CN104561082A - Expression system of yeast namely Candida jeffriesii capable of using xylose - Google Patents

Abstract

The invention relates to an expression system of a yeast namely Candida jeffriesii capable of using xylose. The expression system comprises an expression vector, wherein the following elements are operationally connected from 5'-3' in sequence: a pMD19-Tsimple plasmid skeleton, a rDNA homologous recombination sequence, an exogenous gene expression box and a screening marker gene expression box; the exogenous gene expression box sequentially comprises a promoter, an exogenous gene insertion restriction enzyme cutting site and a transcription terminator from upstream to downstream; and the screening marker gene expression box comprises a promoter, an antibiotic resistance gene and a transcription terminator. The expression vector provided by the invention can be integrally and stably expressed in Candida jeffriesii, and the expression system is of great significance for basic theory researches and product development of the yeast namely Candida jeffriesii capable of using xylose.

Description

One strain can utilize the expression system of the yeast Candida jeffriesii of wood sugar

Technical field

The present invention relates to gene engineering technology field, especially relate to a kind of can utilize the yeast Candida jeffriesii of wood sugar expression system and construction process and application.

Background technology

On the basis of the discipline developments such as molecular biology, genetics, biological chemistry, microbiology, there is genetic engineering technique in 20 century 70s.Nucleic acid molecule is inserted plasmid or other carrier molecules by external by this technology, forms the Combination nova of genetic material, and after importing host cell, obtains stable amplification under new genetic background and express.The expression of functional gene to its coded protein structure and fuction of research and practical application very important, it can be placed in different expression system and express.At present, constructed the multiple expression system for gene functional research, protein expression etc., comprised escherichia expression system, yeast expression system, mammalian cell expression system etc.And destination gene expression success can be made, depend on the selection of suitable expression system.Yeast is a kind of unicellular eukaryote of low grade, and it had both had, and prokaryotic organism are easy to cultivate, breeding is fast, be convenient to the features such as genetically engineered operation, has again the functions such as eukaryotic protein processing, folding, posttranslational modification simultaneously.Therefore, yeast has now become modern molecular biology and has studied most important instrument and model, is particularly suitable for expressing eukaryotic gene and preparing the protein having function.

Lignocellulose is one of renewable resources the abundantest on the earth, the multiple biobased products such as clean fuel ethanol, butanols, bulk chemical lactic acid, high value added product Xylitol, organic acid and microbial bacteria body protein can be converted into, even can be used for the multiple industrial enzymes such as production of cellulose enzyme.It effectively utilizes can solve the resource shortage problem run in social development process, thus gets more and more people's extensive concerning.Wood sugar is a kind of monose that in ligno-cellulose hydrolysate, content is only second to glucose, and its high-level efficiency bio-transformation is one of key factor affecting lignocellulose industry development with utilizing.

At present, found that multiple yeast can utilize even xylose-fermenting, wherein studying more has pichia stipitis, shehatae candida, pachysolen tannophilus etc.Through years of researches, yeast utilizes the metabolic mechanism of wood sugar clear gradually, and corresponding genetic transformation system, also constantly perfect, makes the application of genetic engineering technique in such yeast based on the means such as genetic expression, gene knockout become possibility.Improving substrate as the transformation efficiency of wood sugar by building engineering bacteria on the one hand, increasing target metabolic Product yields; Another aspect can be that substrate produces important biomolecule base product as amino acid, enzyme etc. with cellulose raw material by building engineering bacteria.

Candida jeffriesii is the new yeast that can utilize wood sugar be separated, Phylogenetic Analysis shows that this yeast and another strain the yeast Spathaspora passalidarum of efficiency utilization wood sugar can be mutually sister group (NGUYEN N H, SUH S O, MARSHALL C J, et al.Morphological and ecological similarities:wood-boring beetles associated with novel xylose-fermenting yeasts, Spathaspora passalidarum gen.sp.nov.and Candida jeffriesii sp.nov.Mycol Res, 2006, 110 (Pt 10): 1232-1241).Research on current Candida jeffriesii gene level is still in the starting stage, is badly in need of a genetic expression systems applicatory and carries out more deep research.Multiplely yeast saccharomyces cerevisiae is applied to although have on the market, the expression vector of the expression systems such as pichia spp, but this yeast belongs to and utilizes wood sugars yeast, use special genes encoding system, codon CUG encoding serine but not leucine (Wohlbach DJ, Kuo A, Sato TK, Potts KM, Salamov AA, Labutti KM, Sun H, Clum A, Pangilinan JL, Lindquist EA, Lucas S, Lapidus A, Jin M, Gunawan C, Balan V, Dale BE, Jeffries TW, Zinkel R, Barry KW, Grigoriev IV, Gasch AP.Comparative genomics of xylose-fermenting fungi for enhanced biofuel production.Proceedings of the National Academy of Sciences of the United States of America, 2011, 108 (32): 13212-13217.), therefore above-mentioned conventional expression vector is difficult to be applicable in this yeast expression system by modifying.

Therefore, be necessary to build the gene expression system being applicable to Candida jeffriesii self, on this basis, this gene expression system can be adopted to carry out genetic engineering modified to Candida jeffriesii or on this expression system basis, excavate the excellent genes information of Candida jeffriesii, for building saccharomyces neoformans genetic engineering bacterium and the novel excellent genes of screening, as cellobiase genes etc., lay the foundation, make Candida jeffriesii utilize xylose to produce mankind's useful products by genetic engineering means simultaneously, the biological processing technique setting up renewable resources recycle becomes possibility.

Summary of the invention

For the problems referred to above that prior art exists, the applicant provides the expression system that a strain can utilize the yeast Candida jeffriesii of wood sugar.Expression vector of the present invention can realize the integrated stably express in Candida jeffriesii, has great importance to the fundamental research of xylose utilization yeast Candida jeffriesii and product development.

Technical scheme of the present invention is as follows:

One aspect of the present invention relates to the expression system that a strain can utilize the yeast Candida jeffriesii of wood sugar, and comprise a kind of new expression vector, it is ring-type, from 5 '-3 ' be connected with following element operably successively:

PMD19-Tsimple plasmid backbone, rDNA homologous recombination sequence, exogenous gene expression box and riddled basins expression cassette;

Described exogenous gene expression box comprises promotor successively to downstream from upstream, foreign gene inserts restriction enzyme site and transcription terminator;

Described riddled basins expression cassette comprises promotor, antibiotics resistance gene, transcription terminator.

The described yeast of wood sugar that can utilize is for Candida jeffriesii.

Exogenous gene expression box promoter in described expression vector and the DNA sequence dna of transcription terminator are from yeast Spathaspora passalidarum, this whole genome sequence is numbered NZ_AEIK00000000 in NCBI (http://www.ncbi.nlm.nih.gov/), and wherein said yeast can be the cell strain NRRL Y-27907 from american agriculture research DSMZ.

Preferably, described rDNA homologous recombination sequence is 18s rDNA, and sequence is as shown in SEQ ID NO:1.Another selection is that the similarity of described rDNA sequence and SEQ ID NO:1 is not less than 90%, and be preferably 95%, more excellent is 98%.

Promotor in described exogenous gene expression box comprises SpADH _p, SpXYL _p; Transcription terminator comprises SpCYC1 _t, SpXYL _t.

Promotor in described riddled basins expression cassette comprises SpTEF1 _p; Antibiotics resistance gene can be conventional in expression vector, comprises hygromycin gene, blasticidin resistance gene, G418; Transcription terminator comprises SpCYC1 _t, ScCYC1 _t.

Described SpADH _ppromotor is the alcohol dehydrogenase gene ADH1 promotor that Spathaspora passalidarum originates, and the DNA sequence dna of this promotor is as shown in SEQ ID NO:2;

Described SpXYL _ppromotor is the Xylose reductase gene XYL promotor that Spathaspora passalidarum originates, and the DNA sequence dna of this promotor is as shown in SEQ ID NO:3;

Described SpTEF1 _ppromotor is the transcription initiation factor gene TEF1 promotor that Spathaspora passalidarum originates, and the DNA sequence dna of this promotor is as shown in SEQ ID NO:4;

Described SpCYC1 _tterminator is the cytochrome C gene CYC1 terminator that Spathaspora passalidarum originates, and the DNA sequence dna of this terminator is as shown in SEQ ID NO:5;

Described SpXYL _tterminator is the Xylose reductase gene XYL terminator that Spathaspora passalidarum originates, and the DNA sequence dna of this terminator is as shown in SEQ ID NO:6.

Described ScCYC1 _tterminator is the cytochrome C gene CYC1 terminator that Saccharomyces cerevisiae originates, and the DNA sequence dna of this terminator is as shown in SEQ ID NO:7.

The DNA fragmentation of described foreign gene can comprise described foreign gene and riddled basins, and described foreign gene to insert in described exogenous gene expression box between promotor and transcription terminator.In one embodiment of the invention, described foreign gene is gfp gene, and the DNA sequence dna of this gene is as shown in SEQ ID NO:11.

Can comprise more than one marker gene in described riddled basins expression cassette, described marker gene can be hygromycin B resistant gene, blasticidin resistance gene and/or G418; In one embodiment of the invention, described marker gene is hygromycin B resistant gene.

The DNA sequence dna of described hygromycin B resistant gene is as shown in SEQ ID NO:8.

The DNA sequence dna of described blasticidin resistance gene is as shown in SEQ ID NO:9.

The DNA sequence dna of described G418 is as shown in SEQ ID NO:10.

Yeast used in the present invention is the yeast Candida jeffriesii that a strain can utilize wood sugar.Concrete, this yeast purchased from American farming research DSMZ, deposit number is NRRL Y-27738.

Specifically, contriver has prepared new expression vector according to following technical proposals:

With Spathaspora passalidarum genomic dna for template, carry out pcr amplification with primer P1 and P2 and obtain 18s rDNA homologous recombination sequence; Carry out pcr amplification with primer P23 and P24 and obtain SpTEF1 _ppromotor; Carry out pcr amplification with primer P25 and P26 and obtain SpADH1 _ppromotor; Carry out pcr amplification with primer P27 and P28 and obtain SpXYL _ppromotor; Carry out pcr amplification with primer P29 and P30 and obtain SpCYC1 _tterminator; Carry out pcr amplification with primer P31 and P32 and obtain SpXYL _tterminator.With PMD-hph _mplasmid DNA is template, carries out pcr amplification obtain fragment hph with primer P21 and P22 _m-ScCYC1 _t.The nucleotide sequence of described primer P1-P2 is as shown in SEQ ID NO.13-14, and the nucleotide sequence of described P21-P32 is as shown in SEQ ID NO.33-44.

Take pMD19-Tsimple as skeleton, above-mentioned each fragment connected, described connection carries out on suitable restriction enzyme restriction enzyme site.Concrete mode of connection is: after the EcoR V restriction enzyme site of pMD19-Tsimple connects 18s rDNA, the direction along 18s rDNA connects exogenous gene expression box promoter, exogenous gene expression box transcription terminator, SpTEF1 successively _ppromotor, hph _m-ScCYC1 _t.

Yeast gene expression regulation and control are very complicated processes, select suitable promotor and the expression of transcription terminator to foreign protein most important.The invention provides and for the promotor of exogenous protein expression and Transcription Termination sub-portfolio, SpADH can be comprised _p-SpCYC1 _t, SpXYL _p-SpCYC1 _t, SpADH _p-SpXYL _t, SpXYL _p-SpXYL _t, SpTEF1 _p-SpCYC1 _t, SpXYL _p-SpXYL _t.

Described promotor obtains according to following methods prediction:

(1) according to Spathaspora passalidarum genome sequence, all nucleotide fragments between gene and the open reading frame of a upper gene belonging to promotor conventional in yeast expression system are selected;

(2) adopt the online test and evaluation software of promotor, on-line prediction is carried out to possible promoter sequence;

(3) according to the potential promoter sequence of high score value, design primer amplification obtains promoter sequence to be measured.

Described terminator obtains according to following methods:

(1) according to Spathaspora passalidarum genome sequence, after selecting the open reading frame of gene belonging to terminator conventional in yeast expression system, about 300bp is as terminator sequence to be measured.

(2) design primer amplification and obtain described terminator to be measured.

The promotor of described exogenous protein expression and Transcription Termination sub-portfolio are used for the functional expression of foreign gene.In an embodiment, between the gfp gene promotor of inserting described exogenous protein expression and transcription terminator.

Described expression vector is integrated in the genome of described Candida jeffriesii Host Strains.

Described Candida jeffriesii Host Strains is (but being not limited to) cell strain NRRL Y-27738 from american agriculture research DSMZ.

In one embodiment of the invention, described Candida jeffriesii Host Strains is the Candida jeffriesii NRRL Y-27738 from american agriculture research DSMZ.

Another aspect of the present invention, provides a kind of construction process of Candida jeffriesii gene expression system, comprises the following steps:

The expression vector establishment of described Candida jeffriesii gene expression system:

According to yeast Spathaspora passalidarum whole genome sequence, transfer Spathaspora passalidarum 18s rDNA partial sequence as homologous recombination site.With Spathaspora passalidarum genomic dna for template, carry out pcr amplification with primer P1 and P2 and obtain 18s rDNA homologous recombination sequence, introduce restriction enzyme site EcoR I in fragment upstream, restriction enzyme site Bgl II, BamH I and Kpn I are introduced in downstream simultaneously.By PCR primer purifying rear clone to plasmid pMD19-Tsimple, obtain recombinant plasmid pMD-18srDNA.

With PMD-hph _mplasmid DNA is template, carries out pcr amplification obtain fragment hph with primer P21 and P22 _m-ScCYC1 _t, introduce BamH I, Pst I in fragment upstream, Kpn I is introduced in downstream simultaneously.The PCR primer of purifying and recombinant plasmid pMD-18s rDNA are used BamH I and Kpn I double digestion respectively, and digestion products connects acquisition recombinant plasmid PR-hph _m.

With Spathaspora passalidarum genomic dna for template, carry out PCR amplification with primer P23 and P24 and obtain SpTEF1 _ppromotor, introduces restriction enzyme site BamH I and Pst I at fragment two ends simultaneously.By the PCR primer of purifying and recombinant plasmid PR-hph _muse BamH I and Pst I double digestion respectively, digestion products connects acquisition recombinant plasmid PRTH.

With Spathaspora passalidarum genomic dna for template, carry out pcr amplification with primer P25 and P26 and obtain SpADH _ppromotor; Carry out pcr amplification with primer P27 and P28 and obtain SpXYL _ppromotor; Introduce restriction enzyme site Bgl II in the upstream of fragment, restriction enzyme site Sal I and BamH I is introduced in downstream simultaneously.The PCR primer of purifying and recombinant plasmid PRTH are used respectively Bgl II and Sal I double digestion, the recombinant plasmid cut by enzyme is connected acquisition recombinant plasmid PRATH and PRXTH with PCR primer.

With Spathaspora passalidarum genomic dna for template, carry out pcr amplification with primer P29 and P30 and obtain SpCYC1 _tterminator; Carry out pcr amplification with primer P31 and P32 and obtain SpXYL _tterminator.Introduce restriction enzyme site Sal I and Not I in fragment upstream, introduce restriction enzyme site BamH I in fragment downstream.The PCR primer of purifying and recombinant plasmid PRATH and PRXTH are used respectively Sal I and BamH I double digestion, digestion products connects acquisition PR series recombinant plasmid PRACTH, PRAXTH, PRXCTH and PRXXTH.

The nucleotide sequence of described primer P1-P2 is as shown in SEQ ID NO.13-14.

The nucleotide sequence of described P21-P32 is as shown in SEQ ID NO.33-44.

The activation of Host Strains Candida jeffriesii and cultivation.

The genetic transformation of PR series recombinant plasmid in Host Strains Candida jeffriesii.

Host Strains Candida jeffriesii positive transformant screens.

The construction process of described Candida jeffriesii gene expression system, wherein, described expression vector is recombinant plasmid PRACTH, and wherein the promotor of exogenous gene expression box and terminator are respectively SpADH _pand SpCYC1 _t.

The construction process of described Candida jeffriesii gene expression system, wherein, described expression vector is recombinant plasmid PRAXTH, and wherein the promotor of exogenous gene expression box and terminator are respectively SpADH _pand SpXYL _t.

The construction process of described Candida jeffriesii gene expression system, wherein, described expression vector is recombinant plasmid PRXCTH, and wherein the promotor of exogenous gene expression box and terminator are respectively SpXYL _pand SpCYC1 _t.

The construction process of described Candida jeffriesii gene expression system, wherein, described expression vector is recombinant plasmid PRXXTH, and wherein the promotor of exogenous gene expression box and terminator are respectively SpXYL _pand SpXYL _t.

The construction process of described Candida jeffriesii gene expression system, wherein said genetic transforming method comprises PEG-LiAC conversion method, electrotransformation and protoplast transformation, and preferred method for transformation is PEG-LiAC conversion method.

The construction process of described Candida jeffriesii gene expression system, wherein, described Host Strains Candida jeffriesii transformant screening method is resistant panel screening, bacterium colony PCR or Genomic PCR detection are carried out to the transformant through preliminary screening, and eventually through detecting the method determination transformant of foreign protein activity or meta-bolites.

The invention provides a kind of method of expression alien gene, comprise the steps:

(1) described integrated Candida jeffriesii gene expression system is provided;

(2) foreign gene foreign gene being inserted described expression vector inserts restriction enzyme site, obtains recombinant expression vector;

(3) described recombinant expression vector transformed Host Strains Candida jeffriesii and in Host Strains, express described foreign gene.

Present invention also offers a kind of method of metabolic engineering Host Strains Candida jeffriesii, comprise the steps:

(1) integrated Candida jeffriesii expression system according to claim 1 is provided;

(2) foreign gene target gene being inserted described expression vector inserts restriction enzyme site, obtains recombinant expression vector;

(3) described recombinant expression vector transformed Host Strains Candida jeffriesii and in Host Strains, express described target gene;

(4) cultivate described recombinant bacterium, detect described recombinant bacterium meta-bolites.

Other aspects of invention, due to disclosure herein, are apparent to those skilled in the art.

The technique effect that the present invention is useful is:

1, yeast used in the present invention is the novel yeast utilizing wood sugar of a strain, has efficient xylose utilization ability and stronger ethanol production, has good prospects for commercial application and value.But this yeast belongs to and utilizes wood sugars candiyeast, and such yeast uses special genes encoding system, codon CUG encoding serine but not leucine, the expression vector being therefore applied to the expression system such as yeast saccharomyces cerevisiae, pichia spp on the market cannot be applicable to this xylose utilization yeast.Given this, the present inventor constructs the series of new expression vector being applicable to this yeast self, adopts this serial expression vector, can carry out expression and the metabolic engineering of foreign protein easily to this yeast.

2, the invention provides the method transforming Candida jeffriesii with other DNA moleculars, described DNA molecular can come to connect between comfortable above-mentioned Vector promoter and terminator in the library that Candida jeffriesii genomic fragment forms or the DNA molecular of synthesis.The present invention thus can provide, can be used in expressing gene diverse libraries, produces the technology therefrom can screening the product of new biologically active substance.

3, in integrated expression vector of the present invention, attempt adopting multiple rDNA sequence as integration site, but only there is one of them sequence table to reveal integration effect, this sequence is the partial sequence of 18s rDNA, and to show copy number high in this site, the feature of good stability, makes this serial integrated expression vector become and can be applicable to the integrated expression vector of yeast multi-copy that Candida jeffriesii expresses foreign protein and metabolic engineering.

4, in the new expression vector constructed by the present invention, rite-directed mutagenesis is carried out to multiple CUG codon in the resistant gene open reading frame such as used hygromycin B resistant gene, blasticidin resistance gene, sport UUG, rite-directed mutagenesis has been carried out to the CUG codon in reporter gene gfp open reading frame, sport UUG, thus achieve the effective conversion of this Novel series expression vector in yeast Candida jeffriesii and functional expression.

Accompanying drawing explanation

Fig. 1 be hph gene C DS sequence after the rite-directed mutagenesis of embodiment 1 ( represent rite-directed mutagenesis site);

Fig. 2 is gfp gene C DS sequence after the rite-directed mutagenesis of embodiment 4 represent rite-directed mutagenesis site);

Fig. 3 is the green fluorescent protein recombinant plasmid PRACTH-gfp of embodiment 4 _mplasmid map;

Fig. 4 be embodiment 4 for bacterium green fluorescent protein recombinant plasmid transformed daughter colony PCR proof diagram (M is Maker, and swimming lane 1-9 is positive transformant amplification, and swimming lane 10 is negative control);

Fig. 5 is the green fluorescent protein recombinant plasmid PRACTH-gfp of embodiment 4 _mtransform Candida jeffriesii and GFP fluorescent microscope detection (left figure is details in a play not acted out on stage, but told through dialogues, and right figure is light field).

Embodiment

Below in conjunction with embodiment, technical scheme of the present invention is described in detail.Should be understood that these embodiments are only for illustration of the present invention, and should not be considered as limiting the scope of the invention.Without departing from the spirit and substance of the case in the present invention, the amendment do the inventive method, step or condition or replacement, be all considered as falling into scope of the present invention.

The experimental technique of unreceipted actual conditions in the following example, the condition of substantially all advising according to conventional clone's handbook or manufacturers carries out experimental implementation; Agents useful for same or the unreceipted manufacturer person of instrument, being can by the conventional products of commercial acquisition.

Unless be separately construed as limiting in this article, whole term used herein has usual the understood identical meanings of the ordinary person in field belonging to the present invention.

In the present invention, term " is operably connected " and refers to functional spatial disposition of two or more nucleotide sequence.Such as: promoter sequence is placed in the specific position relative to goal gene nucleotide sequence, what make this goal gene transcribes the guiding being subject to this promotor, makes expression become feasible, thus promoter sequence is " operably connected " on this nucleotide sequence.Usually, term " is operably connected " and refers to that the DNA sequence dna be connected is adjacent, and the connection of described sequence is by carrying out connecting implementing on suitable restriction site.If described site does not exist, the oligonucleotide adaptor or joint that synthesize according to conventional methods can be used.

The structure of the integrated expression vector of embodiment 1:PR series

One, the structure of recombinant plasmid pMD-18s rDNA

(1) according to Spathaspora passalidarum whole genome sequence (GenBank accession NZ_AEIK00000000), design two primers and intercept Spathaspora passalidarum 18s rDNA partial sequence as homologous recombination site.Primer sequence is as follows: primer P1 underscore part is the recognition site of EcoR I, and primer P2 underscore part is respectively the recognition site of Bgl II, BamH I and Kpn I by 5 ' to 3 ' end.

P1：5’GCCG GAATTCTGCCAGTAGTCATATGCTTGTCTC3’

P2：5’ATATTAGG GGTACCCG GGATCCGA AGATCTGTTGAAGAGCAATAAT3’

(2) incubated overnight Spathaspora passalidarum, collecting cell, is separated, extracts genomic dna.

(3) with Spathaspora passalidarum genomic dna for template, carry out pcr amplification with primer P1 and P2.Amplification condition is 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 62 DEG C of annealing 30s, and 72 DEG C extend 1.5min, 30 circulations, and 72 DEG C extend 5min.Purifying reclaims pcr amplification product rear clone to pMD19-Tsimple carrier (purchased from Dalian TaKaRa company), obtains recombinant plasmid pMD-18s rDNA.

Two, recombinant plasmid PMD-hph _mstructure

(1) according to plasmid pRS303H (Taxis C, Knop M.System of centromeric, episomal, and integrative vectors based on drug resistance markers for Saccharomyces cerevisiae.BioTechniques, 2006,40 (1): 73-78.) hygromycin gene expression cassette primers P3 and P4 in.

P3：5’ACATTTTGATGGCCGCACGG3’

P4：5’AACTCCTTCCTTTTCGGTTAGAGCG 3’

(2) with pRS303H plasmid DNA for template, to increase hph expression cassette fragment with primer P3 and P4, amplification condition is 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, and 72 DEG C extend 1.5min, 30 circulations, 72 DEG C of extension 5min.After purifying reclaims above-mentioned fragment, be cloned into pMD19-Tsimple carrier, obtain recombinant plasmid PMD-hph.

(3) according to CUG codon situation design mutant primer in hygromycin gene CDS, in wherein said primer sequence, underscore part is mutational site.

P5：5’GAGAAGTTT TTGATCGAAAAGTTCGACAGC 3’

P6：5’GCTGTCGAACTTTTCGAT CAAAAACTTCTC 3’

P7：5’GACAGCGTCTCCGAC TTGATGCAGCTCTCG 3’

P8：5’CGAGAGCTGCAT CAAGTCGGAGACGCTGTC 3’

P9：5’GGGCGTGGATATGTC TTGCGGGTAAATAG 3’

P10：5’CTATTTACCCG CAAGACATATCCACGCCC 3’

P11：5’AATTCAGCGAGAGC TTGACCTATTGCATCT 3’

P12：5’AGATGCAATAGGT CAAGCTCTCGCTGAATT 3’

P13：5’TTGCAAGAC TTGCCTGAAACCGAA TTGCCCGCTGTT 3’

P14：5’AACAGCGGG CAATTCGGTTTCAGG CAAGTCTTGCAA 3’

P15：5’AATTGCCCGCTGTT TTGCAGCCGGT 3’

P16：5’ACCGGCTG CAAAACAGCGGGCAATT 3’

P17：5’AGGCTCTCGATGAG TTGATGCTTTGGGCCGAG 3’

P18：5’CTCGGCCCAAAGCAT CAACTCATCGAGAGCCT 3’

P19：5’GCTCCAACAATGTC TTGACGGACAATGG 3’

P20：5’CCATTGTCCGT CAAGACATTGTTGGAGC 3’

With plasmid PMD-hph for template, adopt Stratagene site-directed mutagenesis kit (purchased from Anjelen Sci. & Tech. Inc), carry out pcr amplification with above-mentioned primer, obtain ring-type PCR primer.Amplification condition is: 95 DEG C of denaturation 2min, 95 DEG C of sex change 30s, and 55 DEG C of annealing 2min, 68 DEG C extend 3.5min, and 30 circulations, 68 DEG C fully extend 5min.

(4) 30mins are digested with restriction endonuclease Dpn I in 37 DEG C by after above-mentioned PCR primer purifying, in 65 DEG C of reaction 15min with inactivation restriction endonuclease Dpn I.After digestion products purifying, Transformed E .coli JM109 competent cell (purchased from Beijing Quan Shi King Company), coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, deliver to Sangon Biotech (Shanghai) Co., Ltd. after extracting plasmid to check order, select the plasmid that mutational site is correct.After said mutation operation, mutant plasmid called after PMD-hph _m, wherein the CDS sequence of the rear hph of sudden change as shown in Figure 1.

Three, recombinant plasmid PR-hph _mstructure

(1) according to PMD-hph _mhygromycin gene expression cassette sequence in plasmid, designs two primers: primer P21 underscore part is respectively the recognition site of BamH I and Pst I by 5 ' to 3 ' end, and primer P22 underscore part is the recognition site of Kpn I.

P21：5’CG GGATCCAAA CTGCAGATGGGTAAAAAGCCTGAACTCAC3’

P22：5’GG GGTACCAACTCCTTCCTTTTCGGTTAGAGCG3’

(2) with PMD-hph _mplasmid DNA is template, carries out pcr amplification with primer P21 and P22, obtains PCR primer.Amplification condition is 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 63 DEG C of annealing 30s, and 72 DEG C extend 1.5min, 30 circulations, and 72 DEG C extend 5min.

(3) PCR primer of purifying and recombinant plasmid pMD-18s rDNA are used BamH I and Kpn I double digestion respectively, by connection of spending the night after digestion products respectively purifying, Transformed E .coli JM109 competent cell, coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, after extracting plasmid, BamH I and Kpn I double digestion are verified, obtain recombinant plasmid PR-hph _m.

Four, the structure of recombinant plasmid PRTH

(1) according to the sequence information that Spathaspora passalidarum whole genome sequence (GenBank accession NZ_AEIK00000000) and online database EMBL-EBI (http://www.ebi.ac.uk/) provide, all dna sequences between Spathaspora passalidarum transcription initiation factor and a upper gene open reading frame is obtained.According to promotor software (http://www.softberrv.com and http://www.cbs.dtu.dk/services/), on-line prediction is carried out to above-mentioned sequence, design two primers according to selected sequence restriction enzyme site situation afterwards, transfer Spathaspora passalidarum transcription initiation factor upstream about 700bp as promotor SpTEF1 _p: primer P23 underscore part is the recognition site of BamH I, and primer P24 underscore part is the recognition site of Pst I.

P23：5’CG GGATCCACCACTTACATAATAGAAAGAC 3’

P24：5’ACGAGC CTGCAGTTTTGATTGATTGATTG 3’

(2) with Spathaspora passalidarum genomic dna for template, carry out pcr amplification with primer P23 and P24, obtain PCR primer.Amplification condition is 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, and 72 DEG C extend 50s, 30 circulations, and 72 DEG C extend 5min.

(3) by the PCR primer of purifying and recombinant plasmid PR-hph _muse BamH I and Pst I double digestion respectively, by connection of spending the night after digestion products respectively purifying, Transformed E .coli JM109 competent cell, coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, after extracting plasmid, BamH I and Pst I double digestion are verified, obtain recombinant plasmid PRTH.

Five, the structure of recombinant plasmid PRATH and PRXTH

(1) according to the sequence information that Spathaspora passalidarum whole genome sequence (GenBank accession NZ_AEIK00000000) and online database EMBL-EBI (http://www.ebi.ac.uk/) provide, Spathaspora passalidarum ethanol dehydrogenase and all dna sequences of Xylose reductase respectively and between a upper gene open reading frame is obtained.According to promotor software (http://www.softberrv.com and http://www.cbs.dtu.dk/services/), on-line prediction is carried out to above-mentioned sequence, afterwards according to selected sequence restriction enzyme site situation design primer, transfer Spathaspora passalidarum ethanol dehydrogenase and Xylose reductase open reading frame upstream about 1000bp as promotor, i.e. SpADH _pand SpXYL _p: primer P25 and P27 underscore part are the recognition site of Bgl II, and primer P26 and P28 underscore part are respectively the recognition site of BamH I and Sal I by 5 ' to 3 ' end.

P25：5’GCCGGA AGATCTGTAAATTAATGCTACATCAGTTGAGG 3’

P26：5’CG GGATCCACGC GTCGACTATATTTTATTTAGGAATT 3’

P27：5’GCCGGA AGATCTGTGACATAGTTAACTATGGC 3’

P28：5’CG GGATCCACGC GTCGACTTTATTGTATTGTG 3’

(2) with Spathaspora passalidarum genomic dna for template, carry out pcr amplification with primer P25 and P26, obtain fragment SpADH _p.Amplification condition is 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, and 72 DEG C extend 1min, 30 circulations, and 72 DEG C extend 5min.

(3) with Spathaspora passalidarum genomic dna for template, carry out pcr amplification with primer P27 and P28, obtain fragment SpXYL _p.Amplification condition is 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 59 DEG C of annealing 30s, and 72 DEG C extend 1min, 30 circulations, and 72 DEG C extend 5min.

(4) by the fragment SpADH of purifying _pbgl II and BamH I double digestion is used respectively with recombinant plasmid PRTH, by connection of spending the night after digestion products respectively purifying, Transformed E .coli JM109 competent cell, coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, after extracting plasmid, Bgl II and BamH I double digestion are verified, the i.e. forward showing about 1000bp band after gel electrophoresis connects, and obtains recombinant plasmid PRATH.

(5) by the fragment SpXYL of purifying _pbgl II and BamH I double digestion is used respectively with recombinant plasmid PRTH, by connection of spending the night after digestion products respectively purifying, Transformed E .coli JM109 competent cell, coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, after extracting plasmid, Bgl II and BamH I double digestion are verified, the i.e. forward showing about 1000bp band after gel electrophoresis connects, and obtains recombinant plasmid PRXTH.

Six, the structure of the integrated expression vector of PR series

(1) according to the sequence information that Spathaspora passalidarum whole genome sequence (GenBank accession NZ_AEIK00000000) and online database EMBL-EBI (http://www.ebi.ac.uk/) provide, Spathaspora passalidarum cytochrome C1 and Xylose reductase open reading frame downstream sequence is obtained.Design primer transfers Spathaspora passalidarum cytochrome C1 and Xylose reductase open reading frame downstream about 300bp as transcription terminator, i.e. SpCYC1 _tand SpXYL _t: primer P29 and P31 underscore part are respectively the recognition site of Sal I and Not I by 5 ' to 3 ' end, and primer P30 and P32 underscore part are the recognition site of BamH I.

P29：5’ACGC GTCGACATAAGAAT GCGGCCGCGCTAACTTCAATTAGAAT3’

P30：5’CG GGATCCCATCACTATAAGCGAAATCGGGTTTC 3’

P31：5’ACGC GTCGACATAAGAAT GCGGCCGCGTTTGATTCTAGTTTATAT3’

P32：5’GCGC GGATCCATAGTTAACTATGTCACTTGAACTC 3’

(2) with Spathaspora passalidarum genomic dna for template, carry out pcr amplification with primer P29 and P30, obtain fragment SpCYC1 _t.Amplification condition is 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 63 DEG C of annealing 30s, and 72 DEG C extend 30s, 30 circulations, and 72 DEG C extend 5min.

(3) with Spathaspora passalidarum genomic dna for template, carry out pcr amplification with primer P31 and P32, obtain fragment SpXYL _t.Amplification condition is 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 61 DEG C of annealing 30s, and 72 DEG C extend 30s, 30 circulations, and 72 DEG C extend 5min.

(4) by the fragment SpCYC1 of purifying _tsal I and BamH I double digestion is used respectively with recombinant plasmid PRATH, by connection of spending the night after digestion products respectively purifying, Transformed E .coli JM109 competent cell, coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, after extracting plasmid, Sal I and BamH I double digestion are verified, obtain recombinant plasmid PRACTH.

(5) by the fragment SpCYC1 of purifying _tsal I and BamH I double digestion is used respectively with recombinant plasmid PRXTH, by connection of spending the night after digestion products respectively purifying, Transformed E .coli JM109 competent cell, coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, after extracting plasmid, Sal I and BamH I double digestion are verified, obtain recombinant plasmid PRXCTH.

(6) by the fragment SpXYL of purifying _tsal I and BamH I double digestion is used respectively with recombinant plasmid PRATH, by connection of spending the night after digestion products respectively purifying, Transformed E .coli JM109 competent cell, coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, after extracting plasmid, Sal I and BamH I double digestion are verified, obtain recombinant plasmid PRAXTH.

(7) by the fragment SpXYL of purifying _tsal I and BamH I double digestion is used respectively with recombinant plasmid PRXTH, by connection of spending the night after digestion products respectively purifying, Transformed E .coli JM109 competent cell, coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, after extracting plasmid, Sal I and BamH I double digestion are verified, obtain recombinant plasmid PRXXTH.

The foundation of the Candida jeffriesii method for transformation of embodiment 2:PEG/LiAc mediation.

Using Candida jeffriesii NRRL Y-27738 as Host Strains, the method for PEG/LiAc mediated transformation yeast is adopted to be implemented as follows:

One, the competent preparation of Candida jeffriesii NRRL Y-27738

(1) the Candida jeffriesii NRRL Y-27738 of cryopreservation tube preservation is inoculated in YPD substratum, shaking flask activation culture 48h.

(2) by streak culture on YPD flat board for the bacterium liquid activated, and 4 DEG C of preservations.

(3) the mono-bacterium colony of picking Candida jeffriesii NRRL Y-27738 in YPD flat board, is inoculated in 20mlYPD substratum, 30 DEG C of incubated overnight in 100ml shaking flask.

(4) be inoculated in 50ml YPD substratum by the fresh bacterium liquid of incubated overnight, in 250ml shaking flask 30 DEG C, 200rpm cultivates, to bacterium liquid OD600 to about 1.2.

(5) the centrifugal 5min of 5000rpm room temperature, collects somatic cells.

(6) by cell Eddy diffusion in the LiAc of 500 μ l 0.1mol/L, centrifugal, abandon supernatant, obtain competent cell.

Two, the preparation of linearizing recombinant plasmid

(1) E.coli containing recombinant expression plasmid is inoculated in LB substratum, incubated overnight.

(2) collect E.coli somatic cells, adopt alkali cracking method to extract recombinant plasmid, concrete grammar is with reference to vast Tyke plasmid extraction kit.

(3) restriction enzyme Stu I single endonuclease digestion recombinant plasmid is adopted, endonuclease reaction system (50 μ L): 40 μ L DNA, 5 μ L buffer, 1.5 μ L restriction enzyme Stu I, supply 50 μ L with distilled water, mixing is placed on enzyme in 37 DEG C of thermostat containers and cuts 2h.

(4) purifying digestion products, obtains linearizing recombinant plasmid.

Three, PEG/LiAc method transforms Candida jeffriesii NRRL Y-27738

(1) in competent cell, order adds following transformation mixture: 240 μ L PEG3350,36 μ L1.0mol/L LiAc, 25 μ L salmon sperm dnas, 50 μ L linear DNA to be transformed, wherein ice bath immediately after salmon sperm dna boiling water bath 10min;

(2) each reaction tubes of thermal agitation is until cell mixes completely;

(3) 30 DEG C of incubation 1h are placed in;

(4) 42 DEG C of metal bath thermal shock 22min are placed in;

(5) after being down to room temperature, the centrifugal 5min of 5000rpm, abandons supernatant;

(6) add 1ml YPD substratum, after 30 DEG C, cultivate 2h;

(7) the centrifugal 5min of 5000rpm, discards 800 μ l supernatants, and mixing thalline is also coated with hygromycin B (100mg/mL) resistant panel, cultivates 3-4d for 30 DEG C, obtains transformant.

Embodiment 3: the foundation of the yeast Candida jeffriesii method for transformation of electroporation mediation

Using Candida jeffriesii NRRL Y-27738 as Host Strains, adopt being implemented as follows of electroporation mediated transformation yeast:

One, Candida jeffriesii NRRL Y-27738 electricity turns the preparation of competent cell

(1) the Candida jeffriesii NRRL Y-27738 of cryopreservation tube preservation is inoculated in YPD substratum, shaking flask activation culture 48h;

(2) by streak culture on YPD flat board for the bacterium liquid activated, and 4 DEG C of preservations;

(3) the mono-bacterium colony of picking Candida jeffriesii NRRL Y-27738 in YPD flat board, is inoculated in 20mlYPD substratum, 30 DEG C of incubated overnight in 100ml shaking flask;

(4) be inoculated in 50ml YPD substratum by the fresh bacterium liquid of incubated overnight, in 250ml shaking flask 30 DEG C, 200rpm cultivates, to bacterium liquid OD600 to about 1.2;

(5) bacterium liquid is placed in 30min, 5000rpm on ice, 4 DEG C of centrifugal 5min, collects somatic cells;

(6) the 20ml distilled water adding precooling washs thalline 2 times, 5000rpm, 4 DEG C of centrifugal 5min, collects somatic cells;

(7) add the 1.0mol/L sorbitol washes thalline 2 times of 20ml precooling, 5000rpm, 4 DEG C of centrifugal 5min, collect somatic cells;

(8) add the 1.0mol/L sorbyl alcohol mixing somatic cells of 200 μ l precoolings, obtain competent cell.

Two, the preparation of linearizing recombinant plasmid

(1) E.coli containing recombinant expression plasmid is inoculated in LB substratum, incubated overnight.

(2) collect E.coli somatic cells, adopt alkali cracking method to extract recombinant plasmid, concrete grammar is with reference to vast Tyke plasmid extraction kit.

(3) restriction enzyme Stu I single endonuclease digestion recombinant plasmid is adopted, endonuclease reaction system (50 μ L): 40 μ L DNA, 5 μ L buffer, 1.5 μ L restriction enzyme Stu I, supply 50 μ L with distilled water, mixing is placed on enzyme in 37 DEG C of thermostat containers and cuts 2h.

(4) purifying digestion products, obtains linearizing recombinant plasmid.

Three, the electricity of Candida jeffriesii NRRL Y-27738 transforms

(1) get 100 μ l Electroporation-competent cells and 10 μ l DNA mix, join in 0.2cm electricity revolving cup;

(2) electric revolving cup ice bath 5min, impose a condition 1500v, electric shock 5s, carries out electricity and transform;

(3) in electric revolving cup, add the 1.0mol/L sorbyl alcohol of 1ml precooling immediately, be transferred to incubator 30 DEG C of incubation 1h;

(4) the centrifugal 5min of 5000rpm, abandons supernatant;

(5) add 1ml YPD substratum, mixing somatic cells, cultivates 2h after incubator 30 DEG C;

(6) the centrifugal 5min of 5000rpm, discards 800 μ l supernatants, and mixing thalline is also coated with hygromycin B (100mg/mL) resistant panel, cultivates 3-4d for 30 DEG C, obtains transformant.

The application of the embodiment 4:PR integrated expression vector of series in expression alien gene.

One, green fluorescent protein recombinant expression vector is built

(1) according to the gene order of green fluorescent protein, design primer: primer P33 underscore part is the recognition site of Sal I, and primer P34 underscore part is the recognition site of Not I.

P33：5’ACGC GTCGACATGGGTAAGGGAGAAGAACTTTTCAC 3’

P34：5’ATAAGAAT GCGGCCGCTTATTTGTATAGTTCATCCATGCCATG 3’

(2) with the DNA of green fluorescence protein gene for template, carry out pcr amplification with primer P33 and P34, obtain gene gfp.Amplification condition is 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 62 DEG C of annealing 30s, and 72 DEG C extend 45s, 30 circulations, and 72 DEG C extend 5min.

(3) the gfp fragment of purifying is cloned into pMD19-Tsimple carrier, Transformed E .coli JM109 competent cell, coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, after extracting plasmid, Sal I and Not I double digestion are verified, obtain recombinant plasmid pMD-gfp.

(4) owing to there is codon CUG in gfp gene sequence open reading frame, and yeast Candida jeffriesii uses special coding scheme, i.e. codon CUG encoding serine but not leucine.Therefore be necessary to carry out rite-directed mutagenesis to gfp gene, codon CUG is sported codon UUG.

(5) in gfp gene order CDS, the base C of 601, as mutational site, designs simple point mutation primer: primer P35 and P36 underscore part are mutational site.

P35：5’ TACCAGACAACCATTAC TTGTCCACACAATCTGCC3’

p36：5’ GGCAGATTGTGTGGA CAAGTAATGGTTGTCTGGTA 3’

(6) with recombinant plasmid pMD-gfp for template, adopt Stratagene site-directed mutagenesis kit, carry out pcr amplification with primer P35 and P36, obtain ring-type PCR primer.Amplification condition is: 95 DEG C of denaturation 2min, 95 DEG C of sex change 30s, 55 DEG C of annealing 2min, and 68 DEG C extend 3.5min, 30 circulations, and 68 DEG C fully extend 5min;

(7) 30mins are digested with restriction endonuclease Dpn I in 37 DEG C by after above-mentioned PCR primer purifying, in 65 DEG C of reaction 15min with inactivation restriction endonuclease Dpn I.After digestion products purifying, Transformed E .coli JM109 competent cell, coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, deliver to Sangon Biotech (Shanghai) Co., Ltd. after extracting plasmid to check order, select the plasmid that mutational site is correct, called after pMD-gfp _m.After gfp site-directed point mutation, DNA sequence dna is SEQ ID NO:11, as shown in Figure 2.

(8) by recombinant plasmid pMD-gfp _msal I and Not I double digestion is used respectively with PRACTH.Spend the night with the digestion products of plasmid PRACTH after gfp fragment enzyme cuts purifying and be connected, Transformed E .coli JM109 bacterial strain, coat on LB (100 μ g/ml penbritin) flat board, picking individual colonies, after extracting plasmid, Sal I and Not I double digestion are verified, obtain green fluorescent protein recombinant expression vector PRACTH-gfp _m, plasmid map as shown in Figure 3.

Two, Candida jeffriesii recombinant bacterium is built

Will through the linearizing plasmid PRACTH-gfp of Stu I _mby method described in embodiment 2 or embodiment 3, be transformed in Candida jeffriesii NRRL Y-27738, obtain transformant.

Three, transformant screening and checking

(1) by high density Hygromycin B resistant plate screening transformant.The transformant obtained after green fluorescent protein recombinant expression vector being transformed Candida jeffriesii NRRL Y-27738 is transferred in greater concn hygromycin B (200 μ g/mL) resistant panel, cultivate 2-3d for 30 DEG C, adopt identical method to transfer continuously 3 times, obtain pure culture transformant bacterial strain.

(2) the bacterium colony PCR of positive transformant verifies.Prepare PCR amplification system with primer P21 and P22, and in system, add the transformant thalline of micro-microwave treatment.Pcr amplification condition is 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 63 DEG C of annealing 30s, and 72 DEG C extend 1.5min, 30 circulations, and 72 DEG C extend 5min.PCR primer shows about 1100bp band, as shown in Figure 4, with DNA fragmentation hph through agarose gel electrophoresis _m-ScCYC1T stripe size is consistent.

(3) fluoroscopic examination of positive transformant.By the pure culture transformant inoculation of acquisition in step (1) in YPD substratum, after shaking flask 30 DEG C cultivates 18h, collect thalline, distilled water washing somatic cells 2 times is also resuspended in distilled water.Drawing a small amount of suspension is placed on slide glass, covered, takes pictures under fluorescent microscope with oily sem observation.As shown in Figure 5, cell can be observed and send green fluorescence.

Claims (10)

1. a strain can utilize the expression system of the yeast Candida jeffriesii of wood sugar, and it is characterized in that comprising a kind of expression vector, described expression vector is from 5 '-3 ' comprise following operability element successively:

PMD19-Tsimple plasmid backbone, rDNA homologous recombination sequence, exogenous gene expression box and riddled basins expression cassette;

Described exogenous gene expression box comprises promotor successively to downstream from upstream, foreign gene inserts restriction enzyme site and transcription terminator;

Described riddled basins expression cassette comprises promotor, antibiotics resistance gene, transcription terminator.

The described yeast of wood sugar that can utilize is for Candida jeffriesii.

2. expression system according to claim 1, is characterized in that described rDNA homologous recombination sequence is 18s rDNA sequence.

3. expression system according to claim 1, is characterized in that the promotor in described exogenous gene expression box comprises SpADH _p, SpXYL _p; Transcription terminator comprises SpCYC1 _t, SpXYL _t.

4. expression system according to claim 1, is characterized in that the promotor in described riddled basins expression cassette comprises SpTEF1 _p; Antibiotics resistance gene comprises hygromycin gene, blasticidin resistance gene, G418; Transcription terminator comprises SpCYC1 _t, ScCYC1 _t.

5. the expression system according to any one of claim 2 ~ 4, is characterized in that:

Described 18s rDNA sequence is as shown in SEQ ID NO:1;

Described SpADH _ppromotor is the alcohol dehydrogenase gene ADH1 promotor that Spathaspora passalidarum originates, and the DNA sequence dna of this promotor is as shown in SEQ ID NO:2;

Described SpXYL _ppromotor is the Xylose reductase gene XYL promotor that Spathaspora passalidarum originates, and the DNA sequence dna of this promotor is as shown in SEQ ID NO:3;

Described SpTEF1 _ppromotor is the transcription initiation factor gene TEF1 promotor that Spathaspora passalidarum originates, and the DNA sequence dna of this promotor is as shown in SEQ ID NO:4;

Described SpCYC1 _tterminator is the cytochrome C gene CYC1 terminator that Spathaspora passalidarum originates, and the DNA sequence dna of this terminator is as shown in SEQ ID NO:5;

Described SpXYL _tterminator is the Xylose reductase gene XYL terminator that Spathaspora passalidarum originates, and the DNA sequence dna of this terminator is as shown in SEQ ID NO:6;

Described ScCYC1 _tterminator is the cytochrome C gene CYC1 terminator that Saccharomyces cerevisiae originates, and the DNA sequence dna of this terminator is as shown in SEQ ID NO:7;

The DNA sequence dna of described hygromycin gene is as shown in SEQ ID NO:8;

The DNA sequence dna of described blasticidin resistance gene is as shown in SEQ ID NO:9;

The DNA sequence dna of described G418 is as shown in SEQ ID NO:10.

6. expression system according to claim 1, is characterized in that, described host yeast Candida jeffriesii is preserved in american agriculture DSMZ, and deposit number is NRRL Y-27738.

7. the arbitrary described application of expression vector in Host Strains Candida jeffriesii genetic transformation of Claims 1 to 4.

8. a strain according to claim 1 can utilize the purposes of the expression system of the yeast of wood sugar, it is characterized in that for expressing foreign protein and Host Strains own metabolism is engineered.

9. a method for expression alien gene, is characterized in that comprising the steps:

(1) described expression system is prepared;

(2) foreign gene foreign gene being inserted described expression vector inserts restriction enzyme site, obtains recombinant expression vector;

(3) described recombinant expression vector transformed Host Strains Candida jeffriesii and in Host Strains, express described foreign gene.

10. a method of metabolic engineering Host Strains Candida jeffriesii, is characterized in that comprising the steps:

(1) described expression system is prepared;

(2) foreign gene target gene being inserted described expression vector inserts restriction enzyme site, obtains recombinant expression vector;

(3) described recombinant expression vector transformed Host Strains Candida jeffriesii and in Host Strains, express described target gene;

(4) cultivate described recombinant bacterium, detect described recombinant bacterium meta-bolites.