CN106676132B

CN106676132B - Efficient plant binary induction gene expression recombinant plasmid

Info

Publication number: CN106676132B
Application number: CN201710174053.9A
Authority: CN
Inventors: 肖浪涛; 苏益; 黄志刚; 蔺万煌; 王若仲; 罗为桂
Original assignee: Hunan Agricultural University
Current assignee: Hunan Agricultural University
Priority date: 2017-03-22
Filing date: 2017-03-22
Publication date: 2020-02-14
Anticipated expiration: 2037-03-22
Also published as: CN106676132A

Abstract

A high-efficiency plant binary induction gene expression recombinant plasmid is realized by the following steps: constructing a DR5 promoter induced by auxin IAA, and promoting the BD domain expression of a yeast transcriptional activator protein Gal4 by the promoter; constructing a promoter induced by low temperature, and using the promoter to start the AD structural domain expression of the yeast transcriptional activator protein Gal 4; constructing a promoter activated by Gal4 to start the expression of a reporter gene GFP; and (3) introducing the three expression segments into the same plant expression vector pBI 121. The invention can induce the expression of the reporter gene only when two inducing conditions exist simultaneously, thus reducing the interference; meanwhile, the invention realizes the two-stage amplification of the induction signal by utilizing the basic principle of the Gal4/UAS system, and can improve the detection sensitivity of the induction signal; in addition, the invention also has great flexibility and extensibility, and various DNA elements responding to chemical signals and physical signals can be used for constructing a binary inducible expression system and can be widely applied to the research of modern genetics and molecular biology.

Description

Efficient plant binary induction gene expression recombinant plasmid

Technical Field

The invention belongs to the technical field of genetic engineering, relates to a plasmid for controlling gene expression in plants by using two induction conditions, namely an efficient binary plant induction gene expression plasmid, and is a powerful tool for the research of genetics and molecular biology.

Background

Promoter response elements induced by auxin specificity include D1, P3, ER7, DR5 and the like, wherein DR5 formed by repeating a basic sequence TGTCTC for a plurality of times at certain intervals is one of response elements with the strongest biological activity, and in recent years, high-activity auxin specificity inducible promoters such as DR5 and the like are widely applied to genetic screening for researching IAA-related mutants, response of plant tissues and cells to IAA and expression and positioning of IAA inducible genes by being fused with reporter genes. Conserved response elements which are subjected to temperature conditions, such as DRE elements (the core sequence is CRT) in a promoter of an Arabidopsis RD29A gene, are also commonly present in plants, and can control the activated expression of the gene at low temperature. Multiple CRT repeats also exist in some other cold inducible gene promoters, such as arabidopsis COR15A, canola BN115, and wheat WCS 120. Gal4 is a yeast transcriptional activator gene, the protein encoded by it recognizes a 17bp fragment (5'-CGGN11CCG-3') of the Upstream Activating Sequence (UAS) of the promoter of the target gene. Gal4 has two domains: DNA Binding Domain (BD) and transcription Activation Domain (AD), whose coding sequences can be expressed from two promoters separately and then assembled into complete Gal4 autonomously in the cell to activate the expression of downstream genes by binding UAS. Thus, the Gal4/UAS system is a widely used tool for gene expression and function studies in model organisms.

Although inducible promoters and gene-inducible expression systems have been widely used in genetic and molecular biological studies, these systems are of a single-factor inducible type (i.e., gene expression is induced by a single condition), and in some specific fields, the induction time and the induction degree are not synchronized due to interference from the background substances of the organism itself. In addition, most of the existing inducible expression systems are single-stage, and have certain application limitation in the aspect of induced signal amplification, so that the design of a binary gene inducible expression system with two-stage amplification has good application prospect.

Disclosure of Invention

The technical problem to be solved by the invention is to overcome the defects of the existing gene induction expression system and provide an efficient plant binary induction gene expression recombinant plasmid which can induce the expression of a reporter gene only when two induction conditions exist simultaneously, so that the sampled plant material can be prevented from being interfered by a background (such as IAA) and the synchronization of induction time and induction degree can be realized; meanwhile, the invention realizes the two-stage amplification of the induction signal by utilizing the basic principle of the Gal4/UAS system, and can improve the detection sensitivity of the induction signal.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows: a high-efficiency binary plant inducing gene expression recombinant plasmid is prepared from DR5Pro BD_Gal4Expression segment, LTPro:: AD_Gal4The expression section and UAS Pro are obtained by simultaneously introducing a GFP expression section into the same plant expression vector pBI 121;

wherein, the DR5Pro is BD_Gal4The expression segment is obtained by constructing a promoter DR5Pro induced by auxin IAA, and using the promoter to start the BD structural domain expression of the yeast transcriptional activator protein Gal 4; the LTPro is AD_Gal4The expression segment is obtained by constructing a promoter induced by low temperature, and the promoter is used for promoting the AD structural domain expression of the yeast transcriptional activator protein Gal 4; the UAS Pro is that the GFP expression segment is obtained by constructing a promoter upstream activating sequence UAS activated by Gal4 so as to start the expression of reporter gene GFP.

More specifically, the DR5Pro:: BD_Gal4The expression segment is obtained by artificially synthesizing a DR5 response element containing 7 repeats and induced by auxin, then connecting a minimal promoter element of CaMV35S promoter to form an auxin-induced promoter DR5Pro, and then adding a BD domain gene of yeast transcriptional activator protein Gal4 and a Nos terminator after the DR5Pro and fusing.

The LTPro is AD_Gal4The expression segment is obtained by fusing the AD structural domain coding sequence and Nos terminator of the yeast transcriptional activator protein Gal4 after the LT Pro low-temperature induces the promoter; wherein, the LT Pro low temperature inducible promoter (abbreviation of lowtemperature promoter) comprises: firstly, 7 repeated DRE elements induced by low temperature are artificially synthesized, and then a minimal promoter element of CaMV35S promoter is connected to the synthetic DRE elements to form a DRE promoter; secondly, directly cloning COR15A in arabidopsis, BN115 in rape and WCS120 in wheat to induce the promoter at low temperature.

The UASPro is obtained by cloning a promoter upstream activating sequence UAS activated by Gal4, then connecting a minimal promoter element of a CaMV35S promoter to form the UASPro, and then adding a reporter gene GFP and an Nos terminator after the UASPro to fuse.

The detection principle is as follows: gal4 is a yeast transcriptional activator protein comprising a DNA Binding Domain (BD) and a transcriptional Activation Domain (AD), and the complete Gal4 recognizes the Upstream Activation Sequence (UAS) of the promoter of the target gene to activate the expression of downstream genes. Previous studies have demonstrated that when expressing the AD and BD domains of Gal4, respectively, if AD and BD are able to approach each other and assemble into a complex, such a complex can also function as Gal4, binding to UAS and activating downstream gene expression. According to the invention, two inducible promoters (DR 5Pro induced by auxin and LTPro induced by low temperature) are constructed to respectively start the expression of BD and AD domains of Gal4, when the auxin and the low temperature exist simultaneously, BD and AD can be assembled into a complex after being induced and expressed, so that UAS is combined and the efficient expression of reporter gene GFP is activated. In order to ensure that BD and AD can be assembled efficiently, the invention fuses mutually-meshed leucine zipper structures at the carbon end of BD and the nitrogen end of AD.

The invention has the following effects: the invention can induce the expression of the reporter gene only when two inducing conditions exist simultaneously, can eliminate interference factors and ensure that the target gene is accurately expressed as expected; meanwhile, the invention realizes the two-stage amplification of the induction signal by utilizing the basic principle of the Gal4/UAS system, and can improve the detection sensitivity of the induction signal; in addition, the invention also has great flexibility and extensibility, and various DNA elements responding to chemical signals and physical signals can be used for constructing a binary inducible expression system and can be widely applied to the research of modern genetics and molecular biology.

Drawings

FIG. 1 is a schematic diagram of a binary inducible gene expression system of the present invention.

FIG. 2 is a pBI121 plasmid map.

FIG. 3 is a graph of the induced expression of GFP in transgenic Arabidopsis roots at different treatment times. Wherein each time point comprises two images, the left image is a fluorescence image, and the right image is a bright field image.

FIG. 4 is a graph of the induced expression of GFP in transgenic Arabidopsis protoplast cells at different treatment times.

Detailed Description

The present invention will be further described with reference to the following examples.

Materials, reagents and instruments

Plant material: columbia wild type Arabidopsis thaliana (Arabidopsis thaliana L.) seeds were stored and propagated by the laboratory.

Coli (Escherichia coli) strain DH5 α, Agrobacterium tumefaciens (Agrobacterium tumefaciens) strain GV3101, and related plasmids are propagated and stored in the laboratory, wherein the plant expression vector pBI121 is used as a basic skeleton of a recombinant vector, a pEGAD vector is used as an Enhanced Green Fluorescent Protein (EGFP) gene donor, pGAT7 AD is used as a donor of GAL4AD and a nuclear localization signal sequence (NLS), pGBKT7 is used as a donor of GAL4BD, pCambia 1301 is used as a donor of an Nos terminator (Nos terminator), and pYES2 is used as a donor of an UAS element.

Main reagents and consumables: RNA extraction reagent, reverse transcriptase, DNA polymerase, T vector and Real-Time PCR kit are purchased from Beijing all-purpose gold biotechnology limited; endonucleases were purchased from Takara and Thermo Fisher; cellulase, crashase and reagents with higher purity requirements are purchased from Sigma company; other conventional reagents were purchased from Biotechnology engineering (Shanghai) Inc.; key consumables such as culture bottles/dishes for physcomitrella patens, centrifuge tubes for cell sorting, culture dishes special for laser confocal microscopes and the like are purchased from Corning companies.

The main apparatus comprises: a Nuaire ultra-low temperature refrigerator, a Barnstead D3750 ultrapure water system, a Beckman ultra-speed freezing centrifuge, an Eppendorf 5415R centrifuge, an Olympus IX71-22RC micromanipulation system, an Olympus FV1000 laser confocal scanning microscope, a TC-412PCR instrument, an HTY bacteria incubator, a ZHWY-200B constant temperature shaking table and a Genetius full-automatic gel imaging system.

Construction of binary and binary induction expression recombinant plasmid

1. LTPro induced by Low temperature AD_Gal4Construction of expression segments

7 repeated low-temperature response type elements DRE (with the sequence of TACCGACT) are fused with the CaMV35S minimal promoter element to form a DRE promoter; in addition, COR15A (SEQ ID No.1), BN115(SEQ ID No.2), WCS120(SEQ ID No.3) low temperature inducible promoters, collectively abbreviated as LTPro, were obtained by direct cloning from Arabidopsis thaliana (Arabidopsis thaliana), canola (Brassicaapus), and wheat (Triticum aestivum) plants, respectively.

Then sequentially fusing R chain Zip R and GAL4AD (yeast transcription activation protein) of leucine zipper structure after LTProAD domain of white Gal4, AD for short_Gal4) Nuclear localization signal NLS and terminator Nos terminator, DNA fragment fusion was performed by Huada Gene Co. Finally, PCR-expanding the fusion fragment by using primers P1(CAAGCTTTACCGACATTACCGACAT/CAAGCTTAGATCTTGTCCGTTGAAT/CAAGCTTTTAGAAAGTTTAAAATT/CAAGCTTAAACCACGGGTTTTTGG, SEQ ID No.4) and P2(CTCTAGAGGAGGCCCGATCTAGTAAC, SEQ ID No.5) to obtain LTPro:: AD_Gal4Expression segment, PCR system (30 μ L): template 1. mu.L, PCR Mix 15. mu. L, P1 primer 1. mu. L, P2 primer 1. mu.L, polymerase 0.4. mu. L, ddH₂O11.6. mu.L. The PCR conditions were: pre-denaturation at 94 ℃ for 2 min; 30 cycles of 94 ℃ for 30s, 56 ℃ for 30s, 72 ℃ for 2min for 30 s; storing at 72 deg.C for 6min and 4 deg.C.

2. DR5Pro induced by auxin IAA BD_Gal4Construction of expression segments

7 repeated auxin specific response element DR5 (core sequence CCTTTTGTCTC) is fused with CaMV35S minimal promoter element to form auxin-induced promoter DR5Pro, and then E chain Zip E and GAL4BD (BD structural domain of yeast transcriptional activator protein Gal4, abbreviated as BD) of leucine zipper structure are sequentially fused after DR5Pro_Gal4) And a terminator Nosternminator, DNA fragment fusion procedure was performed by Huada Gene Co. Finally, the auxin IAA-induced DR5Pro:: BD) was obtained by PCR extension of the aforementioned fusion fragment using primers P3(CTCTAGACTATACTAAGTTCATGATAATAG, SEQ ID No.6) and P4(CGGATCCACTAGTCTCGAGTCGACGGAGGCCCGATCTAGTAAC, SEQ ID No.7)_Gal4Expression segment, PCR system is: 30 μ L reaction system, wherein 1 μ L template, 1 μ L PCR Mix 15 μ L, P3 primer, 1 μ L, P4 primer, 1 μ L polymerase, 0.4 μ L, ddH₂O11.6. mu.L. The PCR conditions were: pre-denaturation at 94 ℃ for 2 min; 30 cycles of 94 ℃ for 30s, 56 ℃ for 30s, and 72 ℃ for 2 min; storing at 72 deg.C for 6min and 4 deg.C.

3. Gal 4-activated UASPro construction of GFP expression segments

The upstream activating sequence UAS (upstream activating sequence) sequence of the promoter activated by Gal4 was obtained from pYES2 vector, and then fused with the minimal promoter element of CaMV35S to form UAS Pro promoter. Then, the green fluorescent protein reporter gene GFP and the terminator Nos terminator were fused after UASPro, and the DNA fragment fusion operation was performed by Huada Gene Co.Finally, the UASPro activated by Gal4 is obtained by PCR by using primers P5(CACTAGTCGGATTAGAAGCC, SEQ ID No.8) and P6(CGTCGACGGAGGCCCGATCTAGTAAC, SEQ ID No.9), wherein the PCR system comprises the following components: 30 μ L reaction system, wherein 1 μ L template, 1 μ L PCR Mix 15 μ L, P1 primer, 1 μ L, P2 primer, 1 μ L polymerase, 0.4 μ L, ddH₂O11.6. mu.L. The PCR conditions were: pre-denaturation at 94 ℃ for 2 min; 30 cycles of 94 ℃ for 30s, 56 ℃ for 30s, and 72 ℃ for 2min for 10 s; storing at 72 deg.C for 6min and 4 deg.C.

4. Introduction of three expression segments

Fusion of LTPro:: AD_Gal4After each DNA fragment of the fragment was expressed, pBI121 was introduced using HindIII (promoter orientation) and XbaI (terminator orientation), and the plasmid map of pBI121 was as shown in FIG. 2. Fusion of DR5Pro: (BD)_Gal4After each DNA fragment of the fragment was expressed, XbaI and BamHI were introduced into the vector constructed in the first step. Since pBI121 had insufficient cleavage sites, SpeI and SalI were introduced between the 3 'end of NosTer and the 5' end of BamHI of DR5-Nos Ter to prepare for the introduction of the third expression fragment. And (3) fusing the UASPro, namely introducing the DNA fragments of the GFP expression segment into the vector constructed in the second step by using SpeI and SalI to obtain the binary inducible expression recombinant plasmid.

5. Recombinant plasmid restriction enzyme identification

The recombinant plasmid is digested by DNA restriction endonucleases HindIII and XbaI, and LTPro, AD_Gal4Whether the expression segment is successfully introduced into the pBI121 plasmid or not; the recombinant plasmid was digested with DNA restriction enzymes XbaI and BamHI to identify DR5Pro:: BD_Gal4Whether the expression segment is successfully introduced into the pBI121 plasmid or not; the recombinant plasmid is cut by DNA restriction enzymes SpeI and SalI, and the UASPro is identified, namely whether the GFP expression segment is successfully introduced into the pBI121 plasmid or not. The reaction system is as follows: recombinant plasmid 2. mu.L, endonuclease 1. mu.L each, and digestion buffer 2. mu. L, ddH₂The O is filled to 20 mu L, and the reaction conditions are as follows: react for 2h at 37 ℃. Finally, the recombinant plasmid with three expression segments is obtained.

Three-element and two-element induced expression recombinant plasmid GFP induced expression fluorescence verification

And (3) performing GFP induced expression fluorescence verification by taking arabidopsis thaliana successfully transformed with the recombinant plasmid as a material: the transgenic arabidopsis seeds are dibbled in a culture dish containing MS solid culture medium after being sterilized, and are placed in a culture room with 22 ℃, 16h light and 8h dark for two weeks after being vernalized for 24 h. Arabidopsis seedlings were removed from the medium and treated with 1-20. mu.g/L of pre-cooled (4 ℃) IAA solution for 30-210 min. The fluorescence intensity of the temporarily mounted pieces of the prepared roots was observed by a post laser confocal microscope, and as a result, as shown in fig. 3, the fluorescence in the arabidopsis roots was gradually increased with the increase of the treatment time.

Transgenic Arabidopsis thaliana root protoplasts were isolated (50 seedlings aged 4-6 weeks Arabidopsis thaliana roots → cut into 0.5-1mm long pieces → immersed in 3mL of enzyme solution (1.5% Cellulase RS, 1% cellulin, 0.1% pectolyase Y-23, 10mmol/L KCl, 10mmol/L CaCl2, 2mmol/L MgCl2, 2mmol/L MES, pH5.6) → 60rpm, shaking at 28 ℃ for 30-50min → 200 mesh cell sieve filtration → washing liquid washed 200g centrifuged for 5min → washing liquid diluted precipitate → ice-on-standing preservation), treated with 1-20. mu.g/L precooled (4 ℃) IAA solution for 30min, and prepared temporary patches of roots were observed for fluorescence intensity with a post-laser confocal microscope. As a result, as shown in FIG. 4, the fluorescence in the Arabidopsis protoplast cells was gradually increased with the treatment time.

SEQUENCE LISTING

<110> Hunan agriculture university

<120> a high-efficiency plant binary induction gene expression recombinant plasmid

<130>001

<160>9

<170>PatentIn version 3.3

<210>1

<211>985

<212>DNA

<213>Arabidopsis thaliana

<400>1

agatcttgtc cgttgaattt attttagact ttttttttaa tggacttcat tttaaatttt 60

tacaaaatta aattattgca ttttctattt catattgaat taggagatgt tactgtccgt 120

cagattctct agactttttt ttttaaagac tgatctatga tcagaattcc aatttttttt 180

ttctttaagg aaatacatca gagagaaaaa ttattacgaa acgattctat tacaagtaat 240

gattttaacc tttttttttt tacaattgac aatcttttca caacaaaaat ccacaagaaa 300

cgttagacaa tggcataaat ttatttaaat taatccgtat atattcgcct tctatgagaa 360

ttgaattcta taccactgta aaattcttaa acgagataag attattttca gcatgtaaaa 420

aatggtttgt ggtttcaact catttgggct attagtttta catttaggct tgcaaccttg 480

tcggtttatt ttgtgtaggc ttttggtaga tttgggcttg caaacccaaa ttaacttgtt 540

ggccgacata catttgtttc tattacaaat ttaacaacaa acgtcaataa atacacgtga 600

aggaaatgag aacgaccctc ttaagtagta ctggaaattg aaaaaaagaa atctagaaat 660

gctaacatgt aagtttttgt taccaaaaat gcaatttgta tgtagccaca atttcatggc 720

cgacctgctt tttttttctt cttctttctg aaaaccacaa atatgattac acgtggcctg 780

aaaagaacga acagaaactc ggtaatgtgc aaaaaatatc ttactcttaa tacgtgtaat 840

tttggagtgt aataggtcta tcgatctata aaacgatact attggagatt agattcttct 900

catctcactt tgttcatcta aaaactcctc ctttcatttc caaacaaaaa cttcttttta 960

ttctcacatc ttaaagatct ctctc 985

<210>2

<211>1337

<212>DNA

<213>Brassica napus

<400>2

ttagaaagtt taaaatttaa tacttgaaca tgtgaaagat ttttctttta aaatatgatt 60

ttagaaaaaa aatatattat ctaattttta tttattttat tattaaaaac tgacatgtca 120

ctacatataa catgtaaatg aatagtcatc ttgcggtcga cattgaaaga ttcatgttct 180

aagatttagt tacaatttga tgaacaaata agttaagttt aaagtttttt gcgatacaaa 240

tgttaggttg aaagtttaaa atgctaatga aaaactttaa aagtttaaag tgttaatgaa 300

taccactttg agggttttta tgcaatttta tgcaattttc tcaattttta agttacccat 360

ctaggtacaa aaatatttta aaccattttg tccaagattc gtgatttctt tgagccggtc 420

ctgatggctt ggctctgatg taccagaaaa tcgatgcacc acgctaatat tttgtacaaa 480

aaaaaatcaa tgttatatag cattcaatga aacgatttaa cccattttgt aaatcctaat 540

tgaaaaaact aatcttgcac ccggtgaccg ttatatatgc aactttgtga aaatatggtt 600

tgtagttttt atttaagcta ttacaccatg tctgtttaga agttcctagt ggataggata 660

tctctgaaag tgacgttaat taattgttat ttatgtaatg gtatgccttt taaaattaca 720

aaaattggtt ttagtagata aatatgttgt ttaaaggaaa ataaatataa tggtatgcct 780

tttgaaatta caaatatgac gttaattaat tgttatttat gtaatggaac cccatgaaat 840

accataaacc atatatcact ctataagtgt gataggcttg ccatcatata cgttatattt 900

ttatatctat attttgaaaa ctttttaggc ttgccatcat atacgttttt tttttttggg 960

gtagatttac taacatgttg gccgacgtat acttttgttt ttatcacaac aaaggtggta 1020

cacgtgaagt aacgataacg acccacaact ccgatttctt tgtgtttaat tttgcaaaaa 1080

ataaaagcag aaatgctaac atgtatatca ccacaagttt tgatggccga cctgtttttt 1140

caatagttaa agaaaataac atcaatgcat tataaaaaaa ttctacgatg ccacgtgatt 1200

tggattgcag ttggtctagt atctataaaa ctatgatact attggagaat agattattac 1260

tcatctcact cttgttccta ttaaaactcc tcctttgatt tcttttgctc gcttttgact 1320

ctttaaagag aactttc 1337

<210>3

<211>941

<212>DNA

<213>Triticum aestivum

<400>3

aaaccacggg tttttggccg gatccgtggc gggggacgac aacgcggtca gtcgcggcag 60

aggcggcgtc ggacatcggg ccgttcacgt ccgcggtgtc ggacggggac ggtgagatgc 120

ggtgtcgaac gtcgggccgt tcacgtccgc gtcgtcggac gggcacggtg agatgcggcg 180

tcgggcgggg ttgggacggc ggcgatcggc cagttggaaa aatggaacgg gaggagcatg 240

