;
And its antibody light chain variable region sequences contains following complementary determining region:Amino acid sequence such as sequence SEQ ID
NO:LCDR1, such as sequence SEQ ID NO shown in 12:LCDR2 and/or such as sequence SEQ ID NO shown in 13:Shown in 14
LCDR3。
Preferable HCDR1~HCDR3, the nucleotide sequence such as sequence SEQ ID NO of LCDR1~3:Shown in 25~30.
The amino acid sequence such as SEQ ID NO of C14 heavy chain of antibody variable region preferably in the present invention:Shown in 15, antibody
The amino acid sequence of light chain variable district such as SEQ ID NO:Shown in 16;Weight chain variable district and light chain variable district are straight by connecting small peptide
Fusion is connect, its amino acid sequence such as SEQ ID NO:Shown in 35
It is furthermore preferred that C14 heavy chain of antibody variable region nucleotides sequence such as SEQ ID NO:Shown in 31, the core of light chain variable district
Nucleotide sequence such as SEQ ID NO:Shown in 32, weight chain variable district and light chain variable district are directly merged by connecting small peptide, its nucleosides
Acid sequence such as SEQ ID NO:Shown in 36.
Second purpose of the invention is to provide two kinds of single-chain antibodies, the amino acid sequence such as SEQ ID of the antibody C12
NO:Shown in 33;The amino acid sequence of the antibody C14 such as SEQ ID NO:Shown in 34.
3rd purpose of the invention is to provide the nucleotide sequence of two kinds of above-mentioned single-chain antibodies of coding, the nucleotide sequence
Such as SEQ ID NO:37 is shown, such as SEQ ID NO:Shown in 38.
4th purpose of the invention is to provide a kind of expression vector containing above-mentioned nucleotide sequence.
5th purpose of the invention is to provide a kind of recombinant host bacterium containing above-mentioned expression vector.
6th purpose of the invention is to provide a kind of method for producing above-mentioned single-chain antibody, including:
1) above-mentioned recombinant host bacterium expression antibody is cultivated under suitable conditions;
2) and then from Host Strains purify, collect antibody.
The 7th purpose of the present invention is in providing above-mentioned anti-human bladder chalone C antibody in human cystatin C content is detected
Using.
The 8th purpose of the present invention is to provide one group of antibody that can be matched and detected human cystatin C to combination;
The antibody is high to the detection sensitivity of combination, and specificity is good.
The 9th purpose of the present invention is to provide a kind of using the anti-human bladder chalone C antibody test human cystatin C
Colloidal gold immunochromatographimethod quantitative test card, including sample absorption pad, gold standard pad, reaction film and adsorptive pads;The gold standard pad spraying
There is the antibody C12 that colloid gold particle marks, have detection band and quality control band on the reaction film, detection band position is coated with antibody
C14, quality control band position are coated with anti-His tag antibodies or Protein L.The preferred nitrocellulose filter of reaction film.It is described anti-
The anti-His antibody of the preferred mouse of His tag antibodies.
The present invention is prepared for Multiple Antibodies, and carries out pairing screening, obtains sensitivity and specificity energy meet demand
One group of Antibody Combination (C12 and C14);Its convenient a large amount of production simultaneously, can meet the needs of larger scale clinical application in the future.To upper
The debugging Optimization Work that Antibody Combination carries out detection architecture is stated, obtains easy to operate, sensitivity, specificity and coherent detection performance
The colloidal gold immunochromatographimethod quantitative test card of the human cystatin C of human plasma pattern detection can be met.
Brief description of the drawings
Fig. 1 antibody M12 and M14 heavy chains and chain variable region gene electrophoretogram.Lane 1 expands for M12 weight chain variable districts PCR
Increase gene, Lane 2 is that 500DNA Ladder, Lane 3 are M12 light chain variable district PCR amplification genes, and Lane 4 is M14 heavy chains
Variable region PCR amplification genes, Lane 5 are M14 light chain variable district PCR amplification genes.
Fig. 2 single-chain antibody structural representations.VHRepresent weight chain variabl area sequence, VLRepresent light-chain variable sequence, His marks
Sign as six histidines.
Fig. 3 single-chain antibodies express the agarose gel electrophoresis figure of PCR primer.Fig. 3-a are C12 gene PCR products;Fig. 3-b
For C14 gene PCR products.
Fig. 4 single-chain antibody specific detections design sketch (Western Blot).Fig. 4-a are single-chain antibody C12;Fig. 4-b are
Single-chain antibody C14.
Fig. 5 colloidal gold immunochromatographimethod quantitative test card result schematic diagrams of the present invention.1 it is sample pad, 2 be reaction film, 3 is
Absorption pad, 4 be nature controlling line (C lines), 5 be detection line (T lines), 6 be gold standard pad, 7 be PVC sheet.
Fig. 6 .CysC detection card (CC14-CC12) matched curve figures, wherein calibration curve equation is y=-0.002x2+
0.120x+0.066, wherein coefficient R2=0.999.
Fig. 7 .CysC detection card (CC14-CC12) range of linearity curve maps, wherein, calibration curve equation y=1.004x+
0.103, coefficient correlation R2=0.997.
Fig. 8 in the markets obtain the bladder chalone C quantitative detecting reagent of good prestige and method for product comparison chart to be evaluated,
Wherein, calibration curve equation y=1.090x-0.517, coefficient correlation R2=0.953, illustrate this kit and commercially available main flow
Bladder chalone C quantitative detecting reagent testing result uniformity is preferable.
Embodiment
Definition
" antibody " is also known as immunoglobulin, is a kind of large-scale Y shape protein secreted by bone-marrow-derived lymphocyte, can pass through Y shape
Two of which bifurcated top complementary site (antigen knot bound site) specific binding target antigen immunoglobulin molecules, institute
State target antigen such as protein, sugar, polynucleotides, fat, polypeptide, micromolecular compound etc..
" single-chain antibody " (scFv) refers to the weight chain variable district (V of antibodyH) and light chain variable district (VL) pass through 15~20
The single chain fusion protein that amino acid short peptide (linker) connection is formed, the linker for connection are generally rich in glycine and silk
Propylhomoserin, in favor of the stability and pliability of single-chain antibody.Connected mode can be by VLN-terminal be connected to VHC-terminal, Huo Zhexiang
Instead.Although eliminating constant region and introducing linker, single-chain antibody still remains specificity of the antibody to antigen, and it has
Molecular weight is small, penetration power is strong and it is antigenic weak the features such as.
Complementary determining region (complementarity-determining region, CDR), also referred to as hypervariable region.Shaping
It is the most critical zone of target antigen and antibody binding in the end of antibody monomer amino acid, in Artificial Immune Network Theory, Mei Gekang
The complementary determining region of body is otherwise known as idiotype or genotype.
The preparation of the anti-human bladder chalone C hybridoma cell strain of embodiment 1.
1. animal immune
It is female according to the immune BALB/c of general immune programme for children to be extracted from the bladder chalone C of human plasma (buying in HyTest companies)
Property mouse (being purchased from this experimental animal Co., Ltd of Changzhou Cavan).Specific Immunity referring to《Antibody preparation using experiment with being referred to
South》.Immune serum titre is tracked using indirect elisa method, serum titer highest is chosen and mouse is immunized, carry out mice spleen
Cell and murine myeloma cell carry out fusion experiment.
2. cell fusion
(1) preparation of spleen cells
By immune mouse, pluck eyeball and take blood, be placed in 75% (v/v) alcohol and soak 10 minutes after disconnected cervical vertebra is put to death,
Its spleen is taken out in aseptic operating platform, is placed in cell screen clothes, is fully ground cell, screen cloth is crossed, with sterile 1640 culture medium
(being purchased from Gibco companies) centrifuge washing for several times after, cell is resuspended so that single cell suspension is made, and counts, it is standby.
(2) preparation of feeder cells
Female BAl BIc/c mouse one of 8~10 week old are taken, eyeball is plucked and obtains negative serum, are put to death through disconnected cervical vertebra rearmounted
Soaked 10 minutes in 75% (v/v) alcohol;It is sterile to open skin of abdomen, exposure peritonaeum, about 10mL 1640HT are trained with syringe
Support base (be purchased from SIGMA companies) injection mouse peritoneal, gently abdomen massage and piping and druming for several times.Draw the culture containing macrophage
It is standby in base injection 20%1640HAT culture mediums;
Female BAl BIc/c mouse one of 2~3 week old are taken, is placed in 75% (v/v) alcohol and soaks after disconnected cervical vertebra is put to death
10 minutes;It is sterile to take thymus gland in cell screen clothes, grinding, cross screen cloth, obtain thymocyte be placed in it is above-mentioned containing macrophage
It is standby in 20%1640HAT culture mediums.
(3) cell fusions
Murine myeloma cell strain SP2/0 of the selection in exponential phase, collects and counts.Take about 108Individual above-mentioned spleen
Cell and 2 × 107Individual above-mentioned SP2/0 cell lines, which are added in fusion pipe, to be mixed, and 1000rpm abandons supernatant (as far as possible after centrifuging 10 minutes
Abandon net), fusion pipe is put and gently rubbed back and forth on palm so that precipitation is loose.1mL preheatings are added after elder generation is slow in 60 seconds soon
PEG1450 (polyethylene glycol 1450, purchased from SIGMA companies), add 1640HT culture mediums 30mL and terminate, 1000rpm centrifuges 10 points
Clock, supernatant is removed, gently friction makes precipitation loose, adds in the 20% 1640HAT culture mediums that step 2 is obtained.
After above-mentioned HAT culture mediums are fully mixed, dispensed with 200 μ L/ holes into 96 porocyte culture plates, put 37 DEG C, 5%
CO2Cell culture incubator in cultivate.20%1640HAT culture mediums are replaced with 10%1640HT culture mediums after one week, are taken after 3 days
Detected clearly.
3. anti-human bladder chalone C specific hybrid knurl strain screening
(1) preparation of detection plates:With CB coating buffers dilution CysC (buying in HyTest companies) to 1 μ g/mL, coating 96
Hole ELISA ELISA Plates, 100 μ L/ holes, 2~8 DEG C of coatings overnight, washed once and pat dry;Containing 2% bovine serum albumin(BSA) (Bovine
Serum Albumin, BSA) PBST buffer blinds (200ul/ holes), 37 DEG C close 2 hours;Pat dry, it is standby.
(2) screening of positive colonies:The μ L/ holes of cells and supernatant 100 to be checked are added in above-mentioned detection plate, in 37 DEG C
Effect was washed and patted dry after 30 minutes, is added the sheep anti-mouse igg of the HRP marks in 100 μ L/ holes, is washed after being acted on 30 minutes in 37 DEG C
Wash and pat dry, add the TMB nitrite ions in 100 μ L/ holes, developed the color 15 minutes in 37 DEG C of lucifuges, 50 μ L 2M H are added per hole2SO4Eventually
Only react, and the reading numerical values at OD450.Positive hole determines principle:OD450 values/negative control value >=2.1.Choose positive gram
Grand strain carries out Cell-cloned screening.After three to four-wheel cloning screening, monoclonal cell strain positive rate 100% is i.e. true
It is set to stable cell line, singling is carried out to cell line.Hybridoma cell strain M12 and M14 are respectively provided with higher potency, subsequently enter then
One step carries out antibody variable sequences sequencing analysis to above-mentioned hybridoma cell strain.
The measure of the hybridoma cell strain antibody variable sequences of embodiment 2.
M12 the and M14 antibody variable sequences of above-mentioned hybridoma cell strain secretion are measured.
A.RNA extraction:Reference cell total serum IgE extraction agent box (being purchased from Roche companies) specification is to above-mentioned hybridoma
Cell line M12 and M14 carry out Total RNAs extraction and carry out reverse transcription immediately;
B.RNA reverse transcriptions turn into DNA:With reference to Thermo Scientific Reverted First strand cDNA
Synthesis Kit (being purchased from Thermo companies) carry out reverse transcription to the total serum IgE extracted in previous step, and cDNA is made, and freeze
Be stored in -20 DEG C it is standby;
C. the PCR amplifications and recovery of variable region sequences:So that gained cDNA is template in previous step, with mouse IgG hypotype lists
Clonal antibody variable region sequences universal primer is primer, enters performing PCR amplification to the variable region sequences of heavy chain and light chain, PCR is produced
Thing is reclaimed through DNA glue reclaims kit (being purchased from TIANGEN companies), sees accompanying drawing 1;
D. the clone of variable region sequences and sequencing:According to cloning vector pMD18-T kit (being purchased from Takara companies)
Specification, heavy chain and chain variable region gene are attached with pMD18-T carriers respectively, convert bacillus coli DH 5 alpha, picking
Positive colony, Nanjing Genscript Biotechnology Co., Ltd. is transferred to be sequenced.
Sequencing obtains the antibody M12 of hybridoma cell strain secretion heavy chain of antibody variable region amino acid sequence such as SEQ ID
NO:7 is shown, chain variable region amino acid sequence such as SEQ ID NO:Shown in 8.The above-mentioned sequence of Vbase2 database analysises, its is heavy
The amino acid sequence of each complementary determining region of chain variable region is respectively:Such as sequence SEQ ID NO:HCDR1, such as sequence shown in 1
SEQ ID NO:HCDR2, such as sequence SEQ ID NO shown in 2:HCDR3 shown in 3;Each complementary decision of its light chain variable district
The amino acid sequence in area is:Such as sequence SEQ ID NO:LCDR1, such as sequence SEQ ID NO shown in 4:LCDR2 shown in 5, such as
Sequence SEQ ID NO:LCDR3 shown in 6.
Sequencing obtains the antibody M14 of hybridoma cell strain secretion heavy chain of antibody variable region amino acid sequence such as SEQ ID
NO:15 is shown, chain variable region amino acid sequence such as SEQ ID NO:Shown in 16.The above-mentioned sequence of Vbase2 database analysises, its
The amino acid sequence of each complementary determining region of weight chain variable district is respectively:Such as sequence SEQ ID NO:HCDR1, such as sequence shown in 9
Arrange SEQ ID NO:HCDR2, such as sequence SEQ ID NO shown in 10:HCDR3 shown in 11;Each complementation of its light chain variable district
Determining the amino acid sequence in area is:Such as sequence SEQ ID NO:LCDR1, such as sequence SEQ ID NO shown in 12:Shown in 13
LCDR2, such as sequence SEQ ID NO:LCDR3 shown in 14.
The recombination expression of the single-chain antibody of embodiment 3. and purifying
According to sequencing result in embodiment 2, respectively by hybridoma cell strain M12 and M14 heavy chain of antibody and light chain variable
Connection peptide (GGGGS) is added between area3, six histidines are introduced, and the progress of its full genome is artificial synthesized, it is building up to complete red ferment
The recombination expression of single-chain antibody is carried out in mother.Expressed obtained single-chain antibody is respectively designated as antibody C12 and antibody C14, its
Structure composition is as shown in Figure 2.The recombination expression of above-mentioned single-chain antibody is specific as follows:
1. the expression plasmid structure of single-chain antibody gene
Artificial synthesized single-chain antibody C12 gene order such as SEQ ID NO:37 is shown, amino acid sequence such as SEQ ID
NO:Shown in 33;Artificial synthesized single-chain antibody C14 nucleotide sequence such as SEQ ID NO:38 is shown, amino acid sequence such as SEQ
ID NO:Shown in 34.
The fragment upstream of artificial synthesized single-chain antibody C12 and C14 full genome synthesis is introduced into XhoI sequences in pPICZ α A carriers
DNA sequence dna after row, downstream introduce XbaI enzyme cutting site, are building up to pUC57 plasmids (by Nanjing Genscript Biotechnology Co., Ltd.
There is provided) in, a kind of long-term preservation plasmid is obtained, plasmid is designated as pUC57-C12-scFv- (HIS)6And pUC57-C14-scFv-
(HIS)6.Enter performing PCR amplification, wherein sense primer P1 is CGCCAGGGTTTTCCCAGTCAC GAC;Anti-sense primer P2 is:
AGCGGATAACAATTTCACACAGGA.After Standard PCR program, agarose gel electrophoresis analysis (accompanying drawing 3), two kinds of products are shown
Size is consistent with expected size (706bp, 725bp).By PCR obtain gene outcome recovery purifying after, using XhoI (#R0146S,
Purchased from New England Biolabs companies) and XbaI (#R0145V, purchased from New England Biolabs companies) double enzymes
Cut, be connected to T4 ligases in pPICZ α A (V19520, purchased from Invitrogen) plasmid, be transformed into DH5 α competent cells
In, 37 DEG C of overnight incubations in the LB flat boards containing Zeocin (R250-01, purchased from Invitrogen companies).Screen within second day
Positive colony bacterium is sequenced, and compares, completely the same with expected sequence, that is, obtains antibody C12 and C14 expression plasmid, be designated as respectively
pPICZα-C12-scFv-(HIS)6And pPICZ α-C14-scFv- (HIS)6。
2. single-chain antibody gene is in the structure of Pichia pastoris host's engineered strain, screening and expression
YPDS solid mediums are prepared:With reference to Invitrogen company EasySelectPichia Expression Kit
Specification;Pichia pastoris competent cell:With reference to EasySelectPichia Expression Kit specifications;BMGY is cultivated
Basigamy system:With reference to Invitrogen companies Multi-Copy Pichia Expression Kit specifications;BMMY culture mediums are matched somebody with somebody
System:With reference to Invitrogen companies Multi-Copy Pichia Expression Kit specifications.
By pPICZ α-C12-scFv- (HIS)6And pPICZ α-C14-scFv- (HIS)6Plasmid, with SacI restriction enzymes
Enzyme linearization for enzyme restriction.Linearized vector, respectively electricity conversion are entered X-33 competence yeast cells, applied respectively after ethanol precipitation
To the YPDS solid mediums containing Zeocin, 30 DEG C are cultivated 3-5 days cloth, just there is positive colony generation.
The monoclonal of the above-mentioned acquisition of picking is in 5mL BMGY culture mediums, 30 DEG C of cultures to OD600When=2.0~6.0, take
1mL preserves strain, and will be transferred to BMMY Small Amount induced expressions after the resuspension of remaining bacterium solution, and it is dense to end to add methanol every 24h
Spend for 1% (v/v).After one week, bacterium solution supernatant is collected by centrifugation, passes through Western blot analysis (Western blot), observation
Target protein expression.In Western blot primary antibody be anti-HIS-Tag antibody (His-Tag (2A8) Mouse mAb,
M20001, it is purchased from Ai Bimate biological medicines (Shanghai) Co., Ltd.).
C12 the and C14 recombination fusion proteins engineering strain of above-mentioned acquisition is inoculated in BMGY culture mediums respectively, 30
DEG C, 220rpm is cultivated to cell density to OD600=2.0~6.0, methanol was added every 24 hours to final concentration of 1.0% (v/
v).After one week, fermentation culture is collected.
3. single-chain antibody purifies
Using histidine-tagged affinity column purification of single stranded antibody C12 and C14 fusion protein, prepackage pillar selection is
HisTrap HP, are comprised the following steps that:
(1) the removal of impurities pretreatment of zymotic fluid:Above-mentioned expression is obtained into antibody C12 and C14 fusion protein fermented liquid supernatant, from
The heart collects supernatant, and adds combination buffer so that supernatant final concentration of 300mM NaCl, 20mM NaH2PO4, 10mM
Imidazole, adjust pH7.5,0.45 μm of membrane filtration.
(2) HisTrap HP affinity columns purify:With fully-automatic intelligent protein purification system, (AKTA avant150, are purchased from
GE healcare companies) affinity purification is carried out to the antibody C12 and C14 fusion protein zymotic fluid that pretreatment obtains, pillar is
HisTrap HP (17-5248-02, purchased from GE healcare companies).Combination buffer is 300mM NaCl, 20mM
NaH2PO4,10mM Imidazole, pH7.5, elution buffer is 300mM NaCl, 20mM NaH2PO4,500mM
Imidazole, pH7.5.Linear elution is carried out during elution, and collects each eluting peak.By SDS-PAGE electroresis appraisal purity,
Merge satisfactory collecting pipe, change buffer solution and be PBS solution and be concentrated by ultrafiltration (1mg/mL) that filtration sterilization is in -20 DEG C of guarantors
Deposit standby.
The performance evaluation of the single-chain antibody of embodiment 4.
1. single-chain antibody C12 and C14 Western blot identifications
A. polyacrylamide gel electrophoresis:12% separation gel, 5% concentration glue are configured, respectively loading standard protein and day
Right CysC albumen (buying in HyTest companies), electrophoresis 1 hour under constant pressure;
B. transferring film:Transferring film 1 hour under the conditions of constant current (35mA/ films), by the protein on two blocks of polyacrylamide gels point
It is not transferred on two nitrocellulose filters.Coomassie brilliant blue G250 dyes to the SDS-PAGE glue for completing transferring film, observes
The residual condition of albumen;
C. close:TBST buffer blinds (confining liquid) containing 5% defatted milk, 4 DEG C overnight;Cleaning solution after closing (TBST,
Refer to TaKaRa company's T BST buffer) it washed once, 10 minutes;
D. antigen-antibody reaction:Confining liquid dilution (presses 1:400 volume ratios) horseradish peroxidase-labeled C12 (C12-
HRP, 1mg/mL, our company are marked using classical Over-voltage protection, similarly hereinafter) and horseradish peroxidase-labeled C14 (C14-HRP,
1mg/mL, our company are marked using classical Over-voltage protection, similarly hereinafter), it is separately added into above-mentioned two nitrocellulose filters, room temperature
Reaction 1 hour;TBST is washed 5 times, every time 10 minutes;
E. develop the color and take pictures:Residual liquid on nitrocellulose filter is blotted, it is steady that every nitrocellulose filter is separately added into 2mL
The mixed liquor (buying in Thermo companies) of sizing Peroxidase Solution (1mL) and luminol/enhancing agent solution (1mL),
The surface of even wetting nitrocellulose filter, room temperature lucifuge is reacted one minute takes pictures after gel imaging system (buying in GE companies)
(Fig. 4-a, Fig. 4-b), leaves and takes result.
Testing result is visible, and C12 and C14 have preferably specificity, can specific detection CysC albumen.
2. single-chain antibody C14 and C12 is in the evaluation of collaurum detection platform
The antibody purified in embodiment 3 is subjected to combinations of pairs, matched respectively as coated antibody or labelled antibody
Bladder chalone C (CysC) is detected, detecting step is as follows:
1) C14 or C12 are diluted to 1mg/mL with antibody coating buffer, lined on nitrocellulose filter;
2) it is laid on after the C14 of colloid gold label or C12 being diluted into 3 times with 0.01M PB buffer solutions on pad;
3) pad pasting as shown in accompanying drawing 5, slitting, is loaded and (specifically prepares referring to embodiment 5)
4) CysC standard items (many red self-controls) are diluted with Sample dilution, is 7mg/L, 1mg/L to concentration, the two are dense
Degree standard items and zero standard's product (i.e. Sample dilution) add 50ul (C12 coatings-C14 into colloidal-gold detecting-card respectively
Mark or C14 coatings-C12 marks), detection card is placed on readout instrument after 10min and carries out reading.As a result it is as shown in the table:
From the above results, it is seen that the double antibody sandwich method that C14 forms as coated antibody, C12 as labelled antibody
Detecting system can be applied to collaurum detection platform, carry out CysC detection.
The preparation of the colloid gold immune detection card of 5 anti-human bladder chalone C of embodiment
1st, solution is prepared
1) prepared by 0.01M PB buffer solutions:Weigh Na2HPO4·12H2O 3.22g, NaH2PO4·2H2O 0.15g, add pure
Change water 1000mL, rotor is stirred to dissolving, and its pH7.4 ± 0.1,0.45um membrane filtrations are determined with pH meter.
2) prepared by confining liquid:Bovine serum albumin(BSA) (BSA) 5g is weighed, adds 0.01M PB solution (PH7.4 ± 0.1) 50mL,
Rotor is stirred to dissolving.
3) prepared by antibody coating buffer:0.2mL isopropanols are taken, add 9.8mL 0.01M PB solution (PH7.4 ± 0.1), are turned
Son stirring 5-10min.
4) gold labeling antibody is redissolved liquid and prepared:1g bovine serum albumin(BSA)s are weighed, 5g trehaloses, it is molten to add 100mL 0.01M PB
Liquid (pH7.4 ± 0.1), rotor is stirred to dissolving, adds 25ul Tween-20, continues to stir 5-10min with rotor.
5) prepared by Sample dilution:Weigh 12.5g bovine serum albumin(BSA)s add 500mL 0.01M PB solution (PH7.4 ±
0.1), rotor is stirred to dissolving, adds 0.5mL Proclin300, continues to stir 5-10min with rotor.
2nd, prepared by human cystatin C colloidal-gold detecting-card
1) mark of collaurum
Antibody C12 colloid gold label (by taking 1mL colloidal gold solutions mark as an example):Use K2CO3It is (every to adjust collaurum pH value
4ul 0.2M K are added in 1mL collaurums2CO3), 5-10 minutes are stirred, it is (every that antibody C12 is slowly added into colloidal gold solution
25ug antibody C12 are added in 1mL collaurums), stirring at low speed 30 minutes;Confining liquid is added to its final concentration of 10% (quality hundred
Divide ratio), stir 20 minutes;12000rpm centrifuges 30min after standing 30min;Go supernatant 100ul gold labeling antibodies to redissolve liquid to redissolve
Precipitate the C12 antibody for producing colloid gold label.
2) gold standard pad and reaction film preparation
After C12 gold labeling antibodies are diluted into 3 times, it is sprayed in gold standard pad 6, drying for standby;
After antibody C14 is diluted into 0.8mg/mL with antibody diluent, the T of reaction film 2 (nitrocellulose filter) is coated in
The position of line 5;After anti-His tag antibodies are diluted into 0.2mg/mL with antibody diluent, (the nitrocellulose of reaction film 2 is coated in
Film) the position of C lines 4, reaction film drying for standby.
3) pad pasting, cut film, assembling
Sample pad 1, gold standard pad 6, the nitrocellulose filter 2 for being coated with antibody, adsorptive pads 3 are set gradually from left to right
(as shown in Figure 5), and should contact a little between any two, the T lines 5 of the nitrocellulose filter for being coated with antibody are in left, C lines 4
Cut on the right side, and according to shell size, load shell, it is standby to complete detection blocking.
4) kit assembles
The detection card that will be assembled, drier are fitted into aluminium foil bag, heat sealing machine sealing, labelling;
Sample dilution is dispensed by 1mL/ pipes, and loads valve bag, labelling according to kit specification;
According to trimmed size, by the interior bag of certain number, 1 valve bag containing Sample dilution, 1 part of specification, 1 conjunction
Case marker label load in packing box, and label is posted outside packing box.
3rd, human cystatin C colloidal-gold detecting-card application method
1) outer packing is opened, detection card is taken out from sealing aluminium foil bag, is placed on flat table.
2) 2.5 μ l serum/plasma samples are drawn, adds in Sample dilution, is sufficiently mixed.
3) draw samples of the 50ul after processing to add in the well of detection card, stand 10min at room temperature.
4) detection card is put into immunochromatography quantitative analysis instrument, presses " quick detection " key and start to detect, instrument will be automatic
Detection card is scanned.
5) reading/printing testing result from the display screen of immunochromatography quantitative analysis instrument.
4th, human cystatin C colloidal-gold detecting-card Detection results are assessed
1) accuracy:By C14 (coating)-C12 (mark) detections card by detection card application method detection 1,7mg/L CysC
Each 10 replications of reference material, detection card precision is calculated after rejecting outlier.Experimental result shows three Concentration Testing knots
Fruit coefficient of variation CV<10%.
Concentration point (mg/L) | 1 | 7 |
CV | 9.43% | 9.75% |
2) detection range:By C14 (coating)-C12 (mark) detect card detection various concentrations CysC recombinant proteins 0.15,
0.3rd, 0.625,1.25,2.5,5,10mg/L, matched curve and detection range are 0.2-10mg/L (such as accompanying drawing 6).
3) range of linearity:High level sample and Sample dilution are configured to 5 series concentration samples according to a certain percentage, used
C14 (coating)-C12 (mark) detection card detections, each pattern detection 3 times, carry out regression calculation by result and theoretical concentration, sentence
Break whether linear in the concentration range.The range of linearity is 0.2-10mg/L (such as accompanying drawing 7).It is 0.2mg/ to detect card sensitivity
L。
4) degree of accuracy:By C14 (coating)-C12 (mark) detections card by detection card application method detection 1,7mg/L CysC
Each 3 repetitions of reference material, calculate average value and the relative deviation of theoretical value, and experimental result shows that three Concentration Testing results are relative
Deviation B<5%.
Concentration point (mg/L) | 1 | 7 |
B | 3.4% | 4.14% |
5th, the degree of accuracy-methodology compares:
Guangzhou Wondfo Biotech. Co., Ltd.'s Guang of good prestige is obtained in selection like product in the market
Chalone C quantitative detecting reagents (immunochromatographic method) compare product comparison checking.30 parts of clinical patient samples are selected, by 1 to 20
Serial number, with reference product and C14 to be evaluated (coating)-C12 (mark) colloidal-gold detecting-card simultaneously tested,
It is measured according to 1,2,3......28,29,30,30,29,28......3,2,1 sample order.Control and production to be evaluated
The testing result coefficient R of product2=0.953, illustrate that two methods testing result has preferable correlation (such as accompanying drawing 8).
6th, recipe determination
In addition to above-mentioned optimal preparation example 1, applicant also attempts a variety of preparation schemes, for example, several groups of detection blockings below it is standby and
Using result such as following table:
SEQUENCE LISTING
<110>Jiangsu Jiangsu Zhonghong Biopharma Institute Inc. of crystalline substance red-face role's thing medical sci-tech limited company
<120>Human cystatin C collaurum quantitative test card
<130>Human cystatin C collaurum quantitative test card
<160> 38
<170> PatentIn version 3.3
<210> 1
<211> 8
<212> PRT
<213> mouse
<400> 1
Gly Tyr Thr Phe Thr Ser Tyr Trp
1 5
<210> 2
<211> 8
<212> PRT
<213> mouse
<400> 2
Val Asp Pro Gly Ser Gly Thr Thr
1 5
<210> 3
<211> 6
<212> PRT
<213> mouse
<400> 3
Thr Ala Gly Phe Asp Tyr
1 5
<210> 4
<211> 6
<212> PRT
<213> mouse
<400> 4
Gln Asn Ile Asn Val Trp
1 5
<210> 5
<211> 3
<212> PRT
<213> mouse
<400> 5
Lys Ala Ser
1
<210> 6
<211> 9
<212> PRT
<213> mouse
<400> 6
Gln Gln Gly Gln Thr Tyr Pro Leu Thr
1 5
<210> 7
<211> 113
<212> PRT
<213> mouse
<400> 7
Gln Val Gln Leu Gln Gln Pro Gly Ser Glu Leu Val Arg Pro Gly Thr
1 5 10 15
Ser Val Lys Leu Ser Cys Arg Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Trp Met His Trp Val Lys Gln Arg His Gly Gln Gly Leu Glu Trp Leu
35 40 45
Gly Asn Val Asp Pro Gly Ser Gly Thr Thr Asn Tyr Glu Glu Asn Phe
50 55 60
Lys Thr Lys Gly Thr Leu Thr Val Asp Thr Ser Ser Ser Thr Val Tyr
65 70 75 80
Met His Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Thr Ala Gly Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser
100 105 110
Ala
<210> 8
<211> 107
<212> PRT
<213> mouse
<400> 8
Asp Ile Gln Met Asn Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly
1 5 10 15
Asp Thr Ile Thr Ile Thr Cys His Ala Ser Gln Asn Ile Asn Val Trp
20 25 30
Leu Gly Trp Phe Gln Gln Lys Pro Glu Asn Ile Pro Lys Leu Leu Ile
35 40 45
Tyr Lys Ala Ser Thr Leu His Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Val Phe Thr Leu Thr Ile Ser Ser Pro Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Gly Gln Thr Tyr Pro Leu
85 90 95
Thr Phe Gly Ala Gly Thr Lys Leu Glu Ile Lys
100 105
<210> 9
<211> 8
<212> PRT
<213> mouse
<400> 9
Gly Tyr Thr Phe Thr Asp Phe Tyr
1 5
<210> 10
<211> 8
<212> PRT
<213> mouse
<400> 10
Ile Trp Pro Gly Ser Gly Asn Thr
1 5
<210> 11
<211> 11
<212> PRT
<213> mouse
<400> 11
Ala Arg Gly Thr Gly Thr Gly Tyr Phe Asp Val
1 5 10
<210> 12
<211> 7
<212> PRT
<213> mouse
<400> 12
Gln Val Gln Ile Phe Ser Asn
1 5
<210> 13
<211> 3
<212> PRT
<213> mouse
<400> 13
Ala Ala Lys
1
<210> 14
<211> 9
<212> PRT
<213> mouse
<400> 14
Gln His Phe Trp Gly Thr Pro Tyr Thr
1 5
<210> 15
<211> 118
<212> PRT
<213> mouse
<400> 15
Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala
1 5 10 15
Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Phe
20 25 30
Tyr Leu Asn Trp Val Lys Gln Arg Thr Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Glu Ile Trp Pro Gly Ser Gly Asn Thr Tyr Tyr Asn Glu Lys Phe
50 55 60
Lys Asp Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80
Met His Phe Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys
85 90 95
Ala Arg Gly Thr Gly Thr Gly Tyr Phe Asp Val Trp Gly Ala Gly Thr
100 105 110
Thr Val Thr Val Ser Ala
115
<210> 16
<211> 109
<212> PRT
<213> mouse
<400> 16
Arg Trp Glu Leu Ser His Met Val Asp Leu Gln Ala Ala Ala Asn Ser
1 5 10 15
Leu Val Tyr Pro Arg Phe Thr Met Asp Phe Gln Val Gln Ile Phe Ser
20 25 30
Asn Leu Ala Trp Tyr Gln Gln Lys Gln Gly Lys Ser Pro Gln Leu Leu
35 40 45
Val Tyr Ala Ala Lys Asn Leu Ala Asp Gly Val Pro Ser Arg Phe Ser
50 55 60
Gly Ser Gly Ser Gly Thr Gln Tyr Ser Leu Lys Ile Asn Ser Leu Gln
65 70 75 80
Ser Glu Asp Phe Gly Ser Tyr Tyr Cys Gln His Phe Trp Gly Thr Pro
85 90 95
Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210> 17
<211> 24
<212> DNA
<213> mouse
<400> 17
ggctacacat tcaccagcta ctgg 24
<210> 18
<211> 24
<212> DNA
<213> mouse
<400> 18
gttgatcctg gtagcggtac tact 24
<210> 19
<211> 18
<212> DNA
<213> mouse
<400> 19
accgcggggt ttgactac 18
<210> 20
<211> 18
<212> DNA
<213> mouse
<400> 20
cagaacatta atgtttgg 18
<210> 21
<211> 9
<212> DNA
<213> mouse
<400> 21
aaggcttcc 9
<210> 22
<211> 27
<212> DNA
<213> mouse
<400> 22
caacagggtc aaacttatcc gctcacg 27
<210> 23
<211> 339
<212> DNA
<213> mouse
<400> 23
caggtccaac tgcagcaacc tgggtctgag ctggtgaggc ctggaacttc agtgaagctg 60
tcctgcaggg cttctggcta cacattcacc agctactgga tgcactgggt gaagcagagg 120
catggacaag gccttgagtg gctaggaaat gttgatcctg gtagcggtac tactaactac 180
gaggagaatt tcaagaccaa gggcacactg actgtggaca cttcctccag tacagtctac 240
atgcacctca gcagcctgac atctgaggac tctgcggtct attattgtac cgcggggttt 300
gactactggg gccaaggcac cactctcact gtctctgca 339
<210> 24
<211> 321
<212> DNA
<213> mouse
<400> 24
gacatccaga tgaaccagtc tccatccagt ctgtctgcat cccttggaga cacaattacc 60
atcacttgcc atgccagtca gaacattaat gtttggttag gctggttcca gcagaaacca 120
gaaaatattc ctaaactatt gatctataag gcttccacct tgcacacagg cgtcccatca 180
cggtttagtg gcagtggatc tggaacagtt ttcacattaa ccatcagcag cccgcagcct 240
gaagacattg ccacttacta ctgtcaacag ggtcaaactt atccgctcac gttcggtgct 300
gggaccaagt tggaaatcaa a 321
<210> 25
<211> 24
<212> DNA
<213> mouse
<400> 25
ggctacacct tcactgactt ctat 24
<210> 26
<211> 24
<212> DNA
<213> mouse
<400> 26
atttggcctg gaagtggtaa tact 24
<210> 27
<211> 33
<212> DNA
<213> mouse
<400> 27
gcaagaggga ctgggacggg gtacttcgat gtc 33
<210> 28
<211> 21
<212> DNA
<213> mouse
<400> 28
caagtgcaga ttttcagtaa t 21
<210> 29
<211> 9
<212> DNA
<213> mouse
<400> 29
gctgcaaaa 9
<210> 30
<211> 27
<212> DNA
<213> mouse
<400> 30
tgtcaacatt tttggggtac tccgtac 27
<210> 31
<211> 354
<212> DNA
<213> mouse
<400> 31
caggttcagc tgcagcagtc tggagctgag ctggcgaggc ccggggcttc agtgaagctg 60
tcctgcaagg cttctggcta caccttcact gacttctatc taaactgggt gaagcagagg 120
actggacagg gccttgagtg gattggagag atttggcctg gaagtggtaa tacttactac 180
aatgagaagt tcaaggacaa ggccacactg actgcagaca aatcctccag cacagcctac 240
atgcacttca gcagcctgac atctgaggac tctgcagtct atttctgcgc aagagggact 300
gggacggggt acttcgatgt ctggggcgca gggaccacgg tcaccgtctc cgca 354
<210> 32
<211> 324
<212> DNA
<213> mouse
<400> 32
cgttgggagc tctcccatat ggtcgacctg caggcggccg cgaattcact agtgtatcca 60
agattcacca tggattttca agtgcagatt ttcagtaatt tagcatggta tcagcagaaa 120
cagggaaaat ctcctcagct cctggtctat gctgcaaaaa acttagcaga tggtgtgcca 180
tcaaggttca gtggcagtgg atcaggcaca cagtattccc tcaagatcaa tagcctgcag 240
tctgaagatt ttgggagtta ttactgtcaa catttttggg gtactccgta cacgttcgga 300
ggggggacca agctggaaat caaa 324
<210> 33
<211> 235
<212> PRT
<213> mouse
<400> 33
Gln Val Gln Leu Gln Gln Pro Gly Ser Glu Leu Val Arg Pro Gly Thr
1 5 10 15
Ser Val Lys Leu Ser Cys Arg Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Trp Met His Trp Val Lys Gln Arg His Gly Gln Gly Leu Glu Trp Leu
35 40 45
Gly Asn Val Asp Pro Gly Ser Gly Thr Thr Asn Tyr Glu Glu Asn Phe
50 55 60
Lys Thr Lys Gly Thr Leu Thr Val Asp Thr Ser Ser Ser Thr Val Tyr
65 70 75 80
Met His Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Thr Ala Gly Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser
100 105 110
Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
115 120 125
Asp Ile Gln Met Asn Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly
130 135 140
Asp Thr Ile Thr Ile Thr Cys His Ala Ser Gln Asn Ile Asn Val Trp
145 150 155 160
Leu Gly Trp Phe Gln Gln Lys Pro Glu Asn Ile Pro Lys Leu Leu Ile
165 170 175
Tyr Lys Ala Ser Thr Leu His Thr Gly Val Pro Ser Arg Phe Ser Gly
180 185 190
Ser Gly Ser Gly Thr Val Phe Thr Leu Thr Ile Ser Ser Pro Gln Pro
195 200 205
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Gly Gln Thr Tyr Pro Leu
210 215 220
Thr Phe Gly Ala Gly Thr Lys Leu Glu Ile Lys
225 230 235
<210> 34
<211> 241
<212> PRT
<213> mouse
<400> 34
Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala
1 5 10 15
Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Phe
20 25 30
Tyr Leu Asn Trp Val Lys Gln Arg Thr Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Glu Ile Trp Pro Gly Ser Gly Asn Thr Tyr Tyr Asn Glu Lys Phe
50 55 60
Lys Asp Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80
Met His Phe Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys
85 90 95
Ala Arg Gly Thr Gly Thr Gly Tyr Phe Asp Val Trp Gly Ala Gly Thr
100 105 110
Thr Val Thr Val Ser Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
115 120 125
Gly Gly Gly Gly Ser Arg Trp Glu Leu Ser His Met Val Asp Leu Gln
130 135 140
Ala Ala Ala Asn Ser Leu Val Tyr Pro Arg Phe Thr Met Asp Phe Gln
145 150 155 160
Val Gln Ile Phe Ser Asn Leu Ala Trp Tyr Gln Gln Lys Gln Gly Lys
165 170 175
Ser Pro Gln Leu Leu Val Tyr Ala Ala Lys Asn Leu Ala Asp Gly Val
180 185 190
Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Gln Tyr Ser Leu Lys
195 200 205
Ile Asn Ser Leu Gln Ser Glu Asp Phe Gly Ser Tyr Tyr Cys Gln His
210 215 220
Phe Trp Gly Thr Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile
225 230 235 240
Lys
<210> 35
<211> 15
<212> PRT
<213> mouse
<400> 35
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10 15
<210> 36
<211> 45
<212> DNA
<213> mouse
<400> 36
ggtggtggtg gatccggagg tggtggttct ggtggtggtg gttct 45
<210> 37
<211> 705
<212> DNA
<213> mouse
<400> 37
caggtccaac tgcagcaacc tgggtctgag ctggtgaggc ctggaacttc agtgaagctg 60
tcctgcaggg cttctggcta cacattcacc agctactgga tgcactgggt gaagcagagg 120
catggacaag gccttgagtg gctaggaaat gttgatcctg gtagcggtac tactaactac 180
gaggagaatt tcaagaccaa gggcacactg actgtggaca cttcctccag tacagtctac 240
atgcacctca gcagcctgac atctgaggac tctgcggtct attattgtac cgcggggttt 300
gactactggg gccaaggcac cactctcact gtctctgcag gtggtggtgg atccggaggt 360
ggtggttctg gtggtggtgg ttctgacatc cagatgaacc agtctccatc cagtctgtct 420
gcatcccttg gagacacaat taccatcact tgccatgcca gtcagaacat taatgtttgg 480
ttaggctggt tccagcagaa accagaaaat attcctaaac tattgatcta taaggcttcc 540
accttgcaca caggcgtccc atcacggttt agtggcagtg gatctggaac agttttcaca 600
ttaaccatca gcagcccgca gcctgaagac attgccactt actactgtca acagggtcaa 660
acttatccgc tcacgttcgg tgctgggacc aagttggaaa tcaaa 705
<210> 38
<211> 723
<212> DNA
<213> mouse
<400> 38
caggttcagc tgcagcagtc tggagctgag ctggcgaggc ccggggcttc agtgaagctg 60
tcctgcaagg cttctggcta caccttcact gacttctatc taaactgggt gaagcagagg 120
actggacagg gccttgagtg gattggagag atttggcctg gaagtggtaa tacttactac 180
aatgagaagt tcaaggacaa ggccacactg actgcagaca aatcctccag cacagcctac 240
atgcacttca gcagcctgac atctgaggac tctgcagtct atttctgcgc aagagggact 300
gggacggggt acttcgatgt ctggggcgca gggaccacgg tcaccgtctc cgcaggtggt 360
ggtggatccg gaggtggtgg ttctggtggt ggtggttctc gttgggagct ctcccatatg 420
gtcgacctgc aggcggccgc gaattcacta gtgtatccaa gattcaccat ggattttcaa 480
gtgcagattt tcagtaattt agcatggtat cagcagaaac agggaaaatc tcctcagctc 540
ctggtctatg ctgcaaaaaa cttagcagat ggtgtgccat caaggttcag tggcagtgga 600
tcaggcacac agtattccct caagatcaat agcctgcagt ctgaagattt tgggagttat 660
tactgtcaac atttttgggg tactccgtac acgttcggag gggggaccaa gctggaaatc 720
aaa 723
Claims (9)
1. human cystatin C collaurum quantitative testing test paper card, including sample absorption pad, gold standard pad, reaction film and adsorptive pads, described
Gold standard pad is coated with the antibody C12 of colloid gold particle mark, there is detection band and quality control band, detection band position bag on the reaction film
There is antibody C14, quality control band position is coated with anti-His tag antibodies or Protein L;
The antibody C12 is anti-human bladder chalone C antibody, including:
Weight chain variable district contains following complementary determining region:Amino acid sequence such as sequence SEQ ID NO:HCDR1 shown in 1, such as
Sequence SEQ ID NO:HCDR2 and/or such as sequence SEQ ID NO shown in 2:HCDR3 shown in 3;
And light-chain variable sequence contains following complementary determining region:Amino acid sequence such as sequence SEQ ID NO:Shown in 4
LCDR1, such as sequence SEQ ID NO:LCDR2 and/or such as sequence SEQ ID NO shown in 5:LCDR3 shown in 6;
The antibody C14 is anti-human bladder chalone C antibody, including:
Weight chain variable district contains following complementary determining region:Amino acid sequence such as sequence SEQ ID NO:HCDR1 shown in 9, such as
Sequence SEQ ID NO:HCDR2 and/or such as sequence SEQ ID NO shown in 10:HCDR3 shown in 11;
And light-chain variable sequence contains following complementary determining region:Amino acid sequence such as sequence SEQ ID NO:Shown in 12
LCDR1, such as sequence SEQ ID NO:LCDR2 and/or such as sequence SEQ ID NO shown in 13:LCDR3 shown in 14.
2. human cystatin C collaurum quantitative testing test paper card according to claim 1, it is characterised in that antibody C12 heavy chains
The amino acid sequence of variable region such as SEQ ID NO:Shown in 7, the amino acid sequence such as SEQ ID NO of light chain variable district:Shown in 8.
3. human cystatin C collaurum quantitative testing test paper card according to claim 1, it is characterised in that the C12 antibody
For single-chain antibody, its amino acid sequence such as SEQ ID NO:Shown in 33.
4. human cystatin C collaurum quantitative testing test paper card according to claim 1, it is characterised in that antibody C14 heavy chains
The amino acid sequence of variable region such as SEQ ID NO:Shown in 15, the amino acid sequence such as SEQ ID NO of light chain variable district:16 institutes
Show.
5. human cystatin C collaurum quantitative testing test paper card according to claim 1, it is characterised in that the C14 antibody
For single-chain antibody, its amino acid sequence such as SEQ ID NO:Shown in 34.
6. the human cystatin C collaurum quantitative testing test paper card according to claim any one of 1-6, it is characterised in that closing
Liquid is the 0.01M pH7.4PB buffer solutions containing 1%-10%BSA.
7. the human cystatin C collaurum quantitative testing test paper card according to claim any one of 1-6, it is characterised in that Jin Biao
It is 1%-10%BSA, 5% trehalose, 0.025%tween20 0.01M pH7.4PB buffer solutions that antibody, which redissolves liquid,.
8. the human cystatin C collaurum quantitative testing test paper card according to claim any one of 1-6, it is characterised in that antibody
Coating buffer is the 0.01M pH7.4PB buffer solutions of 2% isopropanol or methanol.
9. the human cystatin C collaurum quantitative testing test paper card according to claim any one of 1-6, it is characterised in that sample
Dilution is the 0.01M pH7.4PB buffer solutions containing 0-2.5%BSA and 0.1%Proclin300.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710784640.XA CN107607726B (en) | 2017-09-04 | 2017-09-04 | Human cystatin C colloidal gold quantitative detection card |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710784640.XA CN107607726B (en) | 2017-09-04 | 2017-09-04 | Human cystatin C colloidal gold quantitative detection card |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107607726A true CN107607726A (en) | 2018-01-19 |
CN107607726B CN107607726B (en) | 2022-05-31 |
Family
ID=61057352
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710784640.XA Active CN107607726B (en) | 2017-09-04 | 2017-09-04 | Human cystatin C colloidal gold quantitative detection card |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107607726B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108318695A (en) * | 2018-01-30 | 2018-07-24 | 江苏晶红生物医药科技股份有限公司 | People RBP colloidal gold immunochromatographimethod quantitative testing test paper cards and its clinical application |
CN109709340A (en) * | 2018-12-29 | 2019-05-03 | 江苏众红生物工程创药研究院有限公司 | Human neutrophil gelatinase-associated lipocalin quantitative test card and its clinical application |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN202814977U (en) * | 2012-08-23 | 2013-03-20 | 南京基蛋生物科技有限公司 | Cystatin C colloidal gold immune chromatography assay test strip |
CN105334319A (en) * | 2015-10-21 | 2016-02-17 | 黑龙江省乳品工业技术开发中心 | Test strip for detecting zearalonone in milk |
-
2017
- 2017-09-04 CN CN201710784640.XA patent/CN107607726B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN202814977U (en) * | 2012-08-23 | 2013-03-20 | 南京基蛋生物科技有限公司 | Cystatin C colloidal gold immune chromatography assay test strip |
CN105334319A (en) * | 2015-10-21 | 2016-02-17 | 黑龙江省乳品工业技术开发中心 | Test strip for detecting zearalonone in milk |
Non-Patent Citations (1)
Title |
---|
戴婉如等: "免疫胶体金技术测定血清胱抑素C及其对早期肾损害的诊断价值", 《检验医学与临床》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108318695A (en) * | 2018-01-30 | 2018-07-24 | 江苏晶红生物医药科技股份有限公司 | People RBP colloidal gold immunochromatographimethod quantitative testing test paper cards and its clinical application |
CN108318695B (en) * | 2018-01-30 | 2020-08-11 | 江苏晶红生物医药科技股份有限公司 | Human RBP colloidal gold immunochromatographic assay quantitative detection test paper card and clinical application thereof |
CN109709340A (en) * | 2018-12-29 | 2019-05-03 | 江苏众红生物工程创药研究院有限公司 | Human neutrophil gelatinase-associated lipocalin quantitative test card and its clinical application |
CN109709340B (en) * | 2018-12-29 | 2022-02-11 | 江苏众红生物工程创药研究院有限公司 | Human neutrophil gelatinase-associated lipocalin quantitative detection card and clinical application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN107607726B (en) | 2022-05-31 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109438576A (en) | A kind of preparation and its application of anti-human CD47 monoclonal antibody | |
CN110028582A (en) | Anti-human d-dimer antibody and its application | |
CN109734803B (en) | Anti-human MYO antibody and application thereof in detection kit | |
CN106699884B (en) | Anti-human C-reactive protein antibody and application thereof | |
CN105713091B (en) | Anti-human CRP antibody and its application | |
CN108318695A (en) | People RBP colloidal gold immunochromatographimethod quantitative testing test paper cards and its clinical application | |
CN110078823A (en) | Anti-human D-Dimer antibody and its application | |
CN106596976B (en) | Human C-reactiveprotein colloidal gold quantitative test card | |
CN107607726A (en) | Human cystatin C collaurum quantitative test card | |
CN107383198A (en) | A kind of anti-human CysC antibody and its application | |
CN106093431B (en) | Human calcitonin original collaurum quantitative test card | |
CN106749659B (en) | Anti-human CRP antibody and application thereof | |
CN109608542A (en) | Anti-human NGAL antibody and its application in Test paper card | |
CN105842440B (en) | People's C reactive protein fluorogenic quantitative detection test cards | |
CN109553682A (en) | Anti-human neutrophil gelatinase-associated lipocalin antibody and its application in Test paper card | |
CN105440137B (en) | The antibody of anti-Ractopamine and its application | |
CN108359010A (en) | Anti-human RBP ELISA antibody and its application | |
CN107556384A (en) | A kind of anti-human bladder chalone C antibody and its application | |
CN112876562B (en) | Anti-human serum albumin antibody and application thereof | |
CN110007094A (en) | People's d-dimer quantitative test card and its clinical application | |
CN109725151B (en) | Human myoglobin detection test paper card and clinical application thereof | |
CN109721655B (en) | Anti-human myoglobin antibody and application thereof in detection kit | |
CN105949309B (en) | Anti-human C reactive protein antibody and its application | |
CN109709340A (en) | Human neutrophil gelatinase-associated lipocalin quantitative test card and its clinical application | |
CN105949312B (en) | Anti-human PCT antibody and its application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |