CN106636136A - NtHMA2 gene mutant and application - Google Patents
NtHMA2 gene mutant and application Download PDFInfo
- Publication number
- CN106636136A CN106636136A CN201710033488.1A CN201710033488A CN106636136A CN 106636136 A CN106636136 A CN 106636136A CN 201710033488 A CN201710033488 A CN 201710033488A CN 106636136 A CN106636136 A CN 106636136A
- Authority
- CN
- China
- Prior art keywords
- ser
- ala
- lys
- val
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses an NtHMA2 gene mutant. The mutation of one piece of nucleotide happens in an NtHMA2 gene, a non-mutation NtHMA2 sequence comprises a SEQ ID NO:1 nucleotide sequence, wherein C mutation on a 520 site is T, a termination codon is formed, and the gene is terminated in advance. Compared with a tobacco leaf which contains a SEQ ID NO:1 sequence, the tobacco which contains a mutation sequence is characterized in that a cadmium content is lowered by about 40%, the contents of zinc, iron, lead, chromium, nickel and the like are lowered by about 30%, and an arsenic content is lowered by about 10%.
Description
Technical field
The invention belongs to gene engineering field, and in particular to a kind ofNtHMA2Gene mutation body and application.
Background technology
Cadmium (Cd), arsenic (As), chromium (Cr), hydrargyrum (Hg) and lead (Pb) etc. are generally acknowledged to plant and harm
Than larger heavy metal element, plant essential trace element zinc (Zn), nickel (Ni), copper (Cu) if etc. excessive also can produce
Raw harm.So, increasingly cause the attention of scientific research personnel with regard to crop heavy metal pollution and its research for reducing method.Nicotiana tabacum L.
(Nicotiana tabacum)It is important industrial crops, is Solanaceae annual herb plant.In recent years with regard to a huge sum of money in Nicotiana tabacum L.
The research of category is increasingly becoming a focus of Nicotiana tabacum L. harm reduction research.
Heavy metal can have a negative impact to cigarette quality.Nicotine content is an important indicator for weighing quality of tobacco,
The raising that nicotine is conducive to quality of tobacco is improved within the specific limits, and Cd pollutions can reduce nicotine content of tobacco leaves, and possible cause is
Root synthesizes nicotinic pathway or nicotine is obstructed to top transport process.In addition, soluble sugar is extremely sensitive to Cd, Pb in Nicotiana tabacum L.,
Slight pollution may result in its content and be decreased obviously, and this is likely due to heavy metal and destroys tobacco chloroplast, and photosynthesis are received
What resistance caused.Heavy metal can cause Nicotiana tabacum L. sugar alkali ratio and nitrogen base than raising, and chemical composition composition is unbalance, and quality is affected.
Harm of the heavy metal to human body is huge, and such as excessive cadmium may cause damage in human body to blood vessel;Other cadmium
Element is inhibited to intestinal absorption ferrum, can also disturb the metabolic process of the trace element such as cobalt, copper, zinc, cause lung, kidney,
The human body organ injury such as liver, may finally cause carcinogenic, teratogenesis and mutagenesis etc. to act on.Arsenic can induce numerous disease, such as anxious
Property arseniasiss central nervous system disorder can be caused to cause total numbness, respiratory tract and Alimentary tract disease even quick death;Slowly
Property arseniasiss cause the skins such as nerve problems, malaise, loss of appetite, nausea and cutaneous pigmentation and keratosiss
Pathological changes etc., and the diseases such as pulmonary carcinoma, skin carcinoma and bladder cancer can be caused.Zinc element be human body important trace element it
One, growth promoter, intelligence, the immunologic function even vision to human body has vital effect.But the zinc in human body
It is not The more the better.The zinc of human body excess intake, easily changes into zinc chloride in gastric juice, there is stronger corrosivity to gastric mucosa,
Gastric mucosa congestion, even edema, bleeding can be caused.Excessive blood zinc can suppress the phagocytic function of leukocyte, under being resistance of human body
Drop, easily by courses of infection.Excessive zinc can also affect the absorption and metabolism of human body other inorganic salts, such as affect the absorption of ferrum, make
To be damaged into cu zn ratio too high for iron metabolism in liver;Cholesterol metabolism is affected, hypercholesterolemia etc. is formed.Nickel and its esters
Toxicity it is relatively low, but because itself has chemical-biological activities, therefore can activate or suppress a series of enzyme(Arginase, carboxylic
Change enzyme, acid phosphatase and open up decarboxylase)And play its toxicity.Nickel can cause contact dermatitis.It is directly entered the nickel salt of blood
Toxicity is higher, and colloid nickel or Nickel dichloride. toxicity are larger, and central can be caused to circulate and disordered breathing, goes out cardiac muscle, brain, lung and kidney
Existing edema, bleeding and degeneration.
Nicotiana tabacum L. is the important industrial crops of China, and heavy metal pollution not only affects Nicotiana tabacum L. growth promoter itself, to smoker
Health also have serious threat.Harm reduction is always an important directions of Nicotiana tabacum L. research work, wherein reducing heavy metal
Content is an important public relations goal.
The content of the invention
The first object of the present invention is to provide a kind ofNtHMA2The EMS mutants of gene;Second purpose is to provide institute
StateNtHMA2The application of gene mutation body.
The first object of the present invention is achieved in that and wild-type tobaccoNtHMA2Gene has as in sequence table
SEQ ID No:Nucleotide sequence shown in 1 is compared, what mutant containedNtHMA2The C that gene order is 520 sports T, shape
Into termination codon, the gene is set to terminate in advance.
DescribedNtHMA2The preparation method of the EMS mutants of gene includes EMS mutation and TILLING screening mutants.
EMS mutation tobacco seeds:
A :Using white water treatment tobacco seed, then rotating centrifugal and it is filtered dry;
B :Seed is rinsed, remove bleaching water, seed is not affected by bleach chemical composition, then rotated from
The heart is filtered dry;
C :Seed is placed in the deionized water at a temperature of 10 DEG C ~ 30 DEG C and is soaked 10 ~ 15 hours, tobacco seed Germination,
With the uniform mutagenic treatment of sharp seed, then carry out rotating centrifugal and be filtered dry;
D :Seed is placed on into 0.5% EMS(Ethylmethane sulfonate)10 ~ 15 hours of immersion treatment in mutation agent solution, then
Carry out rotating centrifugal to be filtered dry;
E :Seed is placed in rinsing aid solution and is rinsed, then deionized water is rinsed, and 5 ~ 8 this processes is repeated, then
Buchner funnel filter paper filtration drying.
The mutant of TILLING screening nucleotide changes
A :Seed after mutagenic treatment(M1 generations)Sowing and land for growing field crops, individual plant bagging selfing sowing obtains M2 generations, and each M1 is for individual plant
The M2 of results sows 1 seed for seed.
B:Take M2 and extract mutant material blade DNA using QIAGEN DNA extraction kits for mutant single-strain blade.
C:Sample concentration determines and builds pond
By sample big minispread in order.Take respectively on the passage Tecan infinite M200 instruments of 2ul DNA samples 16
Carry out concentration mensuration.All of sample concentration is diluted to into 40ng/ul, 8 times of DNA ponds is made for TILLING analyses.
