CN103789340A - Method for efficiently preparing recombinant human MICA (major histocompatibility complex class I chain related protein A) - Google Patents

Abstract

The invention provides an expression cassette for efficiently expressing recombinant human MICA (major histocompatibility complex class I chain related protein A) in pichia pastoris. The expression cassette is characterized by sequentially comprising the following components from 5' to 3': (1) a pichia pastoris promoter for controlling gene transcription; (2) a signal peptide sequence for controlling the secretory expression of the recombinant human MICA in the pichia pastoris; (3) a coding sequence of the recombinant human MICA; (4) a transcription terminator, wherein the signal peptide sequence is a Pre sequence of an alpha-factor, and has a nucleotide sequence shown as SEQ ID NO:9. The invention also provides a method for expressing and purifying the human MICA under the induction of methanol and a constitutive expression and purification method for the human MICA.

Description

A kind of efficient method of preparing recombinant human MICA albumen

Technical field

The invention belongs to technical field of bioengineering, relate more specifically to the method for pichia spp Restruction people MICA albumen.

Background technology

MICA is a member of mic gene family, is positioned at the karyomit(e) distance H LA-B locus about 46.5kb of kinetochore end place No. 6, belongs to non-classical HLA-1 genoid.Under normal physiological conditions, the albumen of its coding is present in cell surface, and glycosylation modified by height N-.Be different from classical MHC I quasi-molecule, MICA is not combined with beta-2-microglobulin and is formed heterodimer.As the acceptor of NKG2D, MICA has been considered to participate in directly the cell-mediated killing tumor cells function of NK.In addition, the confirmation MICA such as Bauer as the part of NKG2D at the (Bauer that also plays an important role aspect the caused immune response of organ transplantation, S., V.Groh etc. (1999). " Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. " Science285 (5428): 727-729).

Before the present invention, the recombinant human MICA selling on market is undertaken recombinant expressed by intestinal bacteria and people's clone.As everyone knows, existing intestinal bacteria system does not possess carries out posttranslational modification to recombinant expressed albumen, and particularly N-is glycosyl modified.Albumen recombinant expressed in intestinal bacteria exists mainly with the form of inclusion body, relate to complicated change renaturation process, and whole system can produce many unfavorable factors such as a large amount of intracellular toxins.The animal cell expression systems such as people's clone conventionally need to consume a large amount of serum and greatly increase production cost, and production cycle and production unit require highly, but output is very limited.It should be noted that a lot of protein products that zooblast system is produced that studies show that has potential viral Pollution risk.In addition, Cao Li equality discloses preparation method's patent (CN102154302A) of a MICA albumen, and he carrys out recombinant expressed and preparation MICA albumen with the baculovirus DNA transfection Sf 9 insect cell of restructuring.Because the method has adopted rhabdovirus system, the possibility that has direct virus to pollute, does not meet the standard about clinical injection human cytokines at present.Meanwhile, Sf9 insect expression system has the contained shortcoming of general animal cell expression system.

Although pichia spp is widely used in attempting expressing the recombinant protein in various people source, because different albumen itself has complicacy and singularity, thereby final expression and to prepare effect be unpredictable.Meanwhile, successfully utilize the recombinant expressed and preparation MICA albumen of pichia spp also not report at present.

To sum up, it is a kind of easy that current urgent need is wanted, active high, and output is high and have a preparation method of the recombinant human MICA albumen of commercial application prospect.

Summary of the invention

Technical scheme of the present invention

The invention provides a kind of method of utilizing Pichia anomala expression and preparing recombinant human MICA albumen.

The solution of the present invention-1 provides and in pichia spp, has utilized methanol induction to express the method for recombinant human MICA albumen, and it has comprised structure, the expression of methanol induction recombinant protein and the purification process of recombinant protein of recombinant expression plasmid.

The solution of the present invention-2 provide the method for utilizing constitutive expression (non-methanol induction) recombinant human MICA albumen in pichia spp, and it has comprised the purification process of structure, expression of recombinant proteins and the recombinant protein of recombinant expression plasmid.

Particularly, scheme-1 and scheme-2 all comprise following steps:

(1) build constitutive expression carrier, the encoding sequence that it comprises promotor, terminator, antibiotics resistance gene, secreting signal peptide and MICA;

(2) electricity turns pichia spp, utilizes antibiotic concentration gradient to screen efficient cloning by expression;

(3) expression of MICA albumen and purifying;

In one aspect of the invention, the Pre sequence (SEQ ID No:1) that secreting signal peptide used is α-factor, and incomplete α-factor Pre-Pro sequence (SEQ ID No:2).

In another aspect of this invention, the encoding sequence of MICA used is without codon optimized sequence.

In another aspect of this invention, the encoding sequence of MICA used is through codon optimized sequence.It is well known to those skilled in the art that encoding sequence is carried out to the codon optimized method that is beneficial to express in host cell.

In another aspect of this invention, the C-terminal of expressed MICA albumen is without 6 × His label.

In another aspect of this invention, the C-terminal of expressed MICA albumen is with 6 × His label.

In aspect of the solution of the present invention-1, the promotor that constructed methanol induction MICA expression vector comprises is AOX1 transcripting promoter, terminator is AOX1 transcription terminator, resistant gene is Zeocin resistant gene, secreting signal peptide is the Pre sequence of α-factor, encoding sequence behaviour MICA (AAH16929.1) the extracellular region encoding sequence (Glu24-Gln308) of MICA.

In aspect of the solution of the present invention-2, the promotor that constructed constitutive expression MICA carrier comprises is GAP promotor, terminator is GAP transcription terminator, resistant gene is Zeocin resistant gene, secreting signal peptide is the Pre sequence of α-factor, encoding sequence behaviour MICA (AAH16929.1) the extracellular region encoding sequence (Glu24-Gln308) of MICA.

Can use in the method for the invention the various plasmid vector that is applicable to Pichia anomala expression well known in the art, particularly, the method for scheme-1 includes but not limited to pPIC9K, pPICZ α-A/B/C; The method of scheme-2 includes but not limited to pGAPZ-A/B/C, pGAPZ α-A/B/C.

Can use in the method for the invention various suitable secreting signal peptide well known to those skilled in the art, it includes but not limited to α-factor, α-amylase, glucoamylase, serum albumin secreting signal peptide.

Can use in the method for the invention various Pichi strain well known in the art, it includes but not limited to X-33, GS115 and KM71.

Can interosculate at above-mentioned each technical characterictic of the present invention with at (as embodiment) specifically described each technical characterictic below, thereby form new or preferred technical scheme.

Technique effect of the present invention

The present invention staff finds, when using α-factor Pre-Pro sequence as signal peptide, and the Pro-MICA that exists the Pro sequence of quite a few not to be cut in the supernatant that can cause fermenting.Thereby this researchist adopts the Pre sequence of α-factor as signal peptide, has solved the residual problem of Pro sequence, Fig. 3 is shown in typical effect displaying.

The present invention staff finds, uses the molecular weight of the inventive method expression and the molecular weight of MICA albumen of preparation and the MICA albumen of the expression of cell lines of employment very approaching.Process the MICA albumen (seeing Fig. 7) of purifying with Glycosylase F, find that molecular weight becomes theoretical value 34kDa, shown that MICA is glycosyl modified by N-, the natural form of this and MICA is very approaching.

It is high that the inventive method is expressed output, the output that shake flask fermentation just can realize >=20mg/L.Meanwhile, the post-processed of fermented liquid and purifying are convenient, just can realize purge process by Ni column purification and this two step of S100HR molecular sieve purification.

More specifically, the invention provides the following:

1. for the expression cassette at pichia spp efficiently expressing recombinant human MICA albumen, it is characterized in that described expression cassette from 5 ' to 3 ' comprises following element successively:

(1) the pichia spp promotor that controlling gene is transcribed;

(2) control the signal peptide sequence of described recombinant human MICA secreting, expressing in pichia spp;

(3) encoding sequence of described recombinant human MICA; With

(4) transcription terminator;

Wherein said signal peptide sequence is the Pre sequence of α-factor, and its nucleotide sequence is as shown in SEQ ID No:9.

2. according to the expression cassette described in 1, the encoding sequence of wherein said recombinant human MICA is as shown in SEQ IDNo:10.

3. according to the expression cassette described in 1, wherein said promotor is the AOX1 promotor in pPIC9K plasmid, and described transcription terminator is the AOX1 transcription terminator in pPIC9K plasmid.

4. according to the expression cassette described in 3, its sequence is as shown in SEQ ID No:13.

5. according to the expression cassette described in 1, wherein said promotor is the GAP promotor in pGAPZ α-A plasmid, and described transcription terminator is the GAP transcription terminator in pGAPZ α-A plasmid.

6. according to the expression cassette described in 5, its sequence is as shown in SEQ ID No:14.

7. a Pichia yeast engineering, described Pichia yeast engineering contains the expression cassette described in 3 or 4.

8. a Pichia yeast engineering, described Pichia yeast engineering contains the expression cassette described in 5 or 6.

9. methanol induction is expressed an also method for Purification of Human MICA albumen, said method comprising the steps of:

(1) cultivate according to the Pichia yeast engineering described in 7, and by methanol induction of Pichia pastoris AOX1 promotor, make described engineering bacteria secreting, expressing people MICA albumen; With

(2) people MICA albumen described in purifying from fermented liquid.

10. a method for constitutive expression Purification of Human MICA albumen, said method comprising the steps of:

(1) cultivate according to the Pichia yeast engineering described in 8, and utilize GAP promotor to make described engineering bacteria composing type secreting, expressing people MICA albumen; With

(2) people MICA albumen described in purifying from fermented liquid.

Accompanying drawing explanation

Fig. 1: the structure schema of Pre-MICA-His/pPIC9K plasmid;

Fig. 2: the structure schema of Pre-MICA-His/pGAPZ-A plasmid;

Fig. 3: be better than the design sketch as signal peptide by complete α-factor Pre-Pro sequence as signal peptide by Pre sequence;

Fig. 4: Western blotting (Western blotting) detects methanol induction MICA and expresses;

Fig. 5: Western blotting (Western blotting) test set moulding MICA expresses;

Fig. 6: the peak figure of molecular sieve S100HR purifying;

Fig. 7: coomassie brilliant blue staining method detects the MICA that Glycosylase F processes.

Embodiment

Experiment material

1.1 bacterial strains and plasmid

Pichia pastoris phaff (Pichia pastoris) bacterial strain GS115 and X-33, pPIC9K plasmid and pGAPZ-A plasmid are purchased from Invitrogen company.

1.2 reagent

TRIzol is purchased from Invitrogen company; M-MLV Reverse Transcriptase is purchased from Life Technologies; Oligo dT is purchased from the raw work in Shanghai; PMD18-T is purchased from precious biotechnology; Yeast Nitrogen Base (YNB) is purchased from BD company; Yeast Extract and Trypton are purchased from OXOID company; D-Sorbitol, Biotin, archaeal dna polymerase, T4DNA ligase enzyme, restriction enzyme, albumen marker and PAGE preparation related reagent are purchased from the raw work in Shanghai; Plasmid extraction test kit, PCR product reclaim test kit, DNA glue reclaims test kit purchased from Axygen company; G418 is purchased from Sigma-Aldrich company; Glycosylase F is purchased from New England Biolabs company; Anti-His-label mAb is purchased from Abmart company; Two anti-anti-mouse IgG-HRP are purchased from Bio Legend company; Other chemical reagent are purchased from traditional Chinese medicines group.

In following embodiment, other experimental techniques that use if no special instructions, are ordinary method.

Other material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.

Embodiment 1. methanol induction MICA express and preparation method, comprise the following steps:

The structure of 1.1Pre-MICA-His/pPIC9K plasmid

1.1.1 clone the encoding sequence (Met1-Ala383) of complete MICA gene

Extract the monocytic total RNA of in vitro healthy human peripheral blood (purchased from blood station, Hefei) with TRIzol and by its specification sheets, under the effect of M-MLV Reverse Transcriptase, the synthetic people cDNA take oligo dT as primer.Again take the cDNA that synthesizes as template, carry out PCR with primer-1 (SEQ ID No:3) and primer-2 (SEQ ID No:4), PCR product is inserted into TA carrier pMD18-T, obtain MICA/pMD18T.Plasmid is entrusted the order-checking of handsome company, and result is consistent with expection.

1.1.2 the fusion fragment Pre-MICA-His of Pre sequence, MICA encoding sequence (Glu24-Gln308) and 6 × His label increases

(1) take MICA/pMD18T plasmid as template, carry out PCR with primer-3 (SEQ ID No:5) and primer-4 (SEQ ID No:6), PCR reaction conditions is: first 94 ℃ 3 minutes; Then 94 ℃ 30 seconds, 55 ℃ 40 seconds, 72 ℃ 1 minute, totally 30 circulations; Last 72 ℃ 10 minutes.After reaction finishes, the PCR product obtaining is carried out to 1% agarose gel electrophoresis detection, obtain the band of an about 920bp of size, conform to expected results.Finally, reclaiming test kit with PCR product reclaims PCR fragment.

(2) reclaiming product with the PCR of above-mentioned (1) is template, carries out PCR with primer-5 (SEQ ID No:7) and primer-4 (SEQ ID No:6), and PCR reaction conditions is: 94 ℃ of elder generations 3 minutes; Then 94 ℃ 30 seconds, 55 ℃ 40 seconds, 72 ℃ 1 minute, totally 30 circulations; Last 72 ℃ 10 minutes.After reaction finishes, the PCR product obtaining is carried out to 1% agarose gel electrophoresis detection, obtain the band of an about 955bp of size, conform to expected results.Finally, reclaim test kit with PCR product PCR fragment is reclaimed, and then obtained Pre-MICA-His fragment (N-terminal is with BamH I restriction enzyme site, and C-terminal is with Not I restriction enzyme site).

1.1.3Pre-MICA-His being connected of fragment and pPIC9K plasmid

With BamH I and Not I double digestion Pre-MICA-His fragment and pPIC9K plasmid respectively, purifying reclaims Pre-MICA-His fragment and pPIC9K plasmid respectively, then with the connection of T4DNA ligase enzyme, and transformed competence colibacillus bacillus coli DH 5 alpha, screening positive clone.Positive recombinant plasmid is entrusted the order-checking of handsome company, result shows Pre-MICA-His fragment and pPIC9K plasmid exact connect ion, and Pre-MICA-His sequence is consistent with expection, and then has obtained Pre-MICA-His/pPIC9K expression plasmid, and whole structure flow process is shown in Fig. 1.

In the above plasmid, the encoding sequence of MICA albumen is as follows:, (, ATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCC, GCATTAGCT, ), <GAGCCCCACAGTCTTCGTTATAACCTCACGGTGCTGT, CCTGGGATGGATCTGTGCAGTCAGGGTTTCTCACTGAGGTACATCTG, GATGGTCAGCCCTTCCTGCGCTGTGACAGGCAGAAATGCAGGGCAA, AGCCCCAGGGACAGTGGGCAGAAGATGTCCTGGGAAATAAGACATG, GGACAGAGAGACCAGAGACTTGACAGGGAACGGAAAGGACCTCAG, GATGACCCTGGCTCATATCAAGGACCAGAAAGAAGGCTTGCATTCCC, TCCAGGAGATTAGGGTCTGTGAGATCCATGAAGACAACAGCACCAG, GAGCTCCCAGCATTTCTACTACGATGGGGAGCTCTTCCTCTCCCAAA, ACCTGGAGACTAAGGAATGGACAATGCCCCAGTCCTCCAGAGCTCA, GACCTTGGCCATGAACGTCAGGAATTTCTTGAAGGAAGATGCCATGA, AGACCAAGACACACTATCACGCTATGCATGCAGACTGCCTGCAGGA, ACTACGGCGATATCTAAAATCCGGCGTAGTCCTGAGGAGAACAGTGC, CCCCCATGGTGAATGTCACCCGCAGCGAGGCCTCAGAGGGCAACAT, TACCGTGACATGCAGGGCTTCTGGCTTCTATCCCTGGAATATCACACT, GAGCTGGCGTCAGGATGGGGTATCTTTGAGCCACGACACCCAGCAG, TGGGGGGATGTCCTGCCTGATGGGAATGGAACCTACCAGACCTGGG, TGGCCACCAGGATTTGCCAAGGAGAGGAGCAGAGGTTCACCTGCTA, CATGGAACACAGCGGGAATCACAGCACTCACCCTGTGCCCTCTGGG, AAAGTGCTGGTGCTTCAGAGTCATTGGCAG>[CATCATCACC ATCACC, AT] TAA

Wherein, in (), be signal peptide Pre nucleotide sequence (SEQ ID No:9); In <>, be MICA coding nucleotide sequence (SEQ ID No:10); In [], be 6 × His labelled nucleotide sequence (SEQ ID No:11).Pre aminoacid sequence after translation is as shown in SEQ ID No:1; The aminoacid sequence of MICA is as shown in SEQ ID No:12.

1.2Pre-MICA-His/pPIC9K recombinant expression plasmid electricity transforms pichia spp

With Sal I linearizing Pre-MICA-His/pPIC9K recombinant expression plasmid, ethanol precipitation reclaims.Get the plasmid after 5-10 μ g linearizing, transform cup with 0.2cm electricity and carry out electricity conversion Pichi strain GS115 (parameter setting: voltage 1500V, electric capacity 25 μ F, 200 ohm of resistance, discharge time 4-5ms), coated plate at MD plate (l.34%YNB, 2%Glucose, 2%Agar), be positioned in 28 ℃ of biochemical cultivation cases and cultivate 3-5 days.

In the time that the mono-clonal on MD plate grows to diameter 1-2mm, with the mono-clonal of aseptic toothpick picking part and be scoring to the YPD plate (2%Tryptone that contains G418,1%Yeast Extract, 2%Glucose, l.5%Agar) carry out G418 resistance screening to obtain the copy number of higher MICA expression cassette, the concentration of G418 is respectively 500 μ g/ml, 1mg/ml, 2mg/ml, 3mg/ml and 4mg/ml.In the time that the monoclonal diameter on the YPD of above-mentioned G418 resistance plate is 1-2mm, picking mono-clonal carries out MICA protein expression evaluation (concrete grammar is shown in 1.3 parts).

The expression of 1.3 methanol induction MICA albumen and Western blotting (Western blotting) are identified

Picking mono-clonal access the YPD substratum (2%Tryptone, 1%Yeast extract, 2%Glucose) of 10ml from the YPD plate that contains G418 resistance, is placed in 28 ℃ of shaking tables, and 200rpm shakes and spends the night.Next day, in the time that the thalline OD600 in YPD culture reaches 2-6, get the culture that biomass is equivalent to 0D600=10,1500g is centrifugal and abandon supernatant.Thalline is resuspended with aseptic distilled water, and 1500g is centrifugal and abandon supernatant again.Wash thalline one time with aseptic double-distilled water again, step is the same.Finally, the thalline of centrifugal acquisition is resuspended in to BMMY substratum (2%Tryptone, 1%Yeast Extract, the 1.34%YNB of 10ml, 0.1M phosphate buffered saline buffer, 1%methanol, pH=6), be placed in the shaking table of 28 ℃, 250rpm, abduction delivering 24 hours.

Collect the methanol induction culture of 24 hours, get part culture and detect for OD600, remaining culture 12000g, 4 ℃ of centrifugal 10min, and collect supernatant.Get part supernatant for Western blotting sample preparation, and carry out electrophoresis with 10% SDS-PAGE albumin glue.The primary antibodie that Western blotting uses is anti-His, and two resist the lgG-HRP for anti-mouse.Calculate the optical density value of Western blot band and the ratio size of thalline OD600 value, the foundation of screening using this as efficient expression strain, typical Western blotting the results are shown in Figure 4.

The shake flask fermentation of 1.4MICA albumen and purifying

Get a recombinant expressed bacterium of frozen MICA, dip a small amount of bacterium liquid and line YPD plate with aseptic toothpick, be placed in 28 ℃ of incubators and cultivate 3-5 days.In the time that mono-clonal grows to 1-2mm, picking mono-clonal is inoculated in the YPD substratum of 10ml, is placed in 28 ℃ of shaking tables, 200rpm overnight incubation.Next day, in the time of OD600=6 left and right, is transferred to 10ml culture in the BMGY of 200ml, continues overnight incubation.The 3rd day, in the time that in the culture of 200ml, OD600 is 6-10, the culture 1500g of 200ml, the centrifugal 5min of normal temperature, abandoned supernatant.After resuspended with the aseptic double-distilled water of 100ml, the centrifugal 5min of 1500g normal temperature, then abandon supernatant.Repeat distilled water resuspended, centrifugal and abandon supernatant.Finally, with the resuspended thalline of BMMY substratum of 200ml, be placed in 25 ℃ of shaking tables, 250rpm, methanol induction is expressed 72 hours.

The purification step of MICA albumen is as follows: (1) fermented liquid, for the centrifugal 20min of 12000g at 4 ℃, is collected fermentation supernatant.(2) with Flex Stand system and 0.45 μ m microfiltration cartridge, the fermentation supernatant of upper step is filtered one time.(3) carry out purifying with the Ni-post of XK26/20 post (purchased from GE healthcare company) and Ni-agarose (purchased from GE healthcare company) assembling and reclaim MICA albumen.(4) use the super filter tube (purchased from Millipore company) of 10kDa to concentrate the MICA albumen of Ni post wash-out.(5) molecular sieve (purchased from GE healthcare company) the MICA albumen of purifying Ni post wash-out further of use S100HR.(6) use the super filter tube of 10kDa to concentrate the MCIA albumen of S100 molecular sieve purification, make the concentration of MICA albumen more than 1mg/ml, endotoxin content is lower than 0.1EU/ μ g albumen.

The purifying peak figure of typical S100HR molecular sieve is shown in Fig. 6.

Embodiment 2.MICA constitutive expression and preparation method

Be different from embodiment 1, the promotor that control MICA in this embodiment expresses is pGAP, and Pre-MICA-His encoding sequence is without any change, and concrete steps and details are as follows:

The structure of 2.1Pre-MICA-His/pGAPZ-A plasmid

The encoding sequence (Met1-Ala383) of 2.1.1 cloning complete MICA gene, step and method, with embodiment 1, are not repeated herein.

2.1.2 the fusion fragment Pre-MICA-His of Pre sequence, MICA encoding sequence (Glu24-Gln308) and 6 × His label increases

Except replacing to primer-6 (SEQ ID No:8) for the forward primer of PCR by primer-5 in " 1.1.2 (2) of embodiment 1 ", other step and method, with embodiment 1, are not repeated herein.

2.1.3Pre-MICA-His being connected of fragment and pGAPZ-A plasmid, obtain Pre-MICA-His/pGAPZ-A recombinant expression plasmid

With EcoR I and Not I double digestion Pre-MICA-His fragment and pGAPZ-A plasmid respectively, purifying reclaims Pre-MICA-His fragment and pGAPZ-A plasmid respectively, then with the connection of T4DNA ligase enzyme, and transformed competence colibacillus bacillus coli DH 5 alpha, screening positive clone.Other step and method, with embodiment 1, are not repeated herein.

2.2Pre-MICA-His/pGAPZ-A recombinant expression plasmid electricity transforms pichia spp

With Avr II linearizing Pre-MICA-His/pGAPZ-A recombinant expression plasmid, ethanol precipitation reclaims.Get the plasmid after 5-10 μ g linearizing, transform cup with 0.2cm electricity and carry out electricity conversion Pichi strain X-33 (parameter setting: voltage 1500V, electric capacity 25 μ F, 200 ohm of resistance, discharge time 4-5ms), YPD plate (the 2%Tryptone that coated plate is containing Zeocin resistance, 1%Yeast Extract, 2%Glucose, 1.5%Agar, 100 μ g/ml Zeocin), be positioned in 28 ℃ of biochemical cultivation cases and cultivate 3-5 days.

In the time that the mono-clonal on the YPD of Zeocin resistance plate grows to diameter 1-2mm, with the mono-clonal of aseptic toothpick picking part and be scoring to the YPD plate that contains higher Zeocin concentration, to obtain the copy number of higher MICA expression cassette, the concentration of Zeocin is respectively 250 μ g/ml, 500 μ g/ml, 1mg/ml and 2mg/ml.In the time that the monoclonal diameter on the YPD of above-mentioned Zeocin resistance plate is 1-2mm, picking mono-clonal carries out MICA protein expression evaluation (concrete grammar is shown in following 2.3 parts).

The constitutive expression of 2.3MICA albumen and Western blotting identify

Picking mono-clonal access the YPD substratum of 10ml from the YPD plate that contains Zeocin resistance, is placed in 28 ℃ of shaking tables, and 200rpm shakes and spends the night.Next day, in the time that the thalline OD600 in YPD culture reaches 2-6, get the culture that biomass is equivalent to 0D600=10,1500g is centrifugal and abandon supernatant.Thalline is resuspended with aseptic distilled water, and 1500g is centrifugal and abandon supernatant again.Wash thalline one time with aseptic double-distilled water again, step is the same.Finally, the thalline of centrifugal acquisition is resuspended in to BMGY substratum (2%Tryptone, 1%Yeast Extract, the 1.34%YNB of 10ml, 0.1M phosphate buffered saline buffer, 1%Glycerol, pH=6), be placed in the shaking table of 28 ℃, 250rpm, abduction delivering 24 hours.

The method of Western blotting detection protein expression and step, with embodiment 1, are not repeated herein.The Western blot of this method detects effect and sees Fig. 5

The shake flask fermentation of 2.4MICA albumen and purifying

The fermentation step of constitutive expression MICA is as follows: (1) gets a recombinant expressed bacterium of frozen MICA, dips a small amount of bacterium liquid and lines YPD plate with aseptic toothpick, is placed in 28 ℃ of incubators and cultivates 3-5 days.(2) in the time that mono-clonal grows to 1-2mm, picking mono-clonal is inoculated in the YPD substratum of 10ml, is placed in 28 ℃ of shaking tables, 200rpm overnight incubation (3) is in the time of OD600=2-6 left and right, 10ml culture is transferred in the BMGY of 200ml, is placed in 28 ℃ of shaking tables, 250rpm overnight incubation.(4) to 50% the aseptic glycerine of adding 4ml in fermented liquid, continue to cultivate 24 hours.(5) collect fermentation supernatant.

The purification step of MICA albumen, with 1.4, is not repeated herein.

Claims (10)

1. for the expression cassette at pichia spp efficiently expressing recombinant human MICA albumen, it is characterized in that described expression cassette from 5 ' to 3 ' comprises following element successively:

(1) the pichia spp promotor that controlling gene is transcribed;

(2) control the signal peptide sequence of described recombinant human MICA secreting, expressing in pichia spp;

(3) encoding sequence of described recombinant human MICA; With

(4) transcription terminator;

Wherein said signal peptide sequence is the Pre sequence of α-factor, and its nucleotide sequence is as shown in SEQ ID No:9.

2. expression cassette according to claim 1, the encoding sequence of wherein said recombinant human MICA is as shown in SEQ ID No:10.

3. expression cassette according to claim 1, wherein said promotor is the AOX1 promotor in pPIC9K plasmid, and described transcription terminator is the AOX1 transcription terminator in pPIC9K plasmid.

4. expression cassette according to claim 3, its sequence is as shown in SEQ ID No:13.

5. expression cassette according to claim 1, wherein said promotor is the GAP promotor in pGAPZ α-A plasmid, and described transcription terminator is the GAP transcription terminator in pGAPZ α-A plasmid.

6. expression cassette according to claim 5, its sequence is as shown in SEQ ID No:14.

7. a Pichia yeast engineering, described Pichia yeast engineering contains the expression cassette described in claim 3 or 4.

8. a Pichia yeast engineering, described Pichia yeast engineering contains the expression cassette described in claim 5 or 6.

9. methanol induction is expressed an also method for Purification of Human MICA albumen, said method comprising the steps of:

(1) cultivate Pichia yeast engineering according to claim 7, and by methanol induction of Pichia pastoris AOX1 promotor, make described engineering bacteria secreting, expressing people MICA albumen; With

(2) people MICA albumen described in purifying from fermented liquid.

10. a method for constitutive expression Purification of Human MICA albumen, said method comprising the steps of:

(1) cultivate Pichia yeast engineering according to claim 8, and utilize GAP promotor to make described engineering bacteria composing type secreting, expressing people MICA albumen; With

(2) people MICA albumen described in purifying from fermented liquid.

Images