CN109735547B - Promoter for improving pichia pastoris exogenous protein expression quantity and application thereof - Google Patents
Promoter for improving pichia pastoris exogenous protein expression quantity and application thereof Download PDFInfo
- Publication number
- CN109735547B CN109735547B CN201910205929.0A CN201910205929A CN109735547B CN 109735547 B CN109735547 B CN 109735547B CN 201910205929 A CN201910205929 A CN 201910205929A CN 109735547 B CN109735547 B CN 109735547B
- Authority
- CN
- China
- Prior art keywords
- promoter
- thr
- leu
- gly
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention provides a novel promoter which can obviously improve the expression quantity of pichia pastoris to exogenous proteins. The promoter can generally improve the expression quantity of enzyme genes such as hemicellulase, peroxidase, protease and the like in pichia pastoris by 76-320 percent, has obvious effect, thereby being beneficial to greatly reducing the production cost of the enzyme and promoting the wide application of the enzyme.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a promoter for improving the expression quantity of pichia pastoris protein and application thereof.
Background
The pichia expression system is a novel foreign protein expression system developed in the early 80 s of the last century, and has obvious superiority compared with an escherichia coli expression system, such as: the multiplication time is short, and the fermentation period is short; the genome is simple and convenient to operate; the culture conditions are relatively simple, and high-density culture is easy to carry out, so that higher target protein yield can be obtained; the foreign protein can be folded and glycosylated to form disulfide bond; meanwhile, the method also avoids the defects of poor secretion efficiency of the saccharomyces cerevisiae, unstable expression strains, easy loss of expression plasmids and the like; in addition, in terms of glycosylation degree, the average length of each side chain added to the foreign protein in the pichia pastoris is 8-14 mannose residues, which is much shorter than the average length of 50-150 mannose residues of each side chain of the saccharomyces cerevisiae, and the excessive glycosylation phenomenon cannot be generated; in addition, pichia pastoris secretes little extracellular protein itself, which is very advantageous for later protein purification.
At present, many exogenous genes are successfully expressed in pichia pastoris, but the expression quantity of many proteins is not ideal. Although the yield of the expressed protein is greatly influenced by the genetic characteristics of the protein, the expression amount of the foreign gene can be remarkably increased by fully utilizing certain factors influencing the gene expression and the product stability. Such as the choice of expression promoter, the influence of the copy number of the foreign gene, the characteristics and codon preference of the foreign gene, the expression conditions, the stability of the product, and the like.
Among them, the promoter most commonly used at present is pAOX1, which can strictly regulate alcohol oxidase gene AOX1 and can induce the expression of foreign genes downstream of the promoter in the presence of methanol. To date, many foreign proteins have been expressed by this promoter, such as acetylcholinesterase derived from human brain tissue, superoxide dismutase (SOD) derived from Saccharomyces cerevisiae, and thermostable xylanase derived from Chaetomium thermophilum.
In addition, pGAP was developed by Waterham et al in 1997 as a promoter of glyceraldehyde-3-phosphate dehydrogenase gene that was not induced with methanol. The pGAP promoter enables Pichia pastoris to be induced to express by glucose, and the promoter exists in the constitutive plasmid pGAPZa (A, B, C). It has been reported that some foreign proteins have been expressed by the pGAP promoter.
Other promoters such as FLD1 (glutathione-dependent formaldehyde dehydrogenase gene) promoter, hypoxia inducible promoter Ps ADH, DHAS (dihydroxyacetone synthase), PEX8 (peroxide bioprotein), YPT1 (GTP-binding protein) and the like have been reported in a few studies and applications.
In order to further optimize the pichia pastoris expression system, and especially to further improve the application value of the pichia pastoris expression system in the production of industrial enzyme preparations, the improvement of the capability of pichia pastoris in expressing foreign proteins is urgently needed. Therefore, the present invention provides a high-efficiency promoter by screening, so that the expression level of the foreign protein is increased at the transcription level.
Disclosure of Invention
The invention provides a novel promoter for solving the problems of the prior art, and the promoter can effectively improve pichia pastoris (Pichia pastoris)Pichia pastoris) The expression amount of the foreign protein is increased, thereby being beneficial to greatly reducing the production cost of the target protein.
In one aspect of the present invention, there is provided a promoter comprising:
a) a promoter having the nucleotide sequence of SEQ ID NO. 1;
b) the promoter has the similarity of not less than 90% with the promoter sequence in the a) and has the function of the promoter in the a).
The invention provides an expression vector, which comprises the promoter.
The invention also provides a foreign protein expression system, which comprises a host and an expression vector, wherein the host is pichia pastoris, and the expression vector is the expression vector.
The invention also provides a method for expressing the foreign protein, which comprises the following steps:
1) cloning a foreign gene;
2) constructing a recombinant expression vector carrying the exogenous gene in the step 1) by using the expression vector;
3) and transforming the recombinant expression vector into pichia pastoris to obtain a recombinant strain for recombinant expression of the foreign protein.
The protein is selected from one or more of hemicellulase, peroxidase, protease, cellulase, xylanase, lipase, phospholipase, esterase, cutinase, pectinase, keratinase, reductase, oxidase, phenol oxidase, lipoxygenase, ligninase, pullulanase, tannase, pentosanase, malic enzyme, beta-glucanase, arabinosidase, hyaluronidase, chondroitinase, laccase, amylase and glucoamylase.
The protein is selected from acetyl esterase, aminopeptidase, amylase, arabinase, arabinofuranosidase, carboxypeptidase, catalase, cellulase, chitinase, chymosin, cutinase, deoxyribonuclease, epimerase, esterase, alpha-galactosidase, beta-galactosidase, alpha-glucanase, glucan lyase, endo-beta-glucanase, glucoamylase, glucose oxidase, alpha-glucosidase, beta-glucosidase, glucuronidase, hemicellulase, hexose oxidase, hydrolase, invertase, isomerase, laccase, lipase, lyase, mannosidase, oxidase, oxidoreductase, pectate lyase, pectin acetylesterase, pectin depolymerase, pectin methylesterase, pectin lyase, peroxidase, pectinase, xylanase, isomerase, laccase, lipase, lyase, mannosidase, glucosidase, xylanase, laccase, xylanase, a lipase, a xylanase, a lipase, a xylanase, a lipase, a xylanase, a lipase, a xylanase, a lipase, a xylanase, a lipase, a xylanase, any one or more of phenol oxidase, phytase, polygalacturonase, protease, rhamnogalacturonase, ribonuclease, thaumatin, transferase, transport protein, transglutaminase, xylanase and hexose oxidase.
The novel promoter ATX provided by the invention can obviously improve the expression quantity of pichia pastoris to foreign proteins. Compared with a control group using a promoter AOX1, the expression level of phytase APPA is increased by 91%, the expression level of mannase is increased by 374%, and unexpected technical effects are achieved. The promoter ATX can also generally improve the expression quantity of enzyme genes such as hemicellulase, peroxidase, protease and the like in pichia pastoris by 76-320 percent, and has obvious effect. The promoter is favorable for greatly reducing the production cost of the enzyme protein and promoting the wide application of the enzyme protein.
Detailed Description
The methods of the invention are further illustrated below by way of examples, in which experimental procedures not specifying the conditions are generally run under conventional conditions, e.g., as described in molecular cloning, a laboratory Manual, written by J. Sambruke (Sambrook), et al, or as recommended by the manufacturer. The present invention may be better understood and appreciated by those skilled in the art with reference to the following examples. However, the method of carrying out the present invention should not be limited to the specific method steps described in the examples of the present invention.
Strain and carrier: coli DH5 a, Pichia pastoris GS115, vector pPIC9k, pPICZA, Amp, G418, Zeocin were purchased from Invitrogen.
Enzyme and kit: DNA polymerase was purchased from Takara, T4 ligase, restriction enzyme from Fermentas, plasmid extraction kit and gel purification recovery kit from Omega.
The formula of the culture medium is as follows:
coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, ph 7.0;
LB + Amp medium: adding 100 mu g/mL ampicillin into LB culture medium;
coli medium (LC medium): 0.5% yeast extract, 1% peptone, 0.5% NaCl, ph 7.5;
LC + Zeocin medium: adding 30 mu g/ml Zeocin into LC culture medium;
yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;
YPD + Zeocin medium: adding 100 mu g/ml Zeocin into YPD culture medium;
BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10-5Biotin, 1% glycerol;
BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10-5Biotin, 0.5% methanol.
Example 1 design, cloning of novel promoter ATX and construction of expression plasmid
1. Design and cloning of novel promoter ATX
The applicant removes a TATA box sequence in a gene sequence based on the gene sequence of an alcohol oxidase promoter AOX1 of pichia pastoris, and the modified new promoter sequence is SEQ ID NO 1 and is named as ATX. The novel promoter ATX was synthesized from the entire gene of Huada Gene Co.
The new promoter ATX was cloned using PCR reaction with the following primers and reaction conditions:
primer 1 (F): ATCAGATCTAACATCCAAAGACGAAAGGTTGAA
Primer 1 (R): CGTTTGGATCCTTCGAATAATTAGTTGTTTTTTG
The PCR conditions were: denaturation at 94 deg.C for 5 min; then denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, extension at 72 ℃ for 1min, and after 35 cycles, heat preservation at 72 ℃ for 10 min. The new promoter ATX gene has total length 941 bp.
Construction of the novel expression vector pATX9K
Restriction enzyme for the cloned novel promoter ATX geneBglII andBamh I is subjected to double digestion, and a 50-microliter digestion system is as follows: 43. mu.l of PCR product of ATX gene of the novel promoter, 5. mu.l of 10 XFastdigest Buffer,BglII 1. mu.l andBam1 μ l of HI. After digestion at 37 ℃ for 2h, the product was recovered by agarose gel electrophoresis.
The 50. mu.l digestion system for the expression vector pPIC9K was as follows: the expression vector pPIC9K 43. mu.l, 10 XFastdigest Buffer 5. mu.l,BglII 1. mu.l andBam1 μ l of HI. After digestion at 37 ℃ for 2h, the product was recovered by agarose gel electrophoresis.
Will be passed throughBglII andBamthe new promoter ATX gene fragment of HI double enzyme digestion is connected with an expression vector pPIC9K to construct a new expression plasmid pATX 9K. The linking system is as follows: 5 mul of expression vector pPIC9K double enzyme digestion product, 3 mul of new promoter ATX gene double enzyme digestion product, 10 XT4 ligase buffer 1 μl、T41 μ l of ligase. The ligation was carried out overnight at 22 ℃ and transformed into E.coli DH 5. alpha. and transformants were picked for sequencing verification. And transferring the transformant which is verified to be correct by sequencing into an LB + Amp liquid culture medium, carrying out overnight culture at 37 ℃, and obtaining the quality-improved particles, namely the new expression plasmid pATX 9K.
The applicant cloned the alcohol oxidase promoter AOX1 by referring to the above method, and linked the promoter AOX1 to the expression vector pPIC9K to construct expression plasmid pAOX9K as a control group.
Example 2 construction of Pichia engineering Strain for recombinant expression of Phytase
1. Phytase gene linked expression vector pATX9K
The escherichia coli phytase APPA (the nucleotide sequence is SEQ ID NO: 3, and the coding amino acid sequence is SEQ ID NO: 4) is treated by restriction endonucleaseEcoR I andNoti, carrying out double digestion, wherein 50 ul of digestion system is as follows: mu.l of phytase APPA, 5. mu.l of 10 XFastdigest Buffer,EcoR I 1 μl、NotI1. mu.l. After digestion at 37 ℃ for 2h, the product was recovered by agarose gel electrophoresis.
The new vector pATX9K was treated with restriction enzymesEcoR I andNoti, carrying out double digestion, wherein 50 ul of digestion system is as follows: the new vector pATX9K 43. mu.l, 10 XFastdigest Buffer 5. mu.l,EcoR I 1 μl、NotI1. mu.l. After digestion at 37 ℃ for 2h, the product was recovered by agarose gel electrophoresis.
Will be passed throughEcoR I andNoti the double enzyme digestion phytase APPA fragment is connected with a new vector pATX9K to construct a recombinant plasmid pATX 9K-APPA. The linking system is as follows: double enzyme digestion product of expression vector pATX9K5 ul of the product, 3 ul of phytase APPA gene double digestion product, 10 XT4 ligase buffer 1 μl、T41 μ l of ligase. The ligation was carried out overnight at 22 ℃ and transformed into E.coli DH 5. alpha. and transformants were picked for sequencing verification. And transferring the transformant which is verified to be correct by sequencing into an LB + Amp liquid culture medium, carrying out overnight culture at 37 ℃, and obtaining the quality-improved particles, namely the recombinant yeast expression plasmid pATX 9K-APPA.
Transformation of yeast expression plasmid pATX9K-APPA
The recombinant yeast expression plasmid pATX9K-APPA is usedSacI, linearization is carried out, a linearization product is purified by a column purification kit, and then pichia pastoris GS115 is transformed by an electroporation method and coated on an MD plate. The colonies grown on the MD plates were transformants into which plasmid pATX9K-APPA was introduced. YPD plates containing different concentrations of geneticin G418 were then plated to select multiple copies of transformants.
Shake flask fermentation verification
A plurality of transformants are picked and respectively inoculated into a BMGY culture medium, are subjected to shaking culture at 30 ℃ and 220rpm for 24 hours, are then transferred into a BMMY culture medium, are subjected to shaking culture at 30 ℃ and 220rpm, and are added with 0.5 percent of methanol every 24 hours. After the induction expression for 4d, the thalli are removed by centrifugation, and the phytase activity of the supernatant is measured. The results show that the highest shake flask fermentation enzyme activity of the transformant which is introduced with the plasmid pATX9K-APPA reaches 4651U/ml, and the applicant names the transformant as pichia pastoris ATX-12 (A)Pichia pastorisATX-12）。
As a control group, the applicant refers to the same operation as the above, connects the phytase APPA gene with an expression plasmid pAOX9K to construct a recombinant yeast expression plasmid pAOX9K-APPA, then obtains a transformant of a transfer plasmid pAOX9K-APPA through transformation, the highest enzyme activity of shake flask fermentation reaches 2434U/ml, and the transformant is named as Pichia pastoris AOX-3 (a)Pichia pastoris AOX-3）。
The results show that the novel promoter ATX provided by the invention can obviously improve the expression quantity of phytase APPA of pichia pastoris, and compared with a control group using the promoter AOX1, the expression quantity of phytase is improved by 91%, and unexpected technical effects are achieved.
(1) Definition of the enzyme Activity Unit of Phytase
At 37 deg.C and pH5.5, 1 μmol of inorganic phosphorus is released from sodium phytate with concentration of 5.0mmol/L per minute, and the unit of phytase activity is expressed by U.
(2) Method for measuring enzyme activity of phytase
Two 25mL colorimetric tubes A and B were taken, 1.8mL of an acetic acid buffer (pH 5.0) and 0.2mL of a sample reaction solution were added, mixed, and preheated at 37 ℃ for 5 min. Adding 4mL of substrate solution into the tube A, adding 4mL of stop solution into the tube B, mixing uniformly, reacting for 30min at 37 ℃, adding 4mL of stop solution into the tube A after the reaction is finished, adding 4mL of substrate solution into the tube B, and mixing uniformly. Standing for 10min, and measuring absorbance at 415nm wavelength respectively. For each sample, 3 replicates were taken and the absorbance was averaged and phytase activity was calculated by the regression line equation using a standard curve.
Enzyme activity X is F × C/(m × 30)
Wherein: x is the unit of enzyme activity, U/g (mL);
f is the total dilution multiple of the sample solution before reaction;
c is enzyme activity, U, calculated by a linear regression equation according to the light absorption value of the actual sample liquid;
m is sample mass or volume, g/mL;
30-reaction time.
Example 3 construction of Pichia engineering Strain recombinantly expressing mannanase
In order to further verify that the promoter ATX provided by the invention has a remarkable promoting effect on the expression of other exogenous proteins, the applicant constructs a Pichia pastoris engineering strain for recombinant expression of mannanase MAN (the nucleotide sequence of which is SEQ ID NO: 5 and the coding amino acid sequence of which is SEQ ID NO: 6) by using the novel promoter ATX according to the method described in example 2, and simultaneously uses the Pichia pastoris engineering strain for recombinant expression of mannanase MAN constructed by using the promoter AOX1 as a control group.
Selecting the above engineering strains, inoculating into BMGY culture medium, performing shake culture at 30 deg.C and 220rpm for 24 hr, transferring into BMMY culture medium, performing shake culture at 30 deg.C and 220rpm0.5% methanol was added every 24 hours. After the induction expression for 4d, the thalli are removed by centrifugation, and the activity of the mannanase is measured by supernatant fluid. The result shows that the highest shake flask fermentation enzyme activity in the engineering strain constructed by using the new promoter ATX reaches 1276U/ml, and the applicant names the engineering strain as pichia pastoris ATX-M67 (Pichia pastoris ATX-M67）。
The highest shake flask fermentation enzyme activity in the pichia pastoris engineering strain constructed by using the promoter AOX1 in the control group reaches 269U/ml, and the engineering strain is named as pichia pastoris AOX-CSD2 (a)Pichia pastoris AOX-CSD2）。
The results show that the novel promoter ATX provided by the invention can obviously improve the expression quantity of the pichia pastoris to the mannanase MAN, and compared with a control group using the promoter AOX1, the expression quantity of the mannanase is improved by 374%, so that unexpected technical effects are achieved.
(1) Definition of mannanase enzyme Activity Unit
The amount of enzyme solution required to hydrolyze the substrate to produce 1. mu. mol mannose per minute at 37 ℃ and pH5.5 was one mannan activity unit.
(2) Method for measuring enzyme activity of mannase
0.6% locust bean gum mannan (Sigma, Batch #125K 0091) was used as a substrate, 0.1M acetic acid-sodium acetate (pH5.5) was used as a buffer, the mannan substrate was equilibrated at 37 ℃ for 20min, and the enzyme solution to be tested was equilibrated at 37 ℃ for 10 min. Taking 4 test tubes, respectively adding 2ml of enzyme solution, wherein 3 test tubes are used as measuring tubes, respectively adding 2ml of substrate solution, and the other test tube is used as a blank tube, adding 5ml of DNS solution, and carrying out water bath at 37 +/-0.5 ℃ for 30 minutes. Then 5ml of DNS solution is added into three measuring tubes respectively, 2ml of substrate solution is added into a blank tube, the reaction is carried out for 5 minutes in a boiling water bath, and the volume is determined to 25ml after the reaction is cooled. The absorbance was measured at spectrophotometer 540nn with a blank tube for zero setting.
Besides phytase and mannase, the novel promoter ATX provided by the invention can also generally improve the expression level of enzyme genes such as hemicellulase, peroxidase, protease, cellulase, xylanase, lipase, phospholipase, esterase, cutinase, pectinase, keratinase, reductase, oxidase, phenol oxidase, lipoxygenase, ligninase, pullulanase, tannase, pentosanase, malic enzyme, beta-glucanase, arabinosidase, hyaluronidase, chondroitinase, laccase, amylase, glucoamylase and the like in pichia pastoris by 76-320%, has obvious effect and obtains unexpected technical effect.
Sequence listing
<110> Qingdao blue biological group Co., Ltd
<120> promoter for improving pichia pastoris foreign protein expression quantity and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 941
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60
gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120
tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 180
agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 240
acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 300
tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 360
agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 420
gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg 480
ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcgcca taccgtttgt 540
cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 600
ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 660
ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 720
gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaaa 780
cagaaggaag ctgccctgtc ttaaaccttt ttttttatca tcattattag cttactttca 840
taattgcgac tggttccaat tgacaagctt ttgattttaa cgacttttaa cgacaacttg 900
agaagatcaa aaaacaacta attattcgaa ggatccaaac g 941
<210> 2
<211> 1233
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cagagtgagc cggagctgaa gctggaaagt gtggtgattg tcagtcgtca tggtgtgcgt 60
gctccaacca aggccacgca actgatgcag gatgtcaccc cagacgcatg gccaacctgg 120
ccggtaaaac tgggttggct gacaccgcgc ggtggtgagc taatcgccta tctcggacat 180
taccaacgcc agcgtctggt agccgacgga ttgctggcga aaaagggctg cccgcagtct 240
ggtcaggtcg cgattattgc tgatgtcgac gagcgtaccc gtaaaacagg cgaagccttc 300
gccgccgggc tggcacctga ctgtgcaata accgtacata cccaggcaga tacgtccagt 360
cccgatccgt tatttaatcc tctaaaaact ggcgtttgcc aactggataa cgcgaacgtg 420
actgacgcga tcctcagcag ggcaggaggg tcaattgctg actttaccgg gcatcggcaa 480
acggcgtttc gcgaactgga acgggtgctt aattttccgc aatcaaactt gtgccttaaa 540
cgtgagaaac aggacgaaag ctgttcatta acgcaggcat taccatcgga actcaaggtg 600
agcgccgaca atgtctcatt aaccggtgcg gtaagcctcg catcaatgct gacggagata 660
tttctcctgc aacaagcaca gggaatgccg gagccggggt ggggaaggat caccgattca 720
caccagtgga acaccttgct aagtttgcat aacgcgcaat tttatttgct acaacgcacg 780
ccagaggttg cccgcagccg cgccaccccg ttattagatt tgatcaagac agcgttgacg 840
ccccatccac cgcaaaaaca ggcgtatggt gtgacattac ccacttcagt gctgtttatc 900
gccggacacg atactaatct ggcaaatctc ggcggcgcac tggagctcaa ctggacgctt 960
cccggtcagc cggataacac gccgccaggt ggtgaactgg tgtttgaacg ctggcgtcgg 1020
ctaagcgata acagccagtg gattcaggtt tcgctggtct tccagacttt acagcagatg 1080
cgtgataaaa cgccgctgtc attaaatacg ccgcccggag aggtgaaact gaccctggca 1140
ggatgtgaag agcgaaatgc gcagggcatg tgttcgttgg caggttttac gcaaatcgtg 1200
aatgaagcac gcataccggc gtgcagtttg taa 1233
<210> 3
<211> 410
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln
50 55 60
Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110
His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile
130 135 140
Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 4
<211> 1281
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
caggtggcgg aatatggcca gtgtggcgga aaaggatggt cgggcagcac aacgtgccag 60
tctccataca cctgtcaata ccagaatgac tggtacagtc aatgcttgcc aggaacagga 120
tcgggtggcg cgacaaccac caccacgacc accaccaccg ccaagacaac ggtgaccacc 180
acatcggtca agtcgacaac gactgcgcca accaagacga cgacaaccac ctcgggtccg 240
atatcaacct ccaccggctt cgctcacacc aacggtctca acttcaccat cgatggcgag 300
acgagctact ttgccggatc caactcgtac tggattggct tcctgaccaa caatgccgac 360
gtcgacttgg tcatgcaaca cctgagctcc tcggggctgc gcattctgcg cgtctgggga 420
ttcaacgatg tcaacacgat cccctccgcc ggcaccgtct ggttccagca tcttgcgggc 480
ggcagcgcca ccatcaacac cggtgccgat ggcctgcagc gtcttgatta tgtcgtctcc 540
tcggccgaga aacacggcat caagctcatc atcaactttg tgaacaattg gtccgattac 600
ggtggtatta acgcgtacgt caacgctttt ggcggcagtg cgaccacctg gtacaccaac 660
accgcggcgc agaccgccta caaaaactac atcaaggctg tggtttcgcg gtacatctca 720
tctccggccg tctttgcgtg ggagttggcc aatgagcctc gctgcaaggg ctgcgacacc 780
tccgtcatct atgactgggt caaggcgact agccaatata tcaaatcact cgacccgaag 840
cacatggtca ccattggcga tgagggattc ggcctgacga ccgagtctga cggaagctac 900
cccttcagct tctccgaggg actggacttt tccaagaacc taggcatcag taccattgac 960
tttggaactt tccatctgta cccatcgagc tggggcacaa gcagtgactg gggcaatctc 1020
tgggtcaaag cccacgggga cgcctgtgct gcggcgggta agccctgctt gtttgaggag 1080
tatggctacc cttccgacca ctgcaccatc gaggcggcct ggcagaagac ggcccttaac 1140
accaagggtg tcgctgctga tctgtactgg cagtacggag ataccctgag ttacggtcaa 1200
acttcagacg atggatacac gatttactac ggatccagtg actttacctg cctggtgacg 1260
aatcatgtcg ctgcgatctg a 1281
<210> 5
<211> 426
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Gln Val Ala Glu Tyr Gly Gln Cys Gly Gly Lys Gly Trp Ser Gly Ser
1 5 10 15
Thr Thr Cys Gln Ser Pro Tyr Thr Cys Gln Tyr Gln Asn Asp Trp Tyr
20 25 30
Ser Gln Cys Leu Pro Gly Thr Gly Ser Gly Gly Ala Thr Thr Thr Thr
35 40 45
Thr Thr Thr Thr Thr Ala Lys Thr Thr Val Thr Thr Thr Ser Val Lys
50 55 60
Ser Thr Thr Thr Ala Pro Thr Lys Thr Thr Thr Thr Thr Ser Gly Pro
65 70 75 80
Ile Ser Thr Ser Thr Gly Phe Ala His Thr Asn Gly Leu Asn Phe Thr
85 90 95
Ile Asp Gly Glu Thr Ser Tyr Phe Ala Gly Ser Asn Ser Tyr Trp Ile
100 105 110
Gly Phe Leu Thr Asn Asn Ala Asp Val Asp Leu Val Met Gln His Leu
115 120 125
Ser Ser Ser Gly Leu Arg Ile Leu Arg Val Trp Gly Phe Asn Asp Val
130 135 140
Asn Thr Ile Pro Ser Ala Gly Thr Val Trp Phe Gln His Leu Ala Gly
145 150 155 160
Gly Ser Ala Thr Ile Asn Thr Gly Ala Asp Gly Leu Gln Arg Leu Asp
165 170 175
Tyr Val Val Ser Ser Ala Glu Lys His Gly Ile Lys Leu Ile Ile Asn
180 185 190
Phe Val Asn Asn Trp Ser Asp Tyr Gly Gly Ile Asn Ala Tyr Val Asn
195 200 205
Ala Phe Gly Gly Ser Ala Thr Thr Trp Tyr Thr Asn Thr Ala Ala Gln
210 215 220
Thr Ala Tyr Lys Asn Tyr Ile Lys Ala Val Val Ser Arg Tyr Ile Ser
225 230 235 240
Ser Pro Ala Val Phe Ala Trp Glu Leu Ala Asn Glu Pro Arg Cys Lys
245 250 255
Gly Cys Asp Thr Ser Val Ile Tyr Asp Trp Val Lys Ala Thr Ser Gln
260 265 270
Tyr Ile Lys Ser Leu Asp Pro Lys His Met Val Thr Ile Gly Asp Glu
275 280 285
Gly Phe Gly Leu Thr Thr Glu Ser Asp Gly Ser Tyr Pro Phe Ser Phe
290 295 300
Ser Glu Gly Leu Asp Phe Ser Lys Asn Leu Gly Ile Ser Thr Ile Asp
305 310 315 320
Phe Gly Thr Phe His Leu Tyr Pro Ser Ser Trp Gly Thr Ser Ser Asp
325 330 335
Trp Gly Asn Leu Trp Val Lys Ala His Gly Asp Ala Cys Ala Ala Ala
340 345 350
Gly Lys Pro Cys Leu Phe Glu Glu Tyr Gly Tyr Pro Ser Asp His Cys
355 360 365
Thr Ile Glu Ala Ala Trp Gln Lys Thr Ala Leu Asn Thr Lys Gly Val
370 375 380
Ala Ala Asp Leu Tyr Trp Gln Tyr Gly Asp Thr Leu Ser Tyr Gly Gln
385 390 395 400
Thr Ser Asp Asp Gly Tyr Thr Ile Tyr Tyr Gly Ser Ser Asp Phe Thr
405 410 415
Cys Leu Val Thr Asn His Val Ala Ala Ile
420 425
Claims (6)
1. The promoter is characterized in that the nucleotide sequence of the promoter is SEQ ID NO. 1.
2. An expression vector comprising the promoter of claim 1.
3. A foreign protein expression system comprises a host and an expression vector, and is characterized in that the host is Pichia pastoris, and the expression vector is the expression vector according to claim 2.
4. A method of expressing a foreign protein comprising the steps of:
1) cloning a foreign gene;
2) constructing a recombinant expression vector carrying the foreign gene of step 1) by using the expression vector of claim 2;
3) and transforming the recombinant expression vector into pichia pastoris to obtain a recombinant strain for recombinant expression of the foreign protein.
5. The method of claim 4, wherein the exogenous protein is selected from the group consisting of hemicellulase, peroxidase, protease, cellulase, lipase, esterase, cutinase, pectinase, reductase, oxidase, lipoxygenase, ligninase, tannase, pentosanase, malic enzyme, arabinosidase, hyaluronidase, chondroitinase, laccase, and amylase.
6. The method of claim 5, wherein the exogenous protein is selected from the group consisting of acetyl esterase, aminopeptidase, arabinase, arabinofuranosidase, carboxypeptidase, catalase, chitinase, chymosin, cutinase, deoxyribonuclease, epimerase, alpha-galactosidase, beta-galactosidase, alpha-glucanase, glucan lyase, endo-beta-glucanase, glucoamylase, glucose oxidase, alpha-glucosidase, beta-glucosidase, glucuronidase, hexose oxidase, laccase, lipase, mannosidase, oxidoreductase, pectate lyase, pectin acetylesterase, pectin depolymerase, pectin methylesterase, pectin lyase, phenol oxidase, phytase, polygalacturonase, rhamnogalacturonase, arabinogalacturonase, and the like, Any one or more of ribonuclease, transglutaminase and xylanase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910205929.0A CN109735547B (en) | 2019-03-19 | 2019-03-19 | Promoter for improving pichia pastoris exogenous protein expression quantity and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910205929.0A CN109735547B (en) | 2019-03-19 | 2019-03-19 | Promoter for improving pichia pastoris exogenous protein expression quantity and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109735547A CN109735547A (en) | 2019-05-10 |
| CN109735547B true CN109735547B (en) | 2022-05-31 |
Family
ID=66370803
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910205929.0A Active CN109735547B (en) | 2019-03-19 | 2019-03-19 | Promoter for improving pichia pastoris exogenous protein expression quantity and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109735547B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110029122B (en) * | 2019-03-19 | 2022-03-01 | 青岛蔚蓝生物集团有限公司 | Mannase high-yield strain and application thereof |
| CN110029120B (en) * | 2019-03-19 | 2022-03-01 | 青岛蔚蓝生物集团有限公司 | Phytase high-yield strain and application thereof |
| CN111484989A (en) * | 2020-04-29 | 2020-08-04 | 中国农业大学 | Preparation method of β -mannase and application of β -mannase in preparation of partially hydrolyzed mannan |
| CN113667613A (en) * | 2021-06-24 | 2021-11-19 | 浙江新银象生物工程有限公司 | Recombinant pichia pastoris engineering bacteria and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101935657A (en) * | 2005-02-23 | 2011-01-05 | 格拉茨科技大学 | Mutant AOX 1 promoters |
| CN103789340A (en) * | 2014-01-21 | 2014-05-14 | 中国科学技术大学 | Method for efficiently preparing recombinant human MICA (major histocompatibility complex class I chain related protein A) |
| CN104152484A (en) * | 2014-08-13 | 2014-11-19 | 青岛蔚蓝生物集团有限公司 | Method for improving expression amount of secretory foreign protein in pichia pastoris |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6695426B2 (en) * | 2015-11-13 | 2020-05-20 | バクスアルタ インコーポレイテッド | Highly Expressing Viral Vector for Hemophilia A Gene Therapy Encoding a Recombinant FVIII Variant |
-
2019
- 2019-03-19 CN CN201910205929.0A patent/CN109735547B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101935657A (en) * | 2005-02-23 | 2011-01-05 | 格拉茨科技大学 | Mutant AOX 1 promoters |
| CN103789340A (en) * | 2014-01-21 | 2014-05-14 | 中国科学技术大学 | Method for efficiently preparing recombinant human MICA (major histocompatibility complex class I chain related protein A) |
| CN104152484A (en) * | 2014-08-13 | 2014-11-19 | 青岛蔚蓝生物集团有限公司 | Method for improving expression amount of secretory foreign protein in pichia pastoris |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109735547A (en) | 2019-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109735547B (en) | Promoter for improving pichia pastoris exogenous protein expression quantity and application thereof | |
| Nakari-Set� l� et al. | Production of Trichoderma reesei cellulases on glucose-containing media | |
| Berrin et al. | High-level production of recombinant fungal endo-β-1, 4-xylanase in the methylotrophic yeast Pichia pastoris | |
| CN107760700B (en) | Beta-mannase gene, recombinant expression vector, strain, beta-mannase and preparation method and application thereof | |
| JP2019528797A5 (en) | ||
| CN110029120B (en) | Phytase high-yield strain and application thereof | |
| CN111378585A (en) | Pichia mutant strain for expressing exogenous gene | |
| Ohta et al. | Purification and characterization of an acidophilic xylanase from Aureobasidium pullulans var. melanigenum and sequence analysis of the encoding gene | |
| NZ259372A (en) | Cloning and expression of xylanase-b | |
| KR100919704B1 (en) | An Effective Method for Expressing and Secreting Recombinant Proteins in Yeast | |
| CN116888142A (en) | Recombinant yeast host cells with increased growth rates | |
| CN110029122B (en) | Mannase high-yield strain and application thereof | |
| Mustafa et al. | Molecular cloning and comparative sequence analysis of fungal β-Xylosidases | |
| JP2002536993A5 (en) | ||
| WO2018009806A1 (en) | Methods of producing a fermentation product in trichoderma | |
| Celińska et al. | Evaluation of heterologous α‐amylase production in two expression platforms dedicated for Yarrowia lipolytica: commercial Po1g–pYLSC (php4d) and custom‐made A18–pYLTEF (pTEF) | |
| Kimura et al. | Molecular cloning of xylanase gene xynG1 from Aspergillus oryzae KBN 616, a shoyu koji mold, and analysis of its expression | |
| CN114107360B (en) | Method for improving cellulase expression of trichoderma reesei by interfering phosphatase gene | |
| CN113801801B (en) | Recombinant strain for efficiently producing alkaline pectinase and application thereof | |
| EP0208706A1 (en) | Dna sequence useful for the production and secretion from yeast of peptides and proteins | |
| Matsuo et al. | Cloning and overexpression of β-N-acetylglucosaminidase encoding gene nagA from Aspergillus oryzae and enzyme-catalyzed synthesis of human milk oligosaccharide | |
| Al Balaa et al. | Identification, cloning, and expression of the Scytalidium acidophilum XYL1 gene encoding for an acidophilic xylanase | |
| Qiao et al. | Codon optimization, expression and characterization of Bacillus subtilis MA139 β-1, 3-1, 4-glucanase in Pichia pastoris | |
| Guo et al. | A food-grade industrial arming yeast expressing β-1, 3-1, 4-glucanase with enhanced thermal stability | |
| WO1995017513A1 (en) | Retransformation of filamentous fungi |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |