CN107224441B - Application of miR-194-5p - Google Patents

Abstract

The invention relates to research on Proliferative Vitreoretinopathy (PVR), in particular to application of miR-194-5p as a treatment drug for proliferative vitreoretinopathy. The invention proves that miR-194-5p can effectively inhibit epithelial-mesenchymal transition in the main pathological change process of PVR in vivo and in vitro through an in vitro cell model and an animal PVR model, the small molecular compound can be locally applied to eyes through intravitreal cavity injection, other side effects brought by systemic administration are not involved, the small molecular compound is expected to become an effective PVR treatment medicine to assist retinal detachment surgery, and miR-194-5p plays a role by down-regulating Zeb 1.

Description

Application of miR-194-5p

Technical Field

The invention relates to research on Proliferative Vitreoretinopathy (PVR), in particular to application of miR-194-5p as a treatment drug for proliferative vitreoretinopathy.

Background

Proliferative Vitreoretinopathy (PVR) refers to a lesion of membrane hyperplasia and contraction in the vitreous cavity and on the retinal surface after a rhegmatogenous retinal detachment, which can pull and reopen the repaired fissure, causing a new fissure and distorting and masking the macula, while PVR is also the most common cause of retinal detachment surgery failure, reported to occur at a rate of 5.1% to 11.7%, and in the finally failed retinal detachment surgery, 75% of the causes are attributed to PVR, which is thus also the main cause of blindness. The literature reports that only 11-25% of PVR patients can have more than 0.2 of vision after treatment. However, the research on the pathogenesis of PVR is still unclear so far, no effective treatment medicine is available clinically, the treatment is mainly performed through a vitrectomy, but the operation is complicated, the problem cannot be solved completely through the operation, the postoperative disease is easy to recur, the visual function of a patient is gradually reduced or even lost through a plurality of operations, the operation cost is high, and heavy psychological burden and economic loss are brought to the patient and family members, so that the pathogenesis of PVR is deeply researched, a safe and effective targeted medicine treatment method is searched to assist the success of retinal detachment surgery, and the clinical significance and the social value of the treatment of PVR are important.

Among the pathogenesis of proliferative vitreoretinopathy, epithelial-metaplasia (EMT) is considered to be one of the most important mechanisms. EMT refers to the biological process of epithelial cells gradually transformed into cells with mesenchymal phenotype through a specific program, such as the loss of typical epithelial-like morphology, the transformation into fiber-like morphology and the loss of tight connection among cells, the expression of epithelial cell markers such as ZO-1, E-cad and the like is reduced, the expression of mesenchymal cell markers such as a-SMA, FN, Vimentin and the like is increased, the proliferation and migration capacity of cells are enhanced, and the EMT plays an important role in various fibrotic diseases. The development of EMT by RPE cells under the action of various cytokines is an important pathological process of PVR.

The ZEB1 is one of the most important transcription factors of EMT, the ZEB family is one of the E-cassette binding zinc finger proteins in vertebrates, there are two members of ZEB1/TCF8 and ZEB2/SIP1, encoded by ZFHX1a and ZFHX1b, respectively, the major structural feature is that its N-and C-terminal have C2H2 zinc finger cluster and a centrally located Homology Domain (HD), there are also Smad Binding Domains (SBD) and CtBP interaction domains (C-minor binding protein, SBD), thus, ZEB1 and ZEB2 have similar DNA binding specificity, i.e. each zinc finger cluster can independently bind to the core element 5 '-cac-3' of the E cassette of the transcriptional regulatory region promoter of the target gene, regulate transcription of epithelial gene (g) -2, homologous domain, but not bind to the homology domain, but the major transcriptional regulatory region promoter of the target gene, when the transcriptional gene expression of the protein of ZEB2 is strongly inhibited by the expression of ZEB2, the protein of the protein, the protein family of ZEB2, the protein of the protein, the protein of the epithelial-receptor, the protein of the epithelial cell line 2, the protein of the protein, the protein of the.

LKB gene is a conserved cancer suppressor gene, the coding product of which is a serine-threonine kinase, LKB is involved in biological processes such as apoptosis, cell cycle arrest, cell polarity, chromosome recombination and metabolism, and can also regulate initiation, differentiation and metastasis of lung cancer, LKB gene inactivation is probably related to lung cancer cell invasion, metastasis and EMT, LKB silencing or mutation can promote ZEB to induce EMT.ZEB 1 to directly inhibit SEMA3 expression, SEMA3 is one of members of targeting protein family (semaphorin)3, and is also a secreted targeting protein with strong anti-angiogenesis and anti-metastasis activities, ZEB level is in a significant negative relation with SEMA3 expression, ZEB overexpression or inhibition both correspondingly influence SEMA3 expression, ZEMA B causes-1 to be increased by inhibiting SEMA3 expression, HIF-1 also inhibits E-dhbE expression, TGF-protein expression, TGF-chemokine, TGF-kinase expression, TGF-chemokine, TGF-2 receptor activation, TGF-VEGF-beta receptor, TGF-beta-a pro-a, a pro-a protein, a pro-a protein, a pro-a, a pro-beta-a pro-a, a pro-beta-a pro-beta-a, a pro-beta-a, a.

Disclosure of Invention

The invention aims to discuss the mechanism of inhibiting EMT by miR-194-5p and provide the application of miR-194-5p as a PVR treatment drug.

The purpose of the invention can be realized by the following technical scheme:

the miR-194-5p gene number is MIMAT0000460, the sequence is UGUAACAGCAACUCCAUGUGGA, and the sequence is shown in SEQ ID NO. 1.

In the in vivo test, the method of injecting platelet-enriched plasma (PRP) suspension of 8ul of ARPE19 cells (2.4 x 106) into a vitreous cavity is utilized to successfully induce the model, and then injecting miR-194-5p agimir into the vitreous cavity is utilized to treat the model, compared with the PVR of a physiological saline control group, the PVR of H-89 can protect luciferase, and the miR-194-5p luciferase can directly inhibit the PVR through the analysis of the structure of the rat, and the miR-593 can directly inhibit the activity of the rat due to the loss of the ERSD luciferase and the loss of the mouse-5-CD through the experiment of miR-593, and the miR-194-5p can directly inhibit the PVR through the loss of the retina-5-CD-5-CD-.

According to the first aspect of the invention, in an in vitro cell model, miR-194-5p can inhibit an ARPE19 cell from generating a PVR process simulated by an EMT process.

In a second aspect of the invention, there is provided that miR-194-5p is capable of inhibiting the symptoms of PVR and slowing its progression in an in vivo SD rat PVR model.

In a third aspect of the invention, miR-194-5p is disclosed to be capable of directly targeting a 3' untranslated region of Zeb1 and reducing Zeb1 so as to play a role.

In the fourth aspect of the invention, miR-194-5p is used as a basis for PVR treatment medicines, and a means for carrying out PVR treatment by injecting chemically synthesized miR-194-5p agomir in a vitreous cavity is provided, wherein the agomir of miR-194-5p is formed by modifying cholesterol.

The fifth aspect of the invention provides a medicament for treating proliferative vitreoretinopathy, which mainly comprises miR-194-5p or agomir of miR-194-5 p.

The invention discovers the inhibition effect of miR-194-5p on PVR in vitro and in vivo PVR models for the first time, and miR-194-5p can target Zeb1 and inhibit EMT-related gene expression level change, close connection damage and the like caused by EMT and the like in the PVR morbidity process. These results show that the miR-194-5p can be injected in a vitreous cavity for the first time and used as a drug for PVR treatment.

Compared with the prior art, the invention has the following advantages:

at present, PVR treatment is mainly performed by a vitrectomy, but the operation cost is high, and repeated operations are needed; the agomir micromolecule compound of miR-194-5p is low in price and easy to obtain; the miR-194-5p can effectively inhibit the basis of PVR in vivo and in vitro, and meanwhile, the ophthalmic local drug administration is carried out through intravitreal injection, so that the potential risk brought by systemic drug administration can be avoided.

Drawings

FIG. 1: microscopic images of ARPE19 cells transfected with pSuper-miR-194-5p at0, 24 and 48 hours scratch;

FIG. 2: ARPE19 cells from pSuper empty vector were scored for 0, 24 and 48 hours of microscopy;

FIG. 3 shows the result of miR-194-5p inhibiting the change of the EMT-related marker ZO-1 induced by TGF β 1 on the mRNA level through fluorescent quantitative PCR detection;

FIG. 4 shows the result of miR-194-5p inhibiting the change of the TGF β 1-induced EMT related marker ZEB1 in the mRNA level through fluorescent quantitative PCR detection;

FIG. 5 shows the result of the change of miR-194-5p in mRNA level for inhibiting the EMT related marker Vimintin induced by TGF β 1 through fluorescent quantitative PCR detection;

FIG. 6: detecting a map by Western blot;

FIG. 7 shows that the Western blot detection shows that miR-194-5p inhibits the change of an EMT related marker ZEB1 induced by TGF β 1 at the protein level;

FIG. 8 shows that the Western blot detection shows that miR-194-5p inhibits the change of an EMT related marker Nectin-1 induced by TGF β 1 at the protein level;

FIG. 9 shows that the Western blot detection shows that miR-194-5p inhibits the change of an EMT-related marker ZO-1 induced by TGF β 1 at the protein level;

FIG. 10 shows the result of the in situ change of EMT-related markers induced by inhibiting TGF β 1 by miR-194-5 p;

FIG. 11 shows the result of the in situ change of EMT-related markers induced by inhibiting TGF β 1 by miR-194-5 p;

FIG. 12: the luciferase reporter system analyzes the interaction result of miR-194-5p and a 3' -UTR region of Zeb 1;

FIG. 13: immunofluorescence shows that miR-194-5p inhibits the expression result of rat PVR model Zeb 1;

FIG. 14: fundus photos of the rat PVR model with miR-194-59 inhibited.

Detailed Description

The invention is described in detail below with reference to the figures and specific embodiments.

In the following examples, ARPE19 cells were purchased from ATCC and the medium was DMEM: f12 medium, containing 10% serum and 1% P/S. The culture environment is 37 ℃ and 5% CO₂TGF β 1 or TGF β 2 are purchased from R&And D company. H-89 was purchased from Selleck, Inc. and used at a concentration of 5-50 uM. The reverse transcription kit is PrimeScript^TMRT Master Mix (from Takara) and PCR kit SuperReal Premix Plus (SYBR Green) (from Tiangen). The primers used were synthesized by Jinweizhi, Suzhou. Transwell chamber, 8uM pore size (from corning). The cells were ARPE19 cells transfected with pSuper-miR-194-5p and pSuper empty vector, respectively.

Example 1

Verification that overexpression of miR-194-5p can inhibit cell migration induced by TGF β 1

1. Cell treatment: cells were seeded in 96-well plates and 0.1ug each of the transfection empty vectors, psuper and psuper-194-5p, was transfected with Lipo2000 transfection reagent.

2. Scratching: the cells were scratched in a line with a10 uL pipette tip, and then washed 3 times with PBS to remove floating cells. Adding culture medium for further culture.

3. And (3) photographing: photographs were taken under a microscope at the time points of 0 hour, 24 hours and 48 hours of scratching, respectively.

4. And (3) data analysis: and measuring the width of the scratch by using Image J software to obtain width data, and then performing statistical analysis and mapping by using Graphpad Prism software.

Microscopic images of ARPE19 cells transfected with pSuper-miR-194-5p and ARPE19 cells transfected with pSuper empty vector at0 hour, 24 hours and 48 hours are shown in figures 1 and 2, and as can be seen from figures 1 and 2, after being treated by TGF β 1, the proliferation and migration capabilities of the ARPE19 cells transfected with empty vector are obviously enhanced, the scratch distance is reduced after 48 hours, and the proliferation and migration capabilities of the cells transfected with pSuper-miR-194-5p are especially obviously reduced, which shows that the overexpression of 1miR-194-5p can inhibit the migration induced by TGF β 1.

Example 2

The mRNA level change of EMT related markers induced by inhibiting TGF β 1 by miR-194-5p is detected by fluorescent quantitative PCR, wherein ARPE19 cells transfected with pSuper-miR-194-5p and pSuper empty vector and treated by normal control and TGF β are respectively collected in a 1.5ml tube by 1ml of Trizol, total RNA is extracted, and the total RNA is subjected to reverse transcription and real-time quantitative PCR analysis and calculated by a semi-quantitative method.

The method mainly comprises the following steps:

1. to the samples collected by Trizol was added one fifth of 200ul volume of chloroform, mixed vigorously and centrifuged at 12000rpm for 10 minutes at 4 ℃.

2. After centrifugation, the supernatant was transferred to a new centrifuge tube, taking care not to take the middle protein layer, and an equal volume of isopropanol was added.

3.12000 rpm, 4 deg.C for 10 minutes, discarding the supernatant, and washing the precipitate with 75% ethanol 1-2 times.

4. The precipitate was dried at room temperature and dissolved in an appropriate amount of 20ul DEPC water.

Nanodrop quantification and calculation of the volume required for reverse transcription.

RNA reverse transcription:

(1)20ul of the system, 1000ng of RNA, 4ul of Takara reverse transcription reagent supermix was taken and 20ul was supplemented with ddH 2O.

(2) Reverse transcription program: 15 minutes at 37 ℃ and 5 seconds at 85 ℃, and then can be stored in a refrigerator at-20 ℃ for later use.

7. Quantitative PCR

(1) 10-fold dilution of cDNA obtained by reverse transcription of RNA was used as a template, and primers were designed as shown in Table 1.

(2) The expression quantity of the target gene is detected by using a SYBR Green real-time fluorescent quantitative PCR detection kit of Tiangen company, wherein the q-PCR system comprises 20ul of cDNA template, 2ul of cDNA template, 1ul of primer, 10ul of 2X PCR Mix and 7ul of ddH 2O. The PCR amplification conditions were as follows: denaturation at 94 ℃ for 10 min, cycle in (95 ℃ 5sec, 60 ℃ 60sec) for a total of 40 cycles, and collection of the dissolution profile.

(3) Data analysis was performed by 2- △△ Ct method with Gapdh as the internal reference.

The experimental results are shown in FIGS. 3, 4 and 5, and FIGS. 3, 4 and 5 respectively show the change results of miR-194-5p in mRNA level for inhibiting EMT related markers ZO-1, ZEB1 and Vimintin induced by TGF β 1 through fluorescent quantitative PCR detection, which shows that pSuper-miR-194-5p can effectively inhibit the proliferation and migration of ARPE19 cells.

As can be seen from FIGS. 3, 4 and 5, the TGF β 1 treatment increased the zonulin ZO-1 in transfected pSuper-194-5p cells and decreased the mRNA of ZEB1 and Vimintin compared to the empty vector.

TABLE 1 q-primer sequences used in PCR

Gapdh-Forward	AGGTCGGTGTGAACGGATTTG
		Gapdh-Reverse	TGTAGACCATGTAGTTGAGGTCA
ZO-1-Forward	ATTGTCGTCGCATGTAGATCC
		ZO-1-Revrse	GGGTTCATAGGTCAGATTAGGC
a-SMA-Forward	AATGCAGAAGGAGATCACGG
		a-SMA-Reverse	TCCTGTTTGCTGATCCACATC
Nectin-1-Forward	CGGATGGACGTGAAGCTC
		Nectin-1-Reverse	CAGGCTGTAGTTGATGGGTC
Vimentin-Forward	CGTGAATACCAAGACCTGCTC
		Vimentin-Reverse	GGAAAAGTTTGGAAGAGGCAG

Example 3

Western blot detection shows that miR-194-5p inhibits the change of an EMT related marker induced by TGF β 1 in the protein level, and normal control, TGF β -treated ARPE19 cells transfected with pSuper-miR-194-5p and pSuper empty vector are subjected to protein extraction.

1. And (3) protein extraction: the cells were seeded in 6cm cell culture dishes and after the corresponding treatment 150. mu.l of RIPA lysate containing Protease Inhibitor Cocktail was added, the cells were collected by cell scraping into a new EP tube, incubated on ice for 30 min, centrifuged at 10000rpm for 15min at 4 ℃ and the supernatant was gently aspirated into a clean centrifuge tube and stored at-80 ℃ for future use.

2. Determination of protein concentration: the protein is quantified by a BCA (burst cutting amplification) quantification method, which comprises the following steps: preparing a standard protein solution with the concentration of 2 mu g/mu l, and storing at-20 ℃ for later use; preparing working solution according to the number of the standard products and the samples, and fully and uniformly mixing the reagent A and the reagent B according to the volume ratio of 50:1, wherein the reagent A and the reagent B are used for preparation; the total volume of the working solution is (number of standard substance + number of sample to be measured) × (number of complex wells) × (200 μ l of working solution). Adding standard substances into enzyme-labeled wells according to the volume of 0. mu.l, 1. mu.l, 2. mu.l, 4. mu.l, 8. mu.l and 16. mu.l, and adding 200. mu.l of BCA working solution into each well to prepare a standard curve; adding 2 mul of sample to be detected into each hole, adding 200 mul of BCA working solution, and incubating for 30 minutes at 37 ℃; the absorbance at 560nm was measured using a multifunctional microplate reader.

3. Preparation of protein samples: according to the amount and concentration of the protein to be loaded, 5 Xloadingbuffer was added, and after mixing, the mixture was heated at 100 ℃ for 10 minutes to sufficiently denature the protein, centrifuged at 12000rpm at 4 ℃ for 2 minutes to remove the precipitate, and stored at-80 ℃ until use.

4. SDS-PAGE electrophoresis: preparation of separation gel: the 10% separation gel (10ml) was prepared as follows: 3.3ml of 30% polyacrylamide, 2.7ml of ddH2O2.7, 3.8ml of 1M Tris (pH 8.8), 0.1ml of 10% SDS, 0.1ml of 10% ammonium persulfate and 0.004ml of TEMED; adding APS and TEMED before pouring, mixing, and pouring quickly. Slowly adding the prepared separation gel solution into the assembled glass plate by using a liquid transfer gun, wherein the height of the separation gel solution is about 6cm, a position with the height of 1.5cm is reserved for the concentrated gel, and after the separation gel solution is added, slowly adding absolute ethyl alcohol into the top of the gel to promote the gelation, so that the surface of the gel is in a straight line; standing for about 1 hr until the gel is completely solidified, when there is a fold line between the absolute ethyl alcohol and the gel, the gel is solidified, pouring off the absolute ethyl alcohol on the gel, and sucking with filter paper. A5% concentrated gum (4ml) was prepared as follows: 0.67ml of 30% polyacrylamide, 0.7 ml of ddH2O2.7ml of 1M Tris (pH 6.8), 0.04ml of 10% SDS, 0.04ml of 10% ammonium persulfate and 0.004ml of TEMED0.004ml; adding APS and TEMED before pouring, mixing, and pouring quickly. The prepared concentrated gel solution was slowly added to the upper layer of the separation gel by using a pipette until the edge of the glass plate, then a comb was carefully inserted, care was taken not to generate a bubble, the gel was left for about 1 hour, and after the gel was extracted, the comb was removed to prepare for electrophoresis. Adding the prepared protein sample and protein marker molecules into the sample adding hole to prevent bubbles from generating, and starting electrophoresis after filling the groove with an electrophoresis solution by using a Bio-Rad electrophoresis apparatus under the electrophoresis conditions that: the voltage of 80V is changed to 120V for 30 minutes, and the voltage is changed to 1 hour and 30 minutes or so. Electrophoresis was stopped until bromophenol blue just runs out of the bottom of the separation gel.

5. Film transfer: after SDS-PAGE gel electrophoresis is finished, prying the glass plate, carefully separating out gel, cutting off the part of the concentrated gel, reserving the separation gel, and soaking in deionized water; cutting a PVDF membrane with the size similar to that of the gel, and soaking the PVDF membrane in anhydrous methanol for 2 minutes; putting the cut gel, the filter paper and the PVDF membrane soaked by the anhydrous methanol in advance into a membrane transferring balance solution for balancing for 10 minutes; a Bio-Rad rotary film system is adopted, and the sequence from a black surface to a white surface sequentially comprises the following steps in a sandwich mode: the method comprises the following steps of aligning filter paper, gel and PVDF (polyvinylidene fluoride) membrane to completely remove internal bubbles, and then putting the filter paper, the gel and the PVDF membrane into a membrane transferring instrument filled with membrane transferring liquid under the membrane transferring condition of 300 milliamperes for 2 hours; the film transfer tank was placed in an ice bath. After the film transfer is finished, the PVDF film can be transferred on the reference protein Marker to be used as a mark for successful film transfer, or the film can be dyed by 1 XLichun red dye solution, and then the protein on the film can be seen by washing off the dye solution which is not dyed.

6. Immune hybridization reaction: ponceau was washed off with 1 XPBST, and 5% BSA solution was added and blocked for 1 hour at room temperature. Primary antibody diluted with PBST was added, overnight at 4 ℃; 1 x PBST membrane washing 3 times, each time 10. PBST diluted HRP labeled secondary antibody was added for 1 hour at room temperature. 1 x PBST membrane washing 3 times, each time 10. ECL chemiluminescence collection results were obtained with Gapdh as a control internal control.

7. Data statistical analysis: the grey scale analysis of the western bands was performed with Image J software, then compared to the corresponding Gapdh, and then statistically analyzed and plotted with Graphpad Prism software.

The results of experiments on the protein level change of EMT-related markers induced by inhibiting TGF β 1 by miR-194-5p are shown in FIGS. 6, 7, 8 and 9, and it can be seen from FIGS. 6, 7, 8 and 9 that after TGF β 1 treatment, the expression of zon-1 is reduced, while the expression of the EMT-related gene ZEB1 is obviously increased, and in the miR-194-5p group ZEB1 is obviously reduced, Zo-1 is increased, and the protein level of Nectin-1 is not changed.

Example 4

Immunofluorescence shows that miR-194-5p inhibits the change of the EMT related marker induced by TGF β 1 in cell in situ.

1. Cell treatment: inoculating the cells on a slide preset in a culture dish, and taking out the slide after corresponding treatment;

2. fixing: fixing with 4% paraformaldehyde for 10 min, washing with PBS for 3 times, each for 5 min;

3. membrane permeation: 0.1% triton X-100 membrane penetration for 10 minutes, PBS washing 3 times, each time for 5 minutes;

4. and (3) sealing: 5% horse serum was blocked for 1 hour at room temperature;

5. a first antibody: adding primary antibody diluted by 5% horse serum in a room, placing in a wet box to prevent drying, and incubating overnight at 4 ℃;

6. secondary antibody: PBS wash 3 times, each for 5 minutes; adding a luciferase-labeled secondary antibody which is diluted by 5% horse serum and is from the same genus with the primary antibody, placing the secondary antibody in a wet box, incubating the secondary antibody at the temperature of 37 ℃ in a dark place, and washing the secondary antibody for 3 times by PBS (5 minutes each time);

7. dyeing the core: nuclei were stained with 0.5. mu.g/ml DAPI for 3 min, washed 3 times with PBS, 5min each;

8. sealing: and sealing the sheet by using a fluorescent sealing agent.

9. And (3) photographing: the photographs were taken with a confocal laser microscope under 600 Xmagnification in an oil lens.

The results of experiments on the in-situ change of EMT related markers induced by inhibiting TGF β 1 by miR-194-5p are shown in FIG. 10, wherein Nectin-1, occludin and Zo-1 are positioned on cell membranes, after treatment by TGF β 1, tight junctions between ARPE19 cells transfected with empty vectors are broken, the staining of cell membranes Zo-1, Nectin is discontinuous, and the staining of Zo-1, Nectin and occludin at the membrane positioning is relatively complete and continuous by ARPE19 transfected with miR-194-5p, as shown in FIG. 11, the staining of the tight junction protein ZO-1 in FIGS. 10 and 11 shows that zeb1 is as nuclei, and the breakage of the tight junctions of cells by TGF β 1 is protected by ARPE19 transfected with miR-194-5p, so that zeb1 in the nuclei is reduced.

Example 5

Interaction of miR-194-5p on Zeb13-UTR

miRNA-194-5p plasmid and psicheck-2 plasmid (containing Zeb 13' -UTR region) are transferred into HEK293T cell line, luciferase activity is detected, and a luciferase activity detection kit is purchased from Promega.

When the plasmid is transfected, lipofectamine 2000 liposome of Invitrogen company is adopted, and the main steps are as follows:

1. cells were plated in six well plates at a density of about 50% on the previous day.

2. Before transfection, the culture medium was changed to serum-free and antibiotic-free DMEM, two sterilized centrifuge tubes were added with 250. mu.L of each serum-free and antibiotic-free culture medium, 5. mu.L of each liposome and 4. mu.g of each plasmid (2 ug of miR-194-5p and psicheck2 plasmid) were added, and the mixture was mixed and left to stand for 5 minutes.

3. Adding the culture medium containing the liposome into the culture medium containing the plasmid, uniformly mixing, and uniformly dripping into cells after 30 minutes.

After 4.6 hours, the culture medium is changed into a normal high-sugar DMEM medium to continue culturing, transfection is carried out for 36 hours, and the reporter gene is detected by cracking.

The results are shown in FIG. 12. The interaction of miR-194-5p over-expressed with the 3' -UTR of Zeb1 is supported by reporter gene analysis. As can be seen in FIG. 12, overexpression of MiRNA-194-5p reduced luciferase activity in HEK 293.

Example 6 Ocular fundus examination of miR-194-5p inhibition of intervention in PVR rats in intravitreal injection PVR modeling

1. Rat preparation: SD rats at 6-8W were purchased from Silik, Inc., and housed at the animal center, college university. 160-180 g, and randomly divided into three groups, namely a PBS control group, a model group (ARPE19+ PRP) and a treatment group (ARPE19+ PRP + H89).

2. Cell preparation: in vitro cultured ARPE19 cells were taken, between P10-P15, and the cell concentration was adjusted to give a cell count of 2.4 × 106 per eye, divided into two EP tubes, each of which was a model combination treatment group, and placed on ice until use.

3. Preparation of platelet-rich plasma (PRP): rats were fixed in their cages and the rat tails were exposed outside the cages. Wiping rat tail with alcohol cotton ball before puncture, connecting No. 5 scalp needle with 1ml injector, and flushing the needle and injector with heparin sodium diluent; holding the needle with the right hand, holding the tail of the mouse with the left thumb on the upper side and the index finger on the lower side, slightly bending the tail of the mouse to enable the direction of the blood vessel at the needle insertion position to be parallel to the direction of the needle head, continuously inserting the needle 3-5mm after the needle head is parallel to the mouse tail and puncturing the epidermis, enabling the needle head to enter the tail vein to see blood return, holding the mouse tail with the left hand, pushing and pulling a 1ml syringe piston with the right hand, and producing negative pressure to; after the blood sampling is finished, the needle eye part is pressed for 30s by using a cotton ball absorbent, and the rat is released after hemostasis is determined. Transferring the obtained blood into blood collecting tube containing 3.8% sodium citrate, centrifuging at low temperature for 1000g for 1min, and collecting the supernatant as PRP.

4. Preparation of ARPE19+ PRP suspension: according to the calculated cell amount and injection amount, PRP is respectively used for resuspending ARPE19 cells, the model group is ARPE19+ PRP, and the treatment group is ARPE19+ PRP + miR-194-5 p; the amount of miR-194-5p is 100-50 uM.

5. Injecting in a vitreous cavity: rats were anesthetized by intraperitoneal injection of 2% sodium pentobarbital (1mL/400g body weight) and muscle relaxation by 1 × narcolepsy (0.1mL/200g), followed by administration of one drop of 0.5% tropicamide mydriasis (Wuxi ShanheGroup, Jiangsu, China) and one drop of 0.4% oxybuprocaine hydrochloride for surface anesthesia (eisai co Ltd, Tokyo, Japan). Under a stereomicroscope, a small hole is vertically needled from the corneal limbus by using a 1ml syringe, and then a corresponding liquid is injected into the vitreous cavity from the hole by using a syringe needle. The injection volume for each eye was 8 ul.

The data are shown in fig. 14, control is a normal control showing clear vascular structure of the fundus, partial bending of blood vessels occurs in fundus photography in the PVR group, the model group causes obvious damage to retinal structure and anterior membrane formation, and the method of combined injection of ARPE19 cells and platelet-rich plasma is demonstrated to be capable of successfully inducing the PVR model. The miR-194-5p treatment group shows that the fundus vascular structure is obviously better than that of the model group.

Example 7

Zeb1 expression of miR-194-5p on PVR rat model

Preparation of frozen section of eyeball

1. Preparing eyeballs: collecting eyeball samples at different time points of the SD rat after PVR modeling, and carefully removing the eyeballs after the SD rat is dislocated and dies, and paying attention to the retention of optic nerves;

2. fixing: fixing the mixture in 4% paraformaldehyde overnight;

3. and (3) dissection: dissecting eyeball along the upper edge of the corneosclera edge under dissecting microscope, carefully removing cornea, iris and crystalline lens to form complete cup, and carefully operating to prevent and treat retinal detachment;

4. and (3) dehydrating: dehydrating with 30% sucrose overnight;

5. embedding: embedding with tissue embedding solution OCT at 4 deg.C, and balancing overnight;

6. liquid nitrogen quick freezing: the eyeball was snap frozen with liquid nitrogen, and the location of the eyeball was centered as vertically as possible prior to freezing. Frozen samples were stored at-80 ℃.

7. Slicing: the sections were continuously sliced at a thickness of 8 μm using an ice cutter, and the optic papilla was sliced. The slices were stored at-80 ℃ and dried before use.

Immunofluorescence of frozen retinal sections

1. Preparing a section: a frozen section sample of the eyeball obtained in example 7 was subjected to immunofluorescence staining test.

2. Baking slices: baking at 50 deg.C for half an hour.

3. Fixing: 4% PFA was fixed for 10 min and washed three times with PBS for 5min each.

4. Membrane permeation: the membrane was permeabilized with 0.25% Triton-X100 for 15min and washed 3 times with PBS, 5min each.

5. And (3) sealing: 5% horse serum was blocked for 1 hour at room temperature;

6. a first antibody: the corresponding primary antibody diluted with 5% horse serum was added, placed in a wet box to prevent drying, and incubated overnight at 4 ℃.

7. Secondary antibody: washing with PBS for 5min for 3 times; luciferase-labeled secondary antibody from the same genus and primary antibody diluted with 5% horse serum were added, and the mixture was incubated in a wet box for 1 hour at 37 ℃ in the absence of light.

DAPI staining of nuclei: washing with PBS for 5min for 3 times; nuclei were stained with 0.5. mu.g/ml DAPI for 1min and washed 3 times with PBS for 5min each.

9. Sealing: and sealing the sheet by using a fluorescent sealing agent.

10. Photographing and observing: and taking pictures under a microscope for observation.

As shown in FIG. 13, the photograph is a 2W immunofluorescence photograph of frozen sections of eyeballs, wherein blue is DPAI staining nuclei, and highlight white is an EMT marker Zeb1, and after miR-194-5p treatment, the destruction of eyeball structures is reduced, and the expression level of Zeb1 is reduced, so that the treatment effect of miR-194-5p on PVR is further illustrated.

The embodiments described above are described to facilitate an understanding and use of the invention by those skilled in the art. It will be readily apparent to those skilled in the art that various modifications to these embodiments may be made, and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above embodiments, and those skilled in the art should make improvements and modifications within the scope of the present invention based on the disclosure of the present invention.

<110> university of Tongji

Application of <120> miR-194-5p

<160>11

<210>1

<211>22

<212>DNA

<213> Artificial sequence

<400>1

UGUAACAGCA ACUCCAUGUG GA　　22；

<210>2

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>Gapdh-Forward

<400>2

AGGTCGGTGT GAACGGATTT G 21；

<210>3

<211>23

<212>DNA

<213> Artificial sequence

<220>

<221>Gapdh-Reverse

<400>3

TGTAGACCAT GTAGTTGAGG TCA 23；

<210>4

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>ZO-1-Forward

<400>4

ATTGTCGTCG CATGTAGATC C 21；

<210>5

<211>22

<212>DNA

<213> Artificial sequence

<220>

<221>ZO-1-Revrse

<400>5

GGGTTCATAG GTCAGATTAG GC 22；

<210>6

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>a-SMA-Forward

<400>6

AATGCAGAAG GAGATCACGG 20；

<210>7

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>a-SMA-Reverse

<400>7

TCCTGTTTGC TGATCCACAT C 21；

<210>8

<211>18

<212>DNA

<213> Artificial sequence

<220>

<221>Nectin-1-Forward

<400>8

CGGATGGACG TGAAGCTC 18；

<210>9

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>Nectin-1-Reverse

<400>9

CAGGCTGTAG TTGATGGGTC 20；

<210>10

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>Vimentin-Forward

<400>10

CGTGAATACC AAGACCTGCT C 21；

<210>11

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>Vimentin-Reverse

<400>11

GGAAAAGTTT GGAAGAGGCA G 21；

Claims (9)

1. The application of miR-194-5p in preparing a medicament for treating proliferative vitreoretinopathy.
2. 2. The use of claim 1, wherein the miR-194-5p is used for preparing a medicament for inhibiting PVR.
3. 3. The use of claim 1, wherein the miR-194-5p is used for preparing a medicament for reducing the expression of EMT-associated genes and simultaneously increasing the expression of epithelial-associated genes.
4. 4. The use according to claim 3, wherein said EMT-associated genes comprise a-SMA and ZEB 1.
5. 5. The use of claim 3, wherein the epithelium-associated genes comprise a-SMA and ZO-1.
6. 6. The use of claim 1, wherein the miR-194-5p is used for the preparation of a medicament for protecting the disruption of tight cell junctions caused by EMT.
7. 7. The use according to claim 1, wherein the miR-194-5p is used for the preparation of a medicament for protecting EMT-induced remodeling of the tissue cytoskeleton.
8. 8. The use of claim 1, wherein the gene sequence of miR-194-5p is represented by SEQ id No. 1.
9. 9. The use of claim 1, wherein said miR-194-5p is present as an agomir of chemically synthesized miR-194-5 p.

Images