atcgccgggc gggcgagaag atcatgcaac tgcctctttt ttcccgtaca cgggcgatgc 300

cttttttttt gcatccgcgc gggtatacgt acgtcggcct gtatgtacaa tagaaggtgg 360

gtatatcgtt tccttcatat ggccattctg cccttctaca ttttgttggg ggtctaccga 420

agcacttctc agaatcctac tgtataaaat tatttcgaat caaagcccta agcctctcgt 480

atgcttcttc tagttactct catagtctca ttgtcgttac atgccgacac tttggatctt 540

ccatcctctt aagcaaacaa tactaccatt tttgcaagag aaaagaatca tcttcttccc 600

ggacaaggac gaatgagctg ggacgtggcg acccggacgc gccactggct tcagaggccc 660

ggccccccta gtcggcagcc acctgccgac cactgatgcg accacacgta gctcccagcc 720

gcggcgattc gtccatctga ccagccctct ttatgggcta gtcggcactc acctgcccat 780

ccactcacga gcgcgcacgt cgtggttcgt ataccctcca acggcctata aatactgcgt 840

cgcgctgcat atgctttaca caaccacctg cttcacacta ccaaggcaag tacacagcag 900

caatacgtag tagatttccc gagtgaggag ctcagcgcaa g 941

<210>4

<211>98

<212>DNA

<213> Artificial Synthesis

<400>4

caagctttac cgacattacc gacatcaagc ttagatcttg tccgttgaat caagctttta 60

gaaagtttaa aattcaagct taaaccacgg gtttttgg 98

<210>5

<211>26

<212>DNA

<213> Artificial Synthesis

<400>5

ctctagagga ggcccgatct agtaac 26

<210>6

<211>30

<212>DNA

<213> Artificial Synthesis

<400>6

ctctagacta tactaagttc atgataatag 30

<210>7

<211>43

<212>DNA

<213> Artificial Synthesis

<400>7

cggatccact agtctcgagt cgacggaggc ccgatctagt aac 43

<210>8

<211>20

<212>DNA

<213> Artificial Synthesis

<400>8

cactagtcgg attagaagcc 20

<210>9

<211>26

<212>DNA

<213> Artificial Synthesis

<400>9

cgtcgacgga ggcccgatct agtaac 26

Claims

1. A high-efficiency plant binary induction gene expression recombinant plasmid is characterized in thatThe recombinant plasmid is DR5Pro:: BD induced by auxin IAA_Gal4Expression of fragment, LTPro induced by Low temperature AD_Gal4The expression segment and UAS Pro activated by Gal4 are obtained by simultaneously introducing the GFP expression segment into the same plant expression vector pBI 121;

wherein the DR5Pro induced by auxin IAA is BD_Gal4Construction of the expression segment: 7 repeated auxin specific response elements DR5 are fused with CaMV35S minimum promoter element to form an auxin-induced promoter DR5Pro, and then E chain Zip E, GAL4BD and a terminator Nos terminator of a leucine zipper structure are sequentially fused after the DR5 Pro;

the LTPro induced by low temperature is AD_Gal4Construction of the expression segment: 7 repeated low-temperature response type elements DRE are fused with CaMV35S minimum promoter elements to form DRE promoters, and in addition, COR15A shown in SEQ ID No.1, BN115 shown in SEQ ID No.2 and WCS120 low-temperature induction promoters shown in SEQ ID No.3 are directly cloned from arabidopsis, rape and wheat plants respectively and are collectively called LTPro; then sequentially fusing R chain Zip R, GAL4AD, nuclear localization signal NLS and terminator Nos terminator of the leucine zipper structure after LTPro;

construction of GFP expression segment of the above-described UAS Pro activated by Gal 4: the upstream activating sequence UAS sequence of promoter activated by Gal4 was obtained from pYES2 vector, after which the CaMV35S minimal promoter element was fused to form UAS Pro promoter, and then the green fluorescent protein reporter gene GFP and terminator Nos terminator were fused after UASPro.