CN106636309B

CN106636309B - Probe combination for detecting esophageal cancer related marker and kit thereof

Info

Publication number: CN106636309B
Application number: CN201510733120.7A
Authority: CN
Inventors: 刘苏燕; 吴诗扬; 董艳
Original assignee: Surexam Bio Tech Co Ltd
Current assignee: Surexam Bio Tech Co Ltd
Priority date: 2015-10-30
Filing date: 2015-10-30
Publication date: 2021-03-02
Anticipated expiration: 2035-10-30
Also published as: CN106636309A

Abstract

The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and particularly relates to a probe combination for detecting esophageal cancer related markers and a kit thereof. The marker related to the esophageal cancer provided by the invention is selected from 12 miRNAs, and the marker is closely related to the esophageal cancer; the probe composition provided by the invention comprises a capture probe and a signal amplification composition, and the probe composition has good specificity, accuracy and sensitivity, can realize accurate detection of a target marker, and has good repeatability. The kit provided by the invention also comprises a signal amplification probe, the method provided by the invention adopts an in-situ hybridization method, the signal intensity is improved through a cascade amplification system, the detection of the sample can be completed within 8h by adopting the kit and the method provided by the invention, and the detection efficiency is improved.

Description

Probe combination for detecting esophageal cancer related marker and kit thereof

Technical Field

The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and particularly relates to a probe combination for detecting esophageal cancer related markers and a kit thereof.

Background

MicroRNAs (miRNAs) are endogenous non-coding RNAs with a regulation function, and the size of the RNAs is about 20-25 nucleotides. Mature miRNAs are produced from a long primary transcript by a series of nuclease cleavage processes, then assembled into an RNA-induced silencing complex (RISC), recognize a target miRNA by way of base-complementary pairing, and direct the silencing complex to degrade the target miRNA or repress translation of the target miRNA according to the difference in degree of complementarity. Recent studies have shown that mirnas are involved in a wide variety of regulatory pathways including development, viral defense, hematopoietic processes, organogenesis, cell proliferation and apoptosis, fat metabolism, and the like.

Esophageal tumor is a common malignant tumor of digestive tract, the death rate is up to 90 percent, and the death rate accounts for 21 percent of the death rate of the malignant tumor in China, and the esophageal tumor seriously threatens the health of human beings. Recent research shows that miRNA is closely related to the occurrence and development of esophageal cancer (including squamous carcinoma and adenocarcinoma), and the miRNA expression profile of esophageal cancer tissues is significantly different from that of paracancer normal tissues. Researchers use a gene chip technology to measure the miRNA expression profile in the esophageal squamous cell tissue, and compare the miRNA expression profile with a paracancer normal tissue to find that the expression levels of multiple miRNAs in the two tissues are different. Based on the correlation between the expression of miRNA and esophageal cancer, miRNA can be used as a marker related to esophageal cancer, and early diagnosis and treatment of esophageal cancer can be realized by detecting the expression of miRNA.

At present, the methods for detecting miRNA mainly include Northern Blot, gene chip, fluorescent quantitative probe method, and microsphere-based flow cytometry. However, northern blot method has low sensitivity, long time consumption and large RNA dosage, and is not suitable for high-throughput analysis; the gene chip technology can realize high-throughput analysis of miRNA, i.e. a plurality of miRNA are detected on one chip simultaneously, but the defects are low result accuracy, poor repeatability and expensive experiment price; the fluorescence quantitative probe method has high detection sensitivity, but the detection cost is expensive; the flow cytometry technology based on the microspheres fixes the probe on the microspheres and places the probe in a liquid phase, which is more beneficial to capturing miRNA sequences, so that the accuracy is improved.

The in situ hybridization technique is a method for positioning and morphologically detecting specific miRNA sequences in preserved tissue sections or cell preparations. However, the prior art has many difficulties in multiplex and parallel detection of miRNA. Firstly, preparing a labeled probe of each target miRNA respectively; secondly, it is difficult to detect the expression of multiple target mirnas simultaneously in situ. Therefore, the detection of multiple mirnas reported at present can only be performed by different labeling methods, however, the possible cross-hybridization of the probe to non-specific sequences in the cell cannot be well controlled by different labeling methods.

Disclosure of Invention

The invention aims to provide a microRNA detection kit related to esophageal cancer, which has strong specificity and high sensitivity.

The technical scheme for achieving the purpose is as follows.

A probe composition is capable of detecting esophageal cancer related markers, and the markers are selected from one or more of hsa-miR-25-3p, hsa-miR-373-3p, hsa-miR-16-5p, hsa-miR-208a-3p, hsa-miR-518b, hsa-miR-138-5p, hsa-miR-145-5p, hsa-miR-296-5p, hsa-miR-21-5p, hsa-miR-223-3p, hsa-miR-192-5p or hsa-miR-194-5 p.

The probe composition is characterized by comprising a capture probe:

the nucleotide sequence of the capture probe is a P1 sequence, a spacer arm sequence and a P2 sequence from the 5 'end to the 3' end in sequence;

the P1 sequence specifically binds to the marker of claim 1;

in one embodiment, the spacer arm sequence is 5-10T.

In one embodiment, the P1 sequence is selected from SEQ ID NO 1-12, and the P2 sequence is selected from SEQ ID NO 13-24.

In one embodiment, the probe composition is characterized in that the capture probe is selected from the following sequences:

1, 5T and 13 SEQ ID NO connected in sequence from 5 'end to 3' end;

2, 5T and 14 SEQ ID NO connected in sequence from 5 'end to 3' end;

3, 5T and 15 SEQ ID NO connected in sequence from 5 'end to 3' end;

4, 5T and 16 SEQ ID NO connected in sequence from 5 'end to 3' end;

5, 5T and 17 SEQ ID NO connected in sequence from 5 'end to 3' end;

6, 5T and 18 SEQ ID NO connected in sequence from 5 'end to 3' end;

7, 5T and 19 SEQ ID NO connected in sequence from 5 'end to 3' end;

8 SEQ ID NO, 5T SEQ ID NO and 20 SEQ ID NO connected in sequence from the 5 'end to the 3' end;

9 SEQ ID NO, 5T SEQ ID NO and 21 SEQ ID NO connected in sequence from the 5 'end to the 3' end;

10 SEQ ID NO, 5T SEQ ID NO and 22 SEQ ID NO connected in sequence from 5 'end to 3' end;

11, 5T and 23 SEQ ID NO connected in sequence from 5 'end to 3' end;

12, 5T and 24 SEQ ID NO connected in sequence from 5 'end to 3' end.

The invention also aims to provide an esophageal cancer related marker detection kit, which is characterized by comprising the capture probe and a signal amplification composition.

The kit for detecting the esophageal cancer related marker is characterized in that the signal amplification composition is as follows:

a primary signal amplification probe, wherein a fluorescent group is modified at the 5' end of the primary signal amplification probe;

or a first-stage signal amplification probe and a second-stage signal amplification probe, wherein a fluorescent group is modified at the 3' end of the second-stage signal amplification probe;

or a primary signal amplification probe, a secondary signal amplification probe and a tertiary signal amplification probe, wherein a fluorescent group is modified at the 5' end of the tertiary signal amplification probe;

for any of the capture probes, the primary signal amplification probe specifically binds to the capture probe;

for any one of the primary signal amplification probes, the secondary signal amplification probe specifically binds to the primary signal amplification probe;

for any one of the secondary signal amplification probes, the tertiary signal amplification probe specifically binds to the secondary signal amplification probe.

The invention provides an esophageal cancer related marker detection kit, which is further characterized in that:

the primary signal amplification probe is sequentially provided with a P4 sequence, a spacer arm sequence and a P3 sequence from the 5 'end to the 3' end;

the secondary signal amplification probe is sequentially provided with a P5 sequence, a spacer arm sequence and a P6 sequence from the 5 'end to the 3' end;

the three-level signal amplification probe is sequentially provided with a P8 sequence, a spacer arm sequence and a P7 sequence from the 5 'end to the 3' end;

the P3 sequence specifically binds to the P2 sequence;

the P5 sequence specifically binds to the P4 sequence;

the P6 sequence specifically binds to the P7 sequence;

the spacer arm sequences are independent from 2 to 20T;

the P8 sequence is 5T.

In one embodiment, the P4 sequence is selected from SEQ ID NO 25-36; the sequence of P6 is selected from SEQ ID NO 49-60.

In one embodiment, the fluorescent group is selected from FAM, TET, JOE, HEX, Cy3, TAMRA, ROX, Texas Red, LC Red640, Cy5, LC Red705, or Alexa Fluor 488, and the modified fluorescent groups on the signal amplification probes for different capture probes are different from each other.

The main advantages of the invention are:

(1) the in situ hybridization method has the defect of low fluorescence signal sensitivity, but the invention adopts the detection kit designed by the novel in situ hybridization method to improve the fluorescence signal intensity through a signal amplification system. The detection process can be completed within 8h, the single copy nucleic acid hybridization probe is combined with the corresponding fluorescent probe through a signal amplification system, the detection sensitivity of miRNA in-situ hybridization is obviously improved, in addition, the amplification of signals is realized in a multi-site specific pairing and cascade amplification mode instead of a PCR amplification method, the detection signals are improved, the detection specificity is realized, and the false positive of reverse transcription PCR and real-time fluorescent quantitative PCR technology is avoided.

(2) The signal amplification probe selected by the invention is obtained by comprehensive evaluation, statistical analysis and optimized combination of various parameters through a large number of tests. The method adopts multiple signal amplification probes, the selection of the probes can realize secondary probe or tertiary probe use, signal amplification detection can be realized, and when three probes are used together, the detection sensitivity is greatly improved.

(3) Various specific probes of the miRNA in 12 designed by the invention can perform hybridization reaction under uniform reaction conditions, and nonspecific binding basically does not exist among the probes; the designed probe has good specificity and high signal-to-noise ratio in detection. Meanwhile, the combined use of a plurality of probes enables the identification kit and the detection method to form a system with good detection effect.

Detailed Description

The invention provides an esophageal cancer related marker, a detection probe and a detection method thereof, and a person skilled in the art can realize the marker by properly improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

Example 1 esophageal cancer-associated miRNA detection kit

The embodiment provides an esophageal cancer related miRNA detection kit, which comprises a capture probe and a signal amplification probe, wherein the signal amplification probe comprises a first-level signal amplification probe, a second-level signal amplification probe and a third-level signal amplification probe. The probe has the characteristics of strong specificity and high sensitivity.

1. Capture probe

The capture probes are used for connecting the target nucleic acid and the primary signal amplification probes, the base sequence of each capture probe sequentially comprises a specific sequence P1 combined with the target nucleic acid to be detected, a spacer arm sequence and a sequence P2 from the 5 'end to the 3' end, and the sequence P3 is a base sequence which is reversely complementary with the sequence P2; the P2 sequences for different target genes differ from each other.

The spacer is used for spacing the capture probe P2 sequence from the specificity sequence P1, and the spacer with proper length is arranged in the probe, so that the steric hindrance can be reduced, and the efficiency of the hybridization reaction and the specificity of the hybridization reaction can be improved. The spacer arm of the capture probe of the invention is preferably 5-10T, preferably 5T in this embodiment.

In this example, capture probes were designed for hsa-miR-25-3p, hsa-miR-373-3p, hsa-miR-16-5p, hsa-miR-208a-3p, hsa-miR-518b, hsa-miR-138-5p, hsa-miR-145-5p, hsa-miR-296-5p, hsa-miR-21-5p, hsa-miR-223-3p, hsa-miR-192-5p, or hsa-miR-194-5p, as shown in Table 1 and Table 2:

TABLE 1P 1 sequence of capture probes

SEQ ID NO.	miRNA	P1 sequence (5 '→ 3')
			1	hsa-miR-25-3p	TCAGACCGAGACAAGTGCAATG
2	hsa-miR-373-3p	ACACCCCAAAATCGAAGCACTTC

3	hsa-miR-16-5p	CGCCAATATTTACGTGCTGCTA
			4	hsa-miR-208a-3p	ACAAGCTTTTTGCTCGTCTTAT
5	hsa-miR-518b	ACCTCTAAAGGGGAGCGCTTTG
			6	hsa-miR-138-5p	CGGCCTGATTCACAACACCAGCT
7	hsa-miR-145-5p	AGGGATTCCTGGGAAAACTGGAC
			8	hsa-miR-296-5p	ACAGGATTGAGGGGGGGCCCT
9	hsa-miR-21-5p	TCAACATCAGTCTGATAAGCTA
			10	hsa-miR-223-3p	TGGGGTATTTGACAAACTGACA
11	hsa-miR-192-5p	GGCTGTCAATTCATAGGTCAG
			12	hsa-miR-194-5p	TCCACATGGAGTTGCTGTTACA

TABLE 2P 2 sequence of capture probes

SEQ ID NO.	P2 sequence (5 '→ 3')	SEQ ID NO.	P2 sequence (5 '→ 3')
				13	GTCTATAGTG	19	GATGACAGTA
14	GATTCAGTGA	20	AGTACTTGTG
				15	TTGAGTAATG	21	AGTCTTGAAG
16	TGTAATGAGT	22	TGATGAATTG
				17	GATTAGTGAT	23	ATGACGATAG
18	GTAGATTAGT	24	TTGACGTGAA

2. Signal amplification probe

1) First order signal amplification probe

The signal amplification component comprises one or more primary signal amplification probes, and each primary signal amplification probe sequentially comprises from the 5 'end to the 3' end: a P3 sequence, a spacer arm sequence and a P4 sequence which are combined with the reverse complementary pairing of the P2 sequence, wherein the P3 sequence realizes the cascade amplification of target signals through the combination with the capture probe P2 sequence.

The spacer arm sequence between the P3 and P4 sequences of the invention can be selected from 5-20T, and the spacer arm used in the embodiment is 10T.

The P4 sequence contains one or more base segments which are reversely complementary with the P5 sequence of the secondary signal amplification probe,

preferably, the nucleotide sequence contains 2 to 5 nucleotide fragments complementary and paired with the P2 sequence, in this example, P4 contains 3 nucleotide fragments complementary to P5 in reverse direction, and spacer arm sequences are provided between the same nucleotide fragments, the spacer arm sequences are preferably 3 to 10T, in this example, 3T are provided, specifically, as shown in Table 3:

TABLE 3P 4 sequences of first-order Signal amplification probes

SEQ ID NO.	P4 sequence (5 '→ 3')
		25	GATCTC TTT GATCTC TTT GATCTC
26	ATATCA TTT ATATCA TTT ATATCA
		27	TATCTC TTT TATCTC TTT TATCTC
28	CACATC TTT CACATC TTT CACATC
		29	TCACAT TTT TCACAT TTT TCACAT
30	ACATCA TTT ACATCA TTT ACATCA

31	CATCGA TTT CATCGA TTT CATCGA
		32	TCAGTC TTT TCAGTC TTT TCAGTC
33	ACTCTC TTT ACTCTC TTT ACTCTC
		34	ATCATC TTT ATCATC TTT ATCATC
35	ACATCC TTT ACATCC TTT ACATCC
		36	TCAGCA TTT TCAGCA TTT TCAGCA

2) Two-stage signal amplification probe

The invention contains one or more than one secondary signal amplification probes, and the secondary signal amplification probes sequentially comprise from the 5 'end to the 3' end: a P5 sequence, a spacer arm sequence and a P6 sequence which are combined with the reverse complement of the P4 sequence, wherein the P4 contains one or more than one P5 sequence reverse complementary base sequences.

The spacer arm sequence between the P5 and P6 sequences of the present invention can be selected from 5-10T, and the spacer arm used in this embodiment is 6T, specifically as shown in table 4:

TABLE 4P 5 sequences of Secondary Signal amplification probes

SEQ ID NO.	P5 sequence (5 '→ 3')	SEQ ID NO.	P5 sequence (5 '→ 3')
				37	GAGATC	43	TCGATG
38	TGATAT	44	GACTGA
				39	GAGATA	45	GAGAGT
40	GATGTG	46	GATGAT
				41	ATGTGA	47	GGATGT
42	TGATGT	48	TGCTGA

The P6 sequence contains one or more base sequences which are complementary with the P7 sequence of the three-level signal amplification probe in a reverse direction, preferably contains 2-5 base fragments which are complementary and matched with the P7 sequence, in the embodiment, the P6 sequence contains three base fragments which are complementary with the P7 sequence in a reverse direction, and spacer arm sequences are arranged among the same base sequences, the spacer arm sequences are preferably 2-10T, in the embodiment, 2T, specifically shown in the table 5:

TABLE 5P 6 sequences of Secondary Signal amplification probes

SEQ ID NO.	P6 sequence (5 '→ 3')
		49	ACACG TT ACACG TT ACACG
50	AGCAT TT AGCAT TT AGCAT
		51	CAGCT TT CAGCT TT CAGCT
52	ACGTG TT ACGTG TT ACGTG
		53	GACTA TT GACTA TT GACTA
54	CTAGC TT CTAGC TT CTAGC
		55	TACGA TT TACGA TT TACGA
56	GTGAC TT GTGAC TT GTGAC
		57	CTAGA TT CTAGA TT CTAGA
58	GTAGA TT GTAGA TT GTAGA
		59	CTCGT TT CTCGT TT CTCGT
60	TGATC TT TGATC TT TGATC

3) Three-stage signal amplification probe

The three-level signal amplification probe sequentially comprises the following components from a 5 'end to a 3' end: a P8 sequence, a spacer arm sequence, a P7 sequence, the P6 sequence containing one or more sequences reverse complementary to the P7 sequence; the 5' end of the P8 sequence is also modified with a fluorescent group;

the spacer arm sequence between the P7 and P8 sequences of the present invention can be selected from 3-10T, and the spacer arm used in this embodiment is 5T, as shown in table 6:

TABLE 6P 7 sequences of three-stage Signal amplification probes

SEQ ID NO.	Sequence P7Column (5 '→ 3')	SEQ ID NO.	P7 sequence (5 '→ 3')
				61	GAGTG	67	ATGCT
62	TCATG	68	AGCTG
				63	GTCGT	69	CACGT
64	GAGTC	70	TCGTC
				65	GTCAG	71	GCTAG
66	CGTGT	72	TCGTA

Except for the situation that the specific probes defined under the conditions are reversely complementary and completely matched, the sequences of the P3, the P4, the P5, the P6, the P7 and the P8 are sequences without hairpin structures, no dimer is formed between the probe interior and the probe, no mismatch exists, and no specific binding exists between the probe interior and other nucleic acids of the whole detection system.

In this embodiment, the P8 sequence is a polyT sequence of 5 bases, and its 5' end is labeled with a fluorophore selected from: FAM, TET, JOE, HEX, Cy3, TAMRA, ROX, Texas Red, LC RED640, Cy5, LC RED705 and Alexa Fluor 488, fluorophores for different target nucleic acids are different from each other, and the selected fluorophores are different from each other in color or emission wavelength, so as to distinguish the different types of target nucleic acids.

Example 2 kit for detecting esophageal cancer-related miRNA

The invention provides an esophageal cancer related miRNA detection kit, which can detect target miRNA and comprises: and expression levels of hsa-miR-375, hsa-miR-149-3P, hsa-miR-221-3P, hsa-miR-222-3P, hsa-miR-34a-5P, hsa-miR-199a-5P, hsa-miR-137, hsa-miR-182-5P, hsa-miR-125b-5P, hsa-miR-31-5P, hsa-miR-21-5P or hsa-miR-365a-3P and the like are shown, and in actual detection, corresponding sequences of P1-P8 can be used according to specific requirements to form a detection kit, so that detection can be realized.

The components of the detection kit of the embodiment comprise: the components of the capture probe, the signal amplification probe and the fluorescent group are shown in Table 7.

In this example, 12 miRNAs such as hsa-miR-25-3p, hsa-miR-373-3p, hsa-miR-16-5p, hsa-miR-208a-3p, hsa-miR-518b, hsa-miR-138-5p, hsa-miR-145-5p, hsa-miR-296-5p, hsa-miR-21-5p, hsa-miR-223-3p, hsa-miR-192-5p or hsa-miR-194-5p are randomly divided into 3 groups to detect kit components for different miRNAs, and the kit components are reliable and repeatable.

TABLE 7 detection kit for specific target genes (SEQ ID NO. in the form of Table.)

Example 3 detection of samples Using the kit of example 2

This example will use the kit of example 2 to detect esophageal cancer cells,

in this embodiment, taking esophageal cancer cell line TE-1 as an example, a person skilled in the art can obtain a related cell line from an existing product according to the name of the cell line.

The formulations of the various solutions are as follows:

the signal amplification probe mixture in this example used all the probes in the corresponding list in example 1.

Firstly, sample pretreatment, namely filtering sample cells onto a filter membrane

1. Esophageal cancer cells (TE-1) in the sample storage tube were centrifuged horizontally at 600 Xg for 5min, and the supernatant was discarded.

2. 4mL of PBS and 1mL of fixative were added, vortexed, mixed, and allowed to stand at room temperature for 8 min.

3. And (3) filtering a sample: transferring the liquid in the sample storage tube into a filter, and opening a vacuum pump to pump out the liquid; 4mL of PBS was added to the storage tube, and the tube wall was washed and the liquid was filtered off with suction.

4. The filters were transferred to a 24-well plate, 400. mu.L of 4% formaldehyde solution was added, and the mixture was fixed at room temperature for 1 hour.

5. The liquid was removed and washed three times with 1mL PBS per well for 2min each time.

Second, permeabilization treatment

1. Adding 50 mu L of permeabilizing agent into each new 24-pore plate, taking the filter membrane out of the PBS, contacting the edge of the filter membrane piece with absorbent paper, removing redundant liquid, and reversely buckling the filter membrane on the permeabilizing agent, namely, the side with the code engraved on the iron circle of the filter membrane is downward close to the liquid. Incubate at room temperature for 5 min.

2. The liquid was removed and washed twice with 1ml PBS per well for 2min each time. The filters were kept in PBS for further experimental work.

Digesting the cell, exposing miRNA, and hybridizing the miRNA with the probe

1. Preparing digestive enzyme working solution with corresponding concentration:

reagent composition	Dosage per sample
		Digestive enzymes	1.25μL
PBS	48.75μL
		Total volume	50μL

2. The digestive enzyme working solution is evenly mixed by vortex and is subpackaged into 24-hole plates, and each hole is 50 mu l.

3. And taking out the filter membrane, and reversely buckling the filter membrane onto digestive enzyme working solution in a 24-pore plate to ensure that the downward surface of the filter membrane is fully contacted with the liquid and no bubbles exist. Standing at room temperature for 1 h.

4. The liquid was removed and washed three times with 1ml PBS per well, 2min each time. The filters were kept in PBS buffer for further experimental work.

Fourthly, probe hybridization, the specific sequence of the probe is combined with the target miRNA sequence

1. The capture probe mixture and the probe buffer solution are preheated for 20min in a water bath at 40 ℃ before use.

2. Preparing a capture probe working solution:

reagent composition	Dosage per sample
		Capture probe mixture	8μL
Probe buffer (40 ℃ pre-heating)	42μL
		Total volume	50.0μL

Vortex and mix well and dispense into 24 well plates, 50. mu.l per well.

3. And taking out the filter membrane, and reversely buckling the filter membrane onto the capture probe working solution in the 24-pore plate to ensure that the downward surface of the filter membrane is fully contacted with the liquid and no bubbles exist.

4. Cover with 24-well plate and incubate at 40. + -. 1 ℃ for 3 hours.

5. Removing liquid, adding 1ml washing solution into each hole, washing for three times, and soaking for 2min each time. And keeping the filter membrane in the washing liquid until the next experimental operation, wherein the soaking time of the sample in the washing liquid cannot exceed 30 min.

Fifthly, amplifying target mRNA sequence signals

1. The probe buffer solution is preheated for 20min in a water bath at 40 ℃ before use.

2. Preparing a probe working solution:

reagent composition	Dosage per sample
		Signal amplification probe mixed liquid	8μL
Probe buffer (40 ℃ pre-heating)	42μL
		Total volume	50.0μL

Vortex and mix well and dispense into 24 well plates, 50. mu.l per well.

3. And taking out the filter membrane, and reversely buckling the filter membrane onto the probe working solution in the 24-pore plate to ensure that the downward surface of the filter membrane is fully contacted with the liquid and no bubbles exist.

4. Cover with 24-well plate and incubate at 40. + -. 1 ℃ for 3 hours.

Sixthly, developing color and marking target signal by fluorescence

1. The chromogenic buffer (preheated at 40 ℃) was vortexed and mixed in the dark, and the mixture was dispensed into 24-well plates at 50. mu.l/well.

2. And taking out the filter membrane, and reversely buckling the filter membrane onto the chromogenic buffer solution in the 24-pore plate to ensure that the downward surface of the filter membrane is fully contacted with liquid and no air bubbles exist.

3. Cover with 24-well plate cover, incubate at 40 + -1 deg.C for 30 min.

4. Removing liquid, adding 1ml washing solution into each hole, washing for three times, and soaking for 2min each time. And keeping the filter membrane in the washing liquid until the next experimental operation, wherein the soaking time of the sample in the washing liquid cannot exceed 30 min.

Observation by fluorescence microscope

The control of the present invention uses DAPI as the nuclear fluorophore, which emits a blue fluorescent signal.

1. Placing the filter membrane with cell surface facing upwards on a glass slide, cutting the filter membrane along the inner ring of the iron ring, adding 10 μ L of anti-quenching agent, covering with 18mm × 18mm cover glass, and directly performing microscopic examination or storing at-20 deg.C.

2. The number of sample cells was counted through a 20-fold objective lens.

3. And (4) positioning the position of the heteronuclear according to the 10-time objective lens, dripping oil, observing an experimental result by using an oil scope, and photographing and recording the result.

4. And then positioning the next heterogenic nucleus position according to the 10-time objective lens, dripping oil, observing an experimental result by using an oil lens, and photographing in a visual field to record the result.

5. Repeating the operation until all the heterokaryons are photographed, wherein the number of the heterokaryons is consistent with the result of counting 20 times of the objective lens.

The microscope uses channels as follows:

TABLE 8 excitation and emission wavelengths of fluorophores

Fluorescent group	Excitation wavelength (Excitation filter)	Emission wavelength (Emission filter)
			DAPI	330-385nm	420nm
Alexa Fluor 488	460-495nm	510-550nm
			Cy3	545-580nm	610nm
Cy5	616-649nm	667-751nm
			TET	521nm	536nm
HEX	535nm	556nm
			TAMRA	555nm	576nm
Texas Red	560-580nm	600-650nm

Eighthly, judging and analyzing detection results

1. Positive esophageal cancer cell identification standard

Esophagus cancer cells are enriched on the filter membrane, and the positive judgment standard of the esophagus cancer cells is as follows:

1) has a corresponding target miRNA specific marker, and shows a fluorescent signal point under a corresponding fluorescent channel in the kit.

2) Nuclear DAPI staining positive.

3) The shape of the nucleus of the esophageal cancer cell is irregular, the diameter is larger than 10 mu m, the diameter is obviously larger than the aperture of the filter membrane, and the aperture of the filter membrane is 7 mu m. The size of the white blood cells is similar to the size of the filter membrane pores.

2. Using the above detection method, each sample was detected and observed, wherein "-" or "+" was used to indicate whether fluorescence was detected for DAPI staining of cell nuclei; aiming at the fluorescence signal intensity of the target detection miRNA, respectively reading the number of miRNA fluorescence points of corresponding colors of 10 esophageal cancer cells in each sample, and calculating the average point number, wherein the specific result is as follows:

TABLE 9 sample test results (number of fluorescence signal points)

EXAMPLE 4 stability of the kit

1. Kit stability detection

The invention provides a miRNA detection kit, which selects different numbers of capture probes to form corresponding probe mixed liquor aiming at different target detection miRNAs, thereby realizing the parallel detection of different numbers of miRNAs.

In this example, the stability of the kit of the invention was evaluated by detecting the expression of hsa-miR-25-3p, hsa-miR-373-3p, hsa-miR-16-5p and hsa-miR-208a-3p in 15 samples of three different cell lines (5 samples for each cell line) using the kit of Group1 in the probe set of example 1.

2. About detecting samples

In this embodiment, 3 kinds of esophageal cancer cells of esophageal cancer are used as detection objects, so as to verify the validity and stability (repeatability), and specific cell lines and samples are shown in table 10. The probes described in this example were selected from example 1 and the experimental procedures were as described in reference to example 2.

TABLE 10 cell lines and test specimens

Sample number	Esophageal cancer cell strain	Experimental group
			Samples 16 to 20	TE-1	Group4
Samples 21 to 25	Eca-109	Group5
			Samples 26 to 30	NEC	Group6

3. The result of the detection

Detecting and observing each sample by using the kit, wherein the result of DAPI staining of cell nucleus indicates whether fluorescence is detected by using "-" or "+"; aiming at the fluorescence signal intensity of the target detection miRNA marker, respectively reading the number of miRNA fluorescence points of corresponding colors of 10 esophageal cancer cells in each sample, and calculating the average point number, wherein the specific result is as follows:

TABLE 11 sample test results (number of fluorescence signal points)

As can be seen from the above detection results, on one hand, the detection results of samples of different cell lines are different, and therefore, the present invention is capable of detecting different miRNA expression levels, and is effective; on the other hand, the detection results of the fluorescence point numbers of the miRNAs in 4 such as hsa-miR-25-3p, hsa-miR-373-3p, hsa-miR-16-5p, hsa-miR-208a-3p and the like of 5 samples of the same cell strain are similar (+ -3), and the detection results are specifically shown in Group4 (samples 16-20), Group5 (samples 21-25) or Group6 (samples 26-30), so that the kit has good repeatability; therefore, the kit is effective and reliable in stability, and other kits aiming at different miRNA types still have stable and reliable results, and specific data are omitted.

Example 5 target miRNA number selection

1. Design of kit preparation (selection of number of Capture probes)

In this example, a capture probe was selected for 1, 3, 5, and 7 mirnas, and a first-order signal method probe, a second-order amplification probe, and a third-order signal amplification probe were selected as the signal amplification probes to form a detection kit, and a sample of the same cell line TE-1 was detected, and the detection effect was compared, the specific composition is shown in table 12, the probes were selected from example 1, and the experimental procedure was referred to example 2.

TABLE 12 selection of capture probes for different numbers of target miRNAs (Table number SEQ ID NO.)

2. Detecting and observing each sample by using the kit, wherein the result of DAPI staining of cell nucleus indicates whether fluorescence is detected by using "-" or "+"; aiming at the fluorescence signal intensity of the target detection miRNA marker, respectively reading the number of miRNA fluorescence points of corresponding colors of 10 esophageal cancer cells in each sample, and calculating the average point number, wherein the specific result is as follows:

TABLE 13 sample test results (number of fluorescence signal points)

As can be seen from the comparison of the 4 groups of experiments, the kit can detect target miRNAs with different quantities, can complete detection by using 1, 3, 5 and 7 miRNA capture probes aiming at different miRNA capture probes, and has good specificity and stability.

Other kits aiming at the marker gene and using different quantities of capture probes still have stable and reliable results, and specific data are omitted.

EXAMPLE 6 selection of labeled probes

1. Design of kit preparation (selection of Signal amplification Probe combination)

The invention provides a kit for detecting esophagus cancer related miRNA, wherein the kit selects different signal probe combinations to form corresponding probe mixed liquor aiming at different target detection miRNA, thereby realizing the parallel detection of miRNA.

In this example, the kit composed of the signal amplification probes at different levels provided in example 1 was used to detect the expression of hsa-miR-373-3P, hsa-miR-208a-3P, hsa-miR-138-5P and hsa-miR-21-5P in 5 samples of the same cell line (TE-1), so as to evaluate the applicability of the signal amplification probes P2, P3, P4, P5, P6 and P7 provided by the present invention. The specific kit comprises the following components:

TABLE 14 combination of different Signal amplification probes (SEQ ID NO. in the Table number)

2. Using the above-described kit, each sample was subjected to detection (using the detection method described in example 2) and observation, wherein with respect to DAPI staining of the cell nucleus, "-" or "+" was used to indicate whether fluorescence was detected; aiming at the fluorescence signal intensity of the target detection miRNA marker, respectively reading the number of miRNA fluorescence points of corresponding colors of 10 prostate cancer cells in each sample, and calculating the average point number, wherein the specific result is as follows:

TABLE 15 detection results of different combinations of signal amplification probes

It can be known from the comparison of the 3 groups of experiments that the detection results of the miRNA detected by the kit composed of different signal probe combinations are consistent, except for the miRNA and the amplification probe combination thereof detected in this embodiment, the combination of other miRNA and other signal amplification probes provided by the present invention can also achieve the detection effect of this embodiment, and the specific test result is omitted. Therefore, the signal amplification probe provided by the invention can be matched at will according to actual operation requirements, and can realize miRNA detection of the invention, and the detection results are consistent, which shows that the signal amplification probe provided by the invention has good applicability to the detection of esophagus cancer related miRNA.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

Claims

1. A probe composition, which is capable of detecting esophageal cancer-related markers, wherein the markers are hsa-miR-25-3p, hsa-miR-373-3p, hsa-miR-16-5p, hsa-miR-208a-3p, hsa-miR-518b, hsa-miR-138-5p, hsa-miR-145-5p, hsa-miR-296-5p, hsa-miR-21-5p, hsa-miR-223-3p, hsa-miR-192-5p and hsa-miR-194-5 p;

the probe composition comprises a capture probe: the nucleotide sequence of the capture probe is a P1 sequence, a spacer arm sequence and a P2 sequence from the 5 'end to the 3' end in sequence;

the P1 sequence specifically binds to the marker; the spacer arm sequence is 5-10T;

the P1 sequence is selected from SEQ ID NO 1-12, and the P2 sequence is selected from SEQ ID NO 13-24;

the capture probe is selected from the following sequences:

1, 5T and 13 SEQ ID NO connected in sequence from 5 'end to 3' end;

2, 5T and 14 SEQ ID NO connected in sequence from 5 'end to 3' end;

3, 5T and 15 SEQ ID NO connected in sequence from 5 'end to 3' end;

4, 5T and 16 SEQ ID NO connected in sequence from 5 'end to 3' end;

5, 5T and 17 SEQ ID NO connected in sequence from 5 'end to 3' end;

6, 5T and 18 SEQ ID NO connected in sequence from 5 'end to 3' end;

7, 5T and 19 SEQ ID NO connected in sequence from 5 'end to 3' end;

11, 5T and 23 SEQ ID NO connected in sequence from 5 'end to 3' end;

12, 5T and 24 SEQ ID NO connected in sequence from 5 'end to 3' end.

2. An esophageal cancer-associated marker detection kit comprising the capture probe of claim 1 and a signal amplification composition.

3. The kit of claim 2, wherein the signal amplification composition is:

for any one of the secondary signal amplification probes, the tertiary signal amplification probe specifically binds to the secondary signal amplification probe;

the P3 sequence specifically binds to the P2 sequence;

the P5 sequence specifically binds to the P4 sequence;

the P6 sequence specifically binds to the P7 sequence;

the sequence of the spacer arm is independent from 2 to 20T;

the P8 sequence is 5T.

4. The kit according to claim 3, wherein the sequence of P4 is selected from the group consisting of SEQ ID NO 25-36.

5. The kit according to claim 3, wherein the sequence of P6 is selected from the group consisting of SEQ ID NOS 49-60.

6. The kit of claim 3, wherein the fluorescent group is selected from FAM, TET, JOE, HEX, Cy3, TAMRA, ROX, Texas Red, LC RED640, Cy5, LC RED705 or Alexa Fluor 488, and the modified fluorescent groups on the signal amplification probes for different capture probes are different from each other.