D:Designed using Primer3NtHMA2Gene TILLING analyzes primer, HMA2-F:
AATATAGAGATGGCCAATGAAGGT and HMA2-R:CTAAAATTTATATGACCAAGTACTT, amplification length is
1400bp or so.
E:TILLING analyzes M2 for mutant, screens the individual plant of coding mutation, and carries out sequence verification, obtains one
Mutant, the C of 520 of its CDS sports T, forms termination codon, the gene is terminated in advance.
F:M3 for screening mutant mutational site homozygosis plant, selfing sowing.
G:Cd uptake test is carried out to Mutants homozygous, specially in cigarette strain squaring period, by 100 mol CdCL2Solution
500mL is poured in cigarette strain root.Blade is taken after 5 days, complete drying, detect content of beary metal.
H:Nicotiana tabacum L. containing mutant nucleotide sequence is compared containing SEQ ID NO:It is left that the tobacco leaf cadmium content of 1 sequence reduces by 40%
The right side, zinc, ferrum, lead, chromium, nickel equal size reduce by 30% or so, and arsenic content reduces by 10% or so.
The second object of the present invention is achieved in thatNtHMA2Gene mutation body can make Nicotiana tabacum L. cadmium content reduce by 30 ~
50%, zinc, ferrum, lead, chromium, nickel equal size reduce by 20 ~ 40% or so, and arsenic content reduces by 5 ~ 15% or so.I.e. with describedNtHMA2Base
Because mutant obtains the Nicotiana tabacum L. of low-heavy metal content.
Description of the drawings
Fig. 1 is that mutant mutational site is sequenced peak figure;
Fig. 2 is the present inventionNtHMA2Mutant and the blade cadmium content contrast schematic diagram of cloud and mist 87;
Fig. 3 is the present inventionNtHMA2Mutant and the blade Zn content contrast schematic diagram of cloud and mist 87;
Fig. 4 is the present inventionNtHMA2Mutant and the blade iron content balance schematic diagram of cloud and mist 87;
Fig. 5 is the present inventionNtHMA2Mutant and the blade arsenic content balance schematic diagram of cloud and mist 87;
Fig. 6 is the present inventionNtHMA2Mutant and the blade chromium content contrast schematic diagram of cloud and mist 87;
Fig. 7 is the present inventionNtHMA2Mutant and the blade nickel content contrast schematic diagram of cloud and mist 87.
Specific embodiment
With reference to embodiment and accompanying drawing, the present invention is further illustrated, but never in any form to the present invention in addition
Limit, based on present invention teach that any conversion for being made or replacement, belong to protection scope of the present invention.
NtHMA2 gene mutation bodies of the present invention, with wild-type tobaccoNtHMA2Gene has as in sequence table
SEQ ID No:Nucleotide sequence shown in 1 is compared, what mutant containedNtHMA2The C that gene order is 520 sports T, shape
Into termination codon, the gene is set to terminate in advance.
NtHMA2The aminoacid sequence of gene code such as SEQ ID No:Shown in 2;
NtHMA2The nucleotide sequence of gene mutation body such as SEQ ID No:Shown in 3;
NtHMA2The aminoacid sequence such as SEQ ID No of gene mutation body coding:Shown in 4;
DescribedNtHMA2The preparation method of the EMS mutants of gene includes EMS mutation and TILLING screening mutants.
EMS mutation tobacco seeds:
A :Using white water treatment tobacco seed, then rotating centrifugal and it is filtered dry;
B :Seed is rinsed, remove bleaching water, seed is not affected by bleach chemical composition, then rotated from
The heart is filtered dry;
C :Seed is placed in the deionized water at a temperature of 10 DEG C ~ 30 DEG C and is soaked 10 ~ 15 hours, tobacco seed Germination,
With the uniform mutagenic treatment of sharp seed, then carry out rotating centrifugal and be filtered dry;
D :Seed is placed on into 0.5% EMS(Ethylmethane sulfonate)10 ~ 15 hours of immersion treatment in mutation agent solution, then
Carry out rotating centrifugal to be filtered dry;
E :Seed is placed in rinsing aid solution and is rinsed, then deionized water is rinsed, and 5 ~ 8 this processes is repeated, then
Buchner funnel filter paper filtration drying.
The mutant of TILLING screening nucleotide changes
A :Seed after mutagenic treatment(M1 generations)Sowing and land for growing field crops, individual plant bagging selfing sowing obtains M2 generations, and each M1 is for individual plant
The M2 of results sows 1 seed for seed.
B:Take M2 and extract mutant material blade DNA using QIAGEN DNA extraction kits for mutant single-strain blade.
C:Sample concentration determines and builds pond
By sample big minispread in order.Take respectively on the passage Tecan infinite M200 instruments of 2ul DNA samples 16
Carry out concentration mensuration.All of sample concentration is diluted to into 40ng/ul, 8 times of DNA ponds is made for TILLING analyses.
D:Designed using Primer3NtHMA2Gene TILLING analyzes primer,
HMA2-F:AATATAGAGATGGCCAATGAAGGT and
HMA2-R:CTAAAATTTATATGACCAAGTACTT, amplification length is 1400bp or so.
E:TILLING analyzes M2 for mutant, screens the individual plant of coding mutation, and carries out sequence verification, obtains one
Mutant, the C of 520 of its CDS sports T, forms termination codon, the gene is terminated in advance.
F:M3 for screening mutant mutational site homozygosis plant, selfing sowing.
G:Cd uptake test is carried out to Mutants homozygous, specially in cigarette strain squaring period, by 100 mol CdCL2Solution
500mL is poured in cigarette strain root.Blade is taken after 5 days, complete drying, detect content of beary metal.
H:Nicotiana tabacum L. containing mutant nucleotide sequence is compared containing SEQ ID NO:It is left that the tobacco leaf cadmium content of 1 sequence reduces by 40%
The right side, zinc, ferrum, lead, chromium, nickel equal size reduce by 30% or so, and arsenic content reduces by 10% or so.
Application of the present invention isNtHMA2Gene mutation body can make Nicotiana tabacum L. cadmium content reduce by 30 ~ 50% or so, zinc,
Ferrum, lead, chromium, nickel equal size reduce by 20 ~ 40% or so, and arsenic content reduces by 5 ~ 15% or so.I.e. with describedNtHMA2Gene mutation
Body obtains the Nicotiana tabacum L. of low-heavy metal content.
Below the present invention is described further with being embodied as case:
DescribedNtHMA2The preparation method of mutant, it is unmutatedNtHMA2SEQ in the nucleotide sequence of mutant such as sequence table
ID No:Shown in 1, the C of the nucleotide sequence 520 of mutant sports T, and concrete preparation method is comprised the following steps:
(1)From 50% white water treatment cloud and mist, 87 seed 6 minutes, centrifugation was filtered dry;
(2)Rinsing 1 minute is carried out to seed using deionization, centrifugation is filtered dry removal bleaching water constituent;
(3)Room temperature condition, deionized water impregnated tobacco seed 10-12 hours, centrifugation is filtered dry;
(4)Room temperature condition, 0.50%EMS ethylmethane sulfonates process tobacco seed 12 hours, and centrifugation is filtered dry;
(5)Add deionized water to rinse 1 minute, centrifugation is filtered dry, rinsing 8 times are repeated altogether.Then buchner funnel filter paper is crossed and is filtered dry
It is dry.
(6)Seed after mutagenic treatment(M1 generations)Sowing and land for growing field crops, individual plant bagging selfing sowing obtains M2 generations, each M1 generation
The M2 that individual plant is harvested sows 1 seed for seed, and 1842 M2 are obtained altogether for individual plant.
(7)Take M2 and extract mutant material blade using QIAGEN DNA extraction kits for mutant single-strain blade
DNA.Comprise the following steps that:By sample liquid nitrogen grinding, and collected with 1.5ml centrifuge tubes;The AP1 solution of 400ul is added, 4ul's
RNase is mixed;Sample is put into 65 DEG C of water-bath water-bath 10min, period shakes up 3 times;Add 130ul P3 molten toward sample
Liquid, ice bath 5mim;High speed centrifugation, 13200rpm, 5min;Take upper liquid and pour purple Filter column, 13200rpm, 2min centrifugation into;
Filtrate is proceeded to into new 1.5mL centrifuge tubes and adds the AW1 solution of 675ul to mix;Mixing sample solution point is proceeded to for 2 times yellowish
Chromogenic filter post simultaneously carries out 10000rpm, 1min centrifugations, reject filtrate;Faint yellow Filter column is put in new 2ml centrifuge tubes simultaneously
Add the AW2 solution of 500ul, carry out 10000rpm, filtrate is abandoned in 1min centrifugations (this step is repeated twice);Again reject filtrate
Faint yellow Filter column dallied(10000rpm, 1min), the faint yellow Filter column for having dallied is put into into new 1.5ml centrifugations
Add in pipe after 50ul AE solution and stand 5min, being put into centrifuge carries out 10000rpm, and 1min centrifugations remove yellowish chromogenic filter
Post, is put into 4 DEG C of Refrigerator stores.
(8)Sample concentration determines and builds pond
By sample big minispread in order.Take respectively on the passage Tecan infinite M200 instruments of 2ul DNA samples 16
Carry out concentration mensuration.All of sample concentration is diluted to into 40ng/ul, 8 times of DNA ponds is made for TILLING analyses.
(9)Designed using Primer3NtHMA2Gene TILLING analyzes primer,
HMA2-F:AATATAGAGATGGCCAATGAAGGT and
HMA2-R:CTAAAATTTATATGACCAAGTACTT, amplification length is 1400bp or so.
(10)TILLING analyzes M2 for mutant, and amplification system is:1.0 10 × buffer of l, 0.8 l dNTP
(2.5mM), 0.16 l HMA2-F primer (10 M), 0.16 l HMA2-R primer (10uM), 6.78 l
H2O, 1.0 l DNA profilings (20ng/ul).Response procedures be 95 DEG C of 3min, 94 DEG C of 30s, 62 DEG C of 30s, -1 DEG C/follow
Ring, 72 DEG C of 1min, 7 circulations;94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, 40 circulations, 72 DEG C of 5min;99℃ 10min;70
DEG C 20s, -0.3 DEG C/circulation, 70 circulations, 4 DEG C of preservations.Amplified production is analyzed by capillary electrophoresis.
(11)The individual plant of the coding mutation for filtering out, carries out sequence verification, obtains a mutant, itsNtHMA2Gene
The C of 520 of CDS sports T, forms termination codon, the gene is terminated in advance.
(12)Through the plant of sequencing screening mutational site homozygosis in M3 is for mutant(Fig. 1), selfing sowing.
NtHMA2Mutant reduces the method for Nicotiana tabacum L. content of beary metal and comprises the following steps:
(1)Cd uptake test is carried out to Mutants homozygous, specially in chamber planting Mutants homozygous and wild type control, cigarette strain
Squaring period, by 100 mol CdCL2Solution 500mL is poured in cigarette strain root, and after 5 days blade is taken, and complete drying.Using tobacco business
The method detection Nicotiana tabacum L. content of beary metal of standard YC/T380-2010.
(2)Nicotiana tabacum L. containing mutant nucleotide sequence is compared containing SEQ ID NO:It is left that the tobacco leaf cadmium content of 1 sequence reduces by 40%
The right side, zinc, ferrum, lead, chromium, nickel equal size reduce by 30% or so, and arsenic content reduces by 10% or so(Table 1, Fig. 2 ~ Fig. 7).
The Nicotiana tabacum L. content of beary metal of table 1
SEQUENCE LISTING
<110>Yunnan Academy of Tobacco Agricultural Science
<120>A kind of NtHMA2 mutants and application
<130> 2017
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 4212
<212> DNA
<213>NtHMA2 gene nucleotides
<400> 1
atggtggaaa gtgaaaaaat gaatgaaaca aagaagttga gcaagagcta ttttgatgtt 60
ttgggaattt gctgtacttc agaagttgtt ctagttgaaa aaattctcaa gaatcttgaa 120
ggggttaaag aggtttcagt aattgtcaca acaaagactg tcattgttat tcatgattct 180
cttctcattt ctccgcaaca aattgttaaa gcattgaatc aagcaagatt agaagcaagc 240
ataagagtga aaggagagaa aaactaccaa aagaaatggc caagtccatt tgcaattggc 300
agtggaatat tgcttggact ctcatttttg aagtactttt ttgcaccttt ccaatggtta 360
gcacttgcag ctgttgcagt tgggattcct ccaattattt ttagaggtgt ggctgccgtg 420
cgaaacctca ctcttgacat caacattctt gttttaatag cagtggctgg atcaattgtt 480
ttacacgatt attgggaagc tggtactatt gtcttcttat tcgccattgc agaatggcta 540
gagtcaaggg caagtcacaa ggctaccgct gctatgtcat cactggtcaa tatagtccct 600
ccaacagcag ttttagctga aagcggagaa gtcgtaaatg ttgatgaagt caaggtgaat 660
agcattcttg ctgtgaaagc tggtgaaact atacctattg atggagttgt agtggaaggg 720
gaatgtgacg tggacgagaa aacactgaca ggcgagtcgt ttccagtttc taagcaaaga 780
gattcaacgg tctgggctgg cactacaaat ctaaatggct atatcagtgt taagactacg 840
gctttggctg aagattgtgc ggtggctagg atggcacagc ttgtcgaaga tgctcagaac 900
aagaaatcaa aaacccaaag atacatcgac aagtgtgcta aatattatac accagcaatt 960
gtggctatat cagcttcttt ggcaattgtt cctactgcat taagagttca caatcgaaat 1020
gaatggtatc gcttggcttt ggtcacattg gtgagtgcat gtccgtgtgc acttgttcta 1080
tctacaccag ttgccatgtg ttgcgcactt tcaaaagcag caacgtccgg tcttctgttt 1140
aaaggagcag agtaccttga gactctagct aaaatcaaaa tcatggcttt tgacaaaaca 1200
gggactataa ctaaaggaga atttatggtg accgagttca agtctctgat tgatggtttt 1260
agtctcaata cactgcttta ctgggtttca agcattgaga gcaagtcagg tcatccgatg 1320
gcagccgctc tggtggacta tgcacaatca aattccgttg agccaaagcc tgatagagtt 1380
gagcagtttc aaaattttcc tggtgaaggg atatttggaa gaattgatgg aatggaaatc 1440
tatgtcggga ataggaaaat ttcttcaaga gctggatgta ccacagtacc agaaatagag 1500
ggtgatagtt tcaaaggaaa gtctgttgga tacatatttt tgggatcatc tccagctgga 1560
attttcagtc tttccgatgt ttgtcgaatt ggtgtaaaag aagcaatgag agaactgaag 1620
cagatgggta tcaaaaccgc gatgcttact ggtgattgtt atgcagctgc caaccatgtg 1680
caggatcagt taggtggagc tttggatgaa tttcaagcag aactcctacc agaggacaag 1740
gcaacaatca tcaagggttt tcagaaggaa gctccaacag cgatgatagg cgacggcctt 1800
aatgatgctc ctgcattagc aacagctgac attggcatct caatgggcat ctctgggtca 1860
gctctcgcta aagaaacagg ccatgttata ctaatgacaa atgacatcgg aagaataccg 1920
aaagctgcac gtcttgctag aagagttcga aggaagattg ttgagaatat gattatatca 1980
gtcgttacaa aggctgccat agttgcattg gcaatagcag gttatccatt ggtttgggct 2040
gctgtcctcg cagatactgg gacatgcttg ctagtgattt tgaacagcat gctacttcta 2100
cgaggaggca cacgcagaca tgggaaaaaa tgttggagat cttctactcc ttcgcatgct 2160
ccccaccaca aagacaaagc ttcatgttgc aagtcggaaa atgctcccca gctgtgttgc 2220
tctgatattg agtcacaaaa gaaatgtaca agtcaatcat gctcgtccga ggtgtgtgtt 2280
ccaagatgtc aacctgtctc ctcaggatca aagtcatgtg gaaataatca gtgcccagac 2340
tccattgaaa atagtggttt tcattctcat ccccgtcctc aatgctgctc gtcgaagatg 2400
gctgctaaag catgccaatc tgcagtttca gaatcaaagt catgcggaaa taatcagtgc 2460
ccagactccg ttgaaaatag tggttttcat tctcatcccc gtcctgaatg ctgctcgtcg 2520
aagatggctg ctaaagcgtg ccaatctgca gtttcagaat caaagtcatg tggaaataat 2580
cagtgcccag actccgttga aaatagtggt tttcattctc atccccgtcc tcaatgctgt 2640
tcatcgaaga tggctgctaa agcaggccaa tctgcacttt cagaatcaaa gtcatgtgga 2700
aataacaatt gctcagactc cattcacaag agtaattgtc attctttaac taactctcta 2760
gtatgttctt ccaagatgtc tgctccacaa tgtcattctg ctacttcaag caacaaatca 2820
tgtggaagta ccaagtgctc cgacttcagt gacaaaaaat gttgtcaatc cgacaaaatt 2880
cctcaaacgt gctctaccaa gaagtctgct ccaggatgtc aatctgcagt ttctgggtct 2940
aaatcatgtg gaaatagcaa gtgttcagac tcaaaagaca atagtagcca tccttcacat 3000
cccgatcatc aaacatgcat gtctaagttg tgtgctccac aaagccaatc tgcaacttca 3060
agctccagga catgtggaaa tacaaagtgc tcggacacca atagcaagaa ttcttgttat 3120
tcacaaacca actctgaatc atgctcttca aagatgtctg gtccatcatg caaaactgct 3180
aattcaggtt caaggtcatg cagaaataag aagtgccagg actctgcaac cgagaacagt 3240
tttcattcac cacttactaa tccactcagt ggggaaaagc tttcggagca gaaaagcttg 3300
gatttagtcc gaaaagataa ggaatcaagt catgatcttc gtcatggctg ctctgacgag 3360
gaacatgatc atacaaattt agacaaggca tatgacagtt gtgccttaca agaatgttgt 3420
tattcggttc aaggcaataa aactgatgta tcagaaactg gaatccagga aactgctcat 3480
tgtgacagca ccaatcaaac atgccaaact gcaagttcag gatcgatgac atgcggaaat 3540
gataagatcc tggactctct aagcatccat ggttgtcatt cgcatgataa tccactccac 3600
gaggagaaca acttggagca gaaaatcttg gatgttgttg gagaaggtat aaaatcacct 3660
catgctgtcg gtcatggctg ttcggacaag gaacacgatc actcacatcc agaaaaggca 3720
tatgacagtt gtgcaacaga tgattgttgt ttttcagttc aagtccatgg cattgacgac 3780
gtatcaaaaa gtgaaattca agaaactgct cattgtgaca gcacaaagca gagcatggtc 3840
atctccagca gctgcaaaca tgaaccaaaa gatcaggtaa atcactgtgg acttcactct 3900
aaaactactc caactgatga agaactagcc aagctggtta gaagatgctg caaatacaaa 3960
ccatgccacg acgtccgttc tggctgcagg aagcatgctg cagaatgtgg tccaaccgtt 4020
cgatcaacca tcaatatctt acgggacaac catcatcatt acctagactg cagtggtcgt 4080
aaggtttgtt cgctgttgga gaagagacac atcggtggat gctgtgacag cttcagaaaa 4140
gaatgttgtg ccaagaaaaa acaccttgga gcaagttttg gaggaggttt atcagaaatt 4200
gtcatagagt ag 4212
<210> 2
<211> 1403
<212> PRT
<213>The acid of NtHMA2 aminopeptidase genes
<400> 2
Met Val Glu Ser Glu Lys Met Asn Glu Thr Lys Lys Leu Ser Lys Ser
1 5 10 15
Tyr Phe Asp Val Leu Gly Ile Cys Cys Thr Ser Glu Val Val Leu Val
20 25 30
Glu Lys Ile Leu Lys Asn Leu Glu Gly Val Lys Glu Val Ser Val Ile
35 40 45
Val Thr Thr Lys Thr Val Ile Val Ile His Asp Ser Leu Leu Ile Ser
50 55 60
Pro Gln Gln Ile Val Lys Ala Leu Asn Gln Ala Arg Leu Glu Ala Ser
65 70 75 80
Ile Arg Val Lys Gly Glu Lys Asn Tyr Gln Lys Lys Trp Pro Ser Pro
85 90 95
Phe Ala Ile Gly Ser Gly Ile Leu Leu Gly Leu Ser Phe Leu Lys Tyr
100 105 110
Phe Phe Ala Pro Phe Gln Trp Leu Ala Leu Ala Ala Val Ala Val Gly
115 120 125
Ile Pro Pro Ile Ile Phe Arg Gly Val Ala Ala Val Arg Asn Leu Thr
130 135 140
Leu Asp Ile Asn Ile Leu Val Leu Ile Ala Val Ala Gly Ser Ile Val
145 150 155 160
Leu His Asp Tyr Trp Glu Ala Gly Thr Ile Val Phe Leu Phe Ala Ile
165 170 175
Ala Glu Trp Leu Glu Ser Arg Ala Ser His Lys Ala Thr Ala Ala Met
180 185 190
Ser Ser Leu Val Asn Ile Val Pro Pro Thr Ala Val Leu Ala Glu Ser
195 200 205
Gly Glu Val Val Asn Val Asp Glu Val Lys Val Asn Ser Ile Leu Ala
210 215 220
Val Lys Ala Gly Glu Thr Ile Pro Ile Asp Gly Val Val Val Glu Gly
225 230 235 240
Glu Cys Asp Val Asp Glu Lys Thr Leu Thr Gly Glu Ser Phe Pro Val
245 250 255
Ser Lys Gln Arg Asp Ser Thr Val Trp Ala Gly Thr Thr Asn Leu Asn
260 265 270
Gly Tyr Ile Ser Val Lys Thr Thr Ala Leu Ala Glu Asp Cys Ala Val
275 280 285
Ala Arg Met Ala Gln Leu Val Glu Asp Ala Gln Asn Lys Lys Ser Lys
290 295 300
Thr Gln Arg Tyr Ile Asp Lys Cys Ala Lys Tyr Tyr Thr Pro Ala Ile
305 310 315 320
Val Ala Ile Ser Ala Ser Leu Ala Ile Val Pro Thr Ala Leu Arg Val
325 330 335
His Asn Arg Asn Glu Trp Tyr Arg Leu Ala Leu Val Thr Leu Val Ser
340 345 350
Ala Cys Pro Cys Ala Leu Val Leu Ser Thr Pro Val Ala Met Cys Cys
355 360 365
Ala Leu Ser Lys Ala Ala Thr Ser Gly Leu Leu Phe Lys Gly Ala Glu
370 375 380
Tyr Leu Glu Thr Leu Ala Lys Ile Lys Ile Met Ala Phe Asp Lys Thr
385 390 395 400
Gly Thr Ile Thr Lys Gly Glu Phe Met Val Thr Glu Phe Lys Ser Leu
405 410 415
Ile Asp Gly Phe Ser Leu Asn Thr Leu Leu Tyr Trp Val Ser Ser Ile
420 425 430
Glu Ser Lys Ser Gly His Pro Met Ala Ala Ala Leu Val Asp Tyr Ala
435 440 445
Gln Ser Asn Ser Val Glu Pro Lys Pro Asp Arg Val Glu Gln Phe Gln
450 455 460
Asn Phe Pro Gly Glu Gly Ile Phe Gly Arg Ile Asp Gly Met Glu Ile
465 470 475 480
Tyr Val Gly Asn Arg Lys Ile Ser Ser Arg Ala Gly Cys Thr Thr Val
485 490 495
Pro Glu Ile Glu Gly Asp Ser Phe Lys Gly Lys Ser Val Gly Tyr Ile
500 505 510
Phe Leu Gly Ser Ser Pro Ala Gly Ile Phe Ser Leu Ser Asp Val Cys
515 520 525
Arg Ile Gly Val Lys Glu Ala Met Arg Glu Leu Lys Gln Met Gly Ile
530 535 540
Lys Thr Ala Met Leu Thr Gly Asp Cys Tyr Ala Ala Ala Asn His Val
545 550 555 560
Gln Asp Gln Leu Gly Gly Ala Leu Asp Glu Phe Gln Ala Glu Leu Leu
565 570 575
Pro Glu Asp Lys Ala Thr Ile Ile Lys Gly Phe Gln Lys Glu Ala Pro
580 585 590
Thr Ala Met Ile Gly Asp Gly Leu Asn Asp Ala Pro Ala Leu Ala Thr
595 600 605
Ala Asp Ile Gly Ile Ser Met Gly Ile Ser Gly Ser Ala Leu Ala Lys
610 615 620
Glu Thr Gly His Val Ile Leu Met Thr Asn Asp Ile Gly Arg Ile Pro
625 630 635 640
Lys Ala Ala Arg Leu Ala Arg Arg Val Arg Arg Lys Ile Val Glu Asn
645 650 655
Met Ile Ile Ser Val Val Thr Lys Ala Ala Ile Val Ala Leu Ala Ile
660 665 670
Ala Gly Tyr Pro Leu Val Trp Ala Ala Val Leu Ala Asp Thr Gly Thr
675 680 685
Cys Leu Leu Val Ile Leu Asn Ser Met Leu Leu Leu Arg Gly Gly Thr
690 695 700
Arg Arg His Gly Lys Lys Cys Trp Arg Ser Ser Thr Pro Ser His Ala
705 710 715 720
Pro His His Lys Asp Lys Ala Ser Cys Cys Lys Ser Glu Asn Ala Pro
725 730 735
Gln Leu Cys Cys Ser Asp Ile Glu Ser Gln Lys Lys Cys Thr Ser Gln
740 745 750
Ser Cys Ser Ser Glu Val Cys Val Pro Arg Cys Gln Pro Val Ser Ser
755 760 765
Gly Ser Lys Ser Cys Gly Asn Asn Gln Cys Pro Asp Ser Ile Glu Asn
770 775 780
Ser Gly Phe His Ser His Pro Arg Pro Gln Cys Cys Ser Ser Lys Met
785 790 795 800
Ala Ala Lys Ala Cys Gln Ser Ala Val Ser Glu Ser Lys Ser Cys Gly
805 810 815
Asn Asn Gln Cys Pro Asp Ser Val Glu Asn Ser Gly Phe His Ser His
820 825 830
Pro Arg Pro Glu Cys Cys Ser Ser Lys Met Ala Ala Lys Ala Cys Gln
835 840 845
Ser Ala Val Ser Glu Ser Lys Ser Cys Gly Asn Asn Gln Cys Pro Asp
850 855 860
Ser Val Glu Asn Ser Gly Phe His Ser His Pro Arg Pro Gln Cys Cys
865 870 875 880
Ser Ser Lys Met Ala Ala Lys Ala Gly Gln Ser Ala Leu Ser Glu Ser
885 890 895
Lys Ser Cys Gly Asn Asn Asn Cys Ser Asp Ser Ile His Lys Ser Asn
900 905 910
Cys His Ser Leu Thr Asn Ser Leu Val Cys Ser Ser Lys Met Ser Ala
915 920 925
Pro Gln Cys His Ser Ala Thr Ser Ser Asn Lys Ser Cys Gly Ser Thr
930 935 940
Lys Cys Ser Asp Phe Ser Asp Lys Lys Cys Cys Gln Ser Asp Lys Ile
945 950 955 960
Pro Gln Thr Cys Ser Thr Lys Lys Ser Ala Pro Gly Cys Gln Ser Ala
965 970 975
Val Ser Gly Ser Lys Ser Cys Gly Asn Ser Lys Cys Ser Asp Ser Lys
980 985 990
Asp Asn Ser Ser His Pro Ser His Pro Asp His Gln Thr Cys Met Ser
995 1000 1005
Lys Leu Cys Ala Pro Gln Ser Gln Ser Ala Thr Ser Ser Ser Arg
1010 1015 1020
Thr Cys Gly Asn Thr Lys Cys Ser Asp Thr Asn Ser Lys Asn Ser
1025 1030 1035
Cys Tyr Ser Gln Thr Asn Ser Glu Ser Cys Ser Ser Lys Met Ser
1040 1045 1050
Gly Pro Ser Cys Lys Thr Ala Asn Ser Gly Ser Arg Ser Cys Arg
1055 1060 1065
Asn Lys Lys Cys Gln Asp Ser Ala Thr Glu Asn Ser Phe His Ser
1070 1075 1080
Pro Leu Thr Asn Pro Leu Ser Gly Glu Lys Leu Ser Glu Gln Lys
1085 1090 1095
Ser Leu Asp Leu Val Arg Lys Asp Lys Glu Ser Ser His Asp Leu
1100 1105 1110
Arg His Gly Cys Ser Asp Glu Glu His Asp His Thr Asn Leu Asp
1115 1120 1125
Lys Ala Tyr Asp Ser Cys Ala Leu Gln Glu Cys Cys Tyr Ser Val
1130 1135 1140
Gln Gly Asn Lys Thr Asp Val Ser Glu Thr Gly Ile Gln Glu Thr
1145 1150 1155
Ala His Cys Asp Ser Thr Asn Gln Thr Cys Gln Thr Ala Ser Ser
1160 1165 1170
Gly Ser Met Thr Cys Gly Asn Asp Lys Ile Leu Asp Ser Leu Ser
1175 1180 1185
Ile His Gly Cys His Ser His Asp Asn Pro Leu His Glu Glu Asn
1190 1195 1200
Asn Leu Glu Gln Lys Ile Leu Asp Val Val Gly Glu Gly Ile Lys
1205 1210 1215
Ser Pro His Ala Val Gly His Gly Cys Ser Asp Lys Glu His Asp
1220 1225 1230
His Ser His Pro Glu Lys Ala Tyr Asp Ser Cys Ala Thr Asp Asp
1235 1240 1245
Cys Cys Phe Ser Val Gln Val His Gly Ile Asp Asp Val Ser Lys
1250 1255 1260
Ser Glu Ile Gln Glu Thr Ala His Cys Asp Ser Thr Lys Gln Ser
1265 1270 1275
Met Val Ile Ser Ser Ser Cys Lys His Glu Pro Lys Asp Gln Val
1280 1285 1290
Asn His Cys Gly Leu His Ser Lys Thr Thr Pro Thr Asp Glu Glu
1295 1300 1305
Leu Ala Lys Leu Val Arg Arg Cys Cys Lys Tyr Lys Pro Cys His
1310 1315 1320
Asp Val Arg Ser Gly Cys Arg Lys His Ala Ala Glu Cys Gly Pro
1325 1330 1335
Thr Val Arg Ser Thr Ile Asn Ile Leu Arg Asp Asn His His His
1340 1345 1350
Tyr Leu Asp Cys Ser Gly Arg Lys Val Cys Ser Leu Leu Glu Lys
1355 1360 1365
Arg His Ile Gly Gly Cys Cys Asp Ser Phe Arg Lys Glu Cys Cys
1370 1375 1380
Ala Lys Lys Lys His Leu Gly Ala Ser Phe Gly Gly Gly Leu Ser
1385 1390 1395
Glu Ile Val Ile Glu
1400
<210> 3
<211> 4212
<212> DNA
<213>NtHMA2 gene mutation body nucleotide
<400> 3
atggtggaaa gtgaaaaaat gaatgaaaca aagaagttga gcaagagcta ttttgatgtt 60
ttgggaattt gctgtacttc agaagttgtt ctagttgaaa aaattctcaa gaatcttgaa 120
ggggttaaag aggtttcagt aattgtcaca acaaagactg tcattgttat tcatgattct 180
cttctcattt ctccgcaaca aattgttaaa gcattgaatc aagcaagatt agaagcaagc 240
ataagagtga aaggagagaa aaactaccaa aagaaatggc caagtccatt tgcaattggc 300
agtggaatat tgcttggact ctcatttttg aagtactttt ttgcaccttt ccaatggtta 360
gcacttgcag ctgttgcagt tgggattcct ccaattattt ttagaggtgt ggctgccgtg 420
cgaaacctca ctcttgacat caacattctt gttttaatag cagtggctgg atcaattgtt 480
ttacacgatt attgggaagc tggtactatt gtcttcttat tcgccattgc agaatggcta 540
gagtcaaggg caagtcacaa ggctaccgct gctatgtcat cactggtcaa tatagtccct 600
ccaacagcag ttttagctga aagcggagaa gtcgtaaatg ttgatgaagt caaggtgaat 660
agcattcttg ctgtgaaagc tggtgaaact atacctattg atggagttgt agtggaaggg 720
gaatgtgacg tggacgagaa aacactgaca ggcgagtcgt ttccagtttc taagcaaaga 780
gattcaacgg tctgggctgg cactacaaat ctaaatggct atatcagtgt taagactacg 840
gctttggctg aagattgtgc ggtggctagg atggcatagc ttgtcgaaga tgctcagaac 900
aagaaatcaa aaacccaaag atacatcgac aagtgtgcta aatattatac accagcaatt 960
gtggctatat cagcttcttt ggcaattgtt cctactgcat taagagttca caatcgaaat 1020
gaatggtatc gcttggcttt ggtcacattg gtgagtgcat gtccgtgtgc acttgttcta 1080
tctacaccag ttgccatgtg ttgcgcactt tcaaaagcag caacgtccgg tcttctgttt 1140
aaaggagcag agtaccttga gactctagct aaaatcaaaa tcatggcttt tgacaaaaca 1200
gggactataa ctaaaggaga atttatggtg accgagttca agtctctgat tgatggtttt 1260
agtctcaata cactgcttta ctgggtttca agcattgaga gcaagtcagg tcatccgatg 1320
gcagccgctc tggtggacta tgcacaatca aattccgttg agccaaagcc tgatagagtt 1380
gagcagtttc aaaattttcc tggtgaaggg atatttggaa gaattgatgg aatggaaatc 1440
tatgtcggga ataggaaaat ttcttcaaga gctggatgta ccacagtacc agaaatagag 1500
ggtgatagtt tcaaaggaaa gtctgttgga tacatatttt tgggatcatc tccagctgga 1560
attttcagtc tttccgatgt ttgtcgaatt ggtgtaaaag aagcaatgag agaactgaag 1620
cagatgggta tcaaaaccgc gatgcttact ggtgattgtt atgcagctgc caaccatgtg 1680
caggatcagt taggtggagc tttggatgaa tttcaagcag aactcctacc agaggacaag 1740
gcaacaatca tcaagggttt tcagaaggaa gctccaacag cgatgatagg cgacggcctt 1800
aatgatgctc ctgcattagc aacagctgac attggcatct caatgggcat ctctgggtca 1860
gctctcgcta aagaaacagg ccatgttata ctaatgacaa atgacatcgg aagaataccg 1920
aaagctgcac gtcttgctag aagagttcga aggaagattg ttgagaatat gattatatca 1980
gtcgttacaa aggctgccat agttgcattg gcaatagcag gttatccatt ggtttgggct 2040
gctgtcctcg cagatactgg gacatgcttg ctagtgattt tgaacagcat gctacttcta 2100
cgaggaggca cacgcagaca tgggaaaaaa tgttggagat cttctactcc ttcgcatgct 2160
ccccaccaca aagacaaagc ttcatgttgc aagtcggaaa atgctcccca gctgtgttgc 2220
tctgatattg agtcacaaaa gaaatgtaca agtcaatcat gctcgtccga ggtgtgtgtt 2280
ccaagatgtc aacctgtctc ctcaggatca aagtcatgtg gaaataatca gtgcccagac 2340
tccattgaaa atagtggttt tcattctcat ccccgtcctc aatgctgctc gtcgaagatg 2400
gctgctaaag catgccaatc tgcagtttca gaatcaaagt catgcggaaa taatcagtgc 2460
ccagactccg ttgaaaatag tggttttcat tctcatcccc gtcctgaatg ctgctcgtcg 2520
aagatggctg ctaaagcgtg ccaatctgca gtttcagaat caaagtcatg tggaaataat 2580
cagtgcccag actccgttga aaatagtggt tttcattctc atccccgtcc tcaatgctgt 2640
tcatcgaaga tggctgctaa agcaggccaa tctgcacttt cagaatcaaa gtcatgtgga 2700
aataacaatt gctcagactc cattcacaag agtaattgtc attctttaac taactctcta 2760
gtatgttctt ccaagatgtc tgctccacaa tgtcattctg ctacttcaag caacaaatca 2820
tgtggaagta ccaagtgctc cgacttcagt gacaaaaaat gttgtcaatc cgacaaaatt 2880
cctcaaacgt gctctaccaa gaagtctgct ccaggatgtc aatctgcagt ttctgggtct 2940
aaatcatgtg gaaatagcaa gtgttcagac tcaaaagaca atagtagcca tccttcacat 3000
cccgatcatc aaacatgcat gtctaagttg tgtgctccac aaagccaatc tgcaacttca 3060
agctccagga catgtggaaa tacaaagtgc tcggacacca atagcaagaa ttcttgttat 3120
tcacaaacca actctgaatc atgctcttca aagatgtctg gtccatcatg caaaactgct 3180
aattcaggtt caaggtcatg cagaaataag aagtgccagg actctgcaac cgagaacagt 3240
tttcattcac cacttactaa tccactcagt ggggaaaagc tttcggagca gaaaagcttg 3300
gatttagtcc gaaaagataa ggaatcaagt catgatcttc gtcatggctg ctctgacgag 3360
gaacatgatc atacaaattt agacaaggca tatgacagtt gtgccttaca agaatgttgt 3420
tattcggttc aaggcaataa aactgatgta tcagaaactg gaatccagga aactgctcat 3480
tgtgacagca ccaatcaaac atgccaaact gcaagttcag gatcgatgac atgcggaaat 3540
gataagatcc tggactctct aagcatccat ggttgtcatt cgcatgataa tccactccac 3600
gaggagaaca acttggagca gaaaatcttg gatgttgttg gagaaggtat aaaatcacct 3660
catgctgtcg gtcatggctg ttcggacaag gaacacgatc actcacatcc agaaaaggca 3720
tatgacagtt gtgcaacaga tgattgttgt ttttcagttc aagtccatgg cattgacgac 3780
gtatcaaaaa gtgaaattca agaaactgct cattgtgaca gcacaaagca gagcatggtc 3840
atctccagca gctgcaaaca tgaaccaaaa gatcaggtaa atcactgtgg acttcactct 3900
aaaactactc caactgatga agaactagcc aagctggtta gaagatgctg caaatacaaa 3960
ccatgccacg acgtccgttc tggctgcagg aagcatgctg cagaatgtgg tccaaccgtt 4020
cgatcaacca tcaatatctt acgggacaac catcatcatt acctagactg cagtggtcgt 4080
aaggtttgtt cgctgttgga gaagagacac atcggtggat gctgtgacag cttcagaaaa 4140
gaatgttgtg ccaagaaaaa acaccttgga gcaagttttg gaggaggttt atcagaaatt 4200
gtcatagagt ag 4212
<210> 4
<211> 292
<212> PRT
<213>NtHMA2 gene mutation body aminoacid
<400> 4
Met Val Glu Ser Glu Lys Met Asn Glu Thr Lys Lys Leu Ser Lys Ser
1 5 10 15
Tyr Phe Asp Val Leu Gly Ile Cys Cys Thr Ser Glu Val Val Leu Val
20 25 30
Glu Lys Ile Leu Lys Asn Leu Glu Gly Val Lys Glu Val Ser Val Ile
35 40 45
Val Thr Thr Lys Thr Val Ile Val Ile His Asp Ser Leu Leu Ile Ser
50 55 60
Pro Gln Gln Ile Val Lys Ala Leu Asn Gln Ala Arg Leu Glu Ala Ser
65 70 75 80
Ile Arg Val Lys Gly Glu Lys Asn Tyr Gln Lys Lys Trp Pro Ser Pro
85 90 95
Phe Ala Ile Gly Ser Gly Ile Leu Leu Gly Leu Ser Phe Leu Lys Tyr
100 105 110
Phe Phe Ala Pro Phe Gln Trp Leu Ala Leu Ala Ala Val Ala Val Gly
115 120 125
Ile Pro Pro Ile Ile Phe Arg Gly Val Ala Ala Val Arg Asn Leu Thr
130 135 140
Leu Asp Ile Asn Ile Leu Val Leu Ile Ala Val Ala Gly Ser Ile Val
145 150 155 160
Leu His Asp Tyr Trp Glu Ala Gly Thr Ile Val Phe Leu Phe Ala Ile
165 170 175
Ala Glu Trp Leu Glu Ser Arg Ala Ser His Lys Ala Thr Ala Ala Met
180 185 190
Ser Ser Leu Val Asn Ile Val Pro Pro Thr Ala Val Leu Ala Glu Ser
195 200 205
Gly Glu Val Val Asn Val Asp Glu Val Lys Val Asn Ser Ile Leu Ala
210 215 220
Val Lys Ala Gly Glu Thr Ile Pro Ile Asp Gly Val Val Val Glu Gly
225 230 235 240
Glu Cys Asp Val Asp Glu Lys Thr Leu Thr Gly Glu Ser Phe Pro Val
245 250 255
Ser Lys Gln Arg Asp Ser Thr Val Trp Ala Gly Thr Thr Asn Leu Asn
260 265 270
Gly Tyr Ile Ser Val Lys Thr Thr Ala Leu Ala Glu Asp Cys Ala Val
275 280 285
Ala Arg Met Ala
290
<210> 5
<211> 24
<212> DNA
<213> HMA2-F
<400> 5
aatatagaga tggccaatga aggt 24
<210> 6
<211> 25
<212> DNA
<213> HMA2-R
<400> 6
ctaaaattta tatgaccaag tactt 25
Claims (2)
1. a kind ofNtHMA2Gene mutation body, it is characterised in that with wild-type tobaccoNtHMA2Gene has as in sequence table
SEQ ID No:Nucleotide sequence shown in 1 is compared, what mutant containedNtHMA2The C that gene order is 520 sports T, shape
Into termination codon, the gene is set to terminate in advance.
2. described in a kind of claim 1NtHMA2The application of gene mutation body, it is characterised in thatNtHMA2Gene mutation body can
So that Nicotiana tabacum L. cadmium content reduces by 30 ~ 50%, zinc, ferrum, lead, chromium, nickel equal size reduce by 20 ~ 40%, and arsenic content reduces by 5 ~ 15%.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710033488.1A CN106636136B (en) | 2017-01-18 | 2017-01-18 | A kind of NtHMA2 gene mutation body and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710033488.1A CN106636136B (en) | 2017-01-18 | 2017-01-18 | A kind of NtHMA2 gene mutation body and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106636136A true CN106636136A (en) | 2017-05-10 |
CN106636136B CN106636136B (en) | 2019-09-20 |
Family
ID=58840910
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710033488.1A Active CN106636136B (en) | 2017-01-18 | 2017-01-18 | A kind of NtHMA2 gene mutation body and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106636136B (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107586880A (en) * | 2017-10-31 | 2018-01-16 | 云南省烟草农业科学研究院 | A kind of molecular labeling and application for differentiating tobacco cadmium transporter gene NtHMA2 wild types and mutant |
CN109439669A (en) * | 2018-11-17 | 2019-03-08 | 云南省烟草农业科学研究院 | The cloning process of tobacco arsenic transporter gene NtNIP7-1 a kind of and application |
CN115927373A (en) * | 2022-08-05 | 2023-04-07 | 云南省烟草农业科学研究院 | NtMYC2a gene mutant for improving nicotine content of tobacco leaves and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20130199553A1 (en) * | 2012-02-08 | 2013-08-08 | Patsy Elizabeth Elliott | Tobacco Having Altered Amounts Of Environmental Contaminants And Methods For Producing Such Lines |
CN103981194A (en) * | 2014-06-10 | 2014-08-13 | 云南省烟草农业科学研究院 | Tobacco cadmium transporter gene NtHMA2, and cloning method and application thereof |
-
2017
- 2017-01-18 CN CN201710033488.1A patent/CN106636136B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20130199553A1 (en) * | 2012-02-08 | 2013-08-08 | Patsy Elizabeth Elliott | Tobacco Having Altered Amounts Of Environmental Contaminants And Methods For Producing Such Lines |
CN103981194A (en) * | 2014-06-10 | 2014-08-13 | 云南省烟草农业科学研究院 | Tobacco cadmium transporter gene NtHMA2, and cloning method and application thereof |
Non-Patent Citations (3)
Title |
---|
HERMAND,V. 等: ""GenBank: HF675181.1"", 《GENBANK》 * |
VICTOR HERMAND ET AL.,: ""Inactivation of two newly identified tobacco heavy metal ATPases leads to reduced Zn and Cd accumulation in shoots and reduced pollen germination"", 《METALLOMICS》 * |
韩彦莎等: ""胡杨PeXTH基因的克隆及其转基因烟草的抗镉性分析"", 《西北农林科技大学学报(自然科学版)》 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107586880A (en) * | 2017-10-31 | 2018-01-16 | 云南省烟草农业科学研究院 | A kind of molecular labeling and application for differentiating tobacco cadmium transporter gene NtHMA2 wild types and mutant |
CN109439669A (en) * | 2018-11-17 | 2019-03-08 | 云南省烟草农业科学研究院 | The cloning process of tobacco arsenic transporter gene NtNIP7-1 a kind of and application |
CN109439669B (en) * | 2018-11-17 | 2022-03-29 | 云南省烟草农业科学研究院 | Tobacco arsenic transport gene NtNIP7-1 and cloning method and application thereof |
CN115927373A (en) * | 2022-08-05 | 2023-04-07 | 云南省烟草农业科学研究院 | NtMYC2a gene mutant for improving nicotine content of tobacco leaves and application thereof |
CN115927373B (en) * | 2022-08-05 | 2024-05-28 | 云南省烟草农业科学研究院 | NtMYC2a gene mutant for improving nicotine content of tobacco leaves and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN106636136B (en) | 2019-09-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106636136B (en) | A kind of NtHMA2 gene mutation body and application | |
Liu et al. | Ammonium aggravates salt stress in plants by entrapping them in a chloride over-accumulation state in an NRT1. 1-dependent manner | |
El-Agamy et al. | In vitro salt and drought tolerance of Manfalouty and Nab El-Gamal pomegranate cultivars | |
Yeoh et al. | Sequence analysis and gene expression of putative exo-and endo-glucanases from oil palm (Elaeis guineensis) during fungal infection | |
Fozouni et al. | Short term response of grapevine grown hydroponically to salinity: Mineral composition and growth parameters | |
Chen et al. | Generation of low-cadmium rice germplasms via knockout of OsLCD using CRISPR/Cas9 | |
CN106636137B (en) | A kind of preparation method and application of NtHMA4 gene mutation body | |
CN113122458A (en) | Ganoderma leucocontextum Z160097 and cultivation method and application thereof | |
CN109182582A (en) | Qualitative detection primer and detection method for fusarium oxysporum f.sp.cubense | |
Gutiérrez et al. | New species of Buxus (Buxaceae) from northeastern Cuba based on morphological and molecular characters, including some comments on molecular diagnosis | |
Baayen et al. | Inheritance of resistance in carnation against Fusarium oxysporum f. sp. dianthi races 1 and 2, in relation to resistance components | |
CN106497935A (en) | Overexpression GhJAZ1 genes amplification Genes For Plant Tolerance low temperature stress | |
CN109706087B (en) | Penicillium simplicissimum strain and separation method and application thereof | |
CN107190089A (en) | The method that using molecular labeling 3 kinds of strawberry cultivars are carried out with quick discriminating | |
CN114395509B (en) | Bacillus WYJ-E14 separated from radix curcumae and application thereof in preparation of antitumor drugs | |
CN113061619B (en) | Mutant gene TyrA related to phenol release amount of smoke | |
KR101790032B1 (en) | Hot pepper esterase like marker gene for diagnosis of gummy stem blight disease of watermelon, and uses thereof | |
CN113832253A (en) | Method for positioning Chinese cabbage clubroot disease resistance gene | |
CN107337721B (en) | Aphid-resistant gene PPA-7, preparation, encoded protein and application | |
CN113174395A (en) | Mutant gene DHQ-SDH1 related to smoke phenol release amount | |
CN116064589B (en) | Tobacco NtPht1-7 gene mutant and application thereof | |
Fan et al. | Identification and fungicide screening of fungal species associated with walnut anthracnose in Shaanxi and Liaoning provinces, China | |
Shang et al. | Ca alleviated Cd-induced toxicity in salix matsudana by affecting Cd absorption, translocation, subcellular distribution, and chemical forms | |
Yang et al. | Hexaploid Salix rehderiana is more suitable for remediating lead contamination than diploids, especially male plants | |
Çelik et al. | Investıgatıon of Nicotinamide Phosphorıbosyltransferase (Nampt), Interleukin-6 (Il-6) And Vaspin Serum Protein Levels In Type 2 Diabetes Mellitus |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |