CN106636136B - A kind of NtHMA2 gene mutation body and application - Google Patents

Abstract

The invention discloses one kindNtHMA2Gene mutation body,NtHMA2The mutation of a nucleotide occurs in gene, it is unmutatedNtHMA2Sequence includes the nucleotide sequence of SEQ ID NO:1.Wherein, 877 C sport T, form terminator codon, terminate the gene in advance.Tobacco containing mutant nucleotide sequence reduces by 40% or so compared to the tobacco leaf cadmium content containing SEQ ID NO:1 sequence, and zinc, iron, lead, chromium, nickel equal size reduce by 30% or so, and arsenic content reduces by 10% or so.

Description

A kind of NtHMA2 gene mutation body and application

Technical field

The invention belongs to genetic engineering technology fields, and in particular to a kind ofNtHMA2Gene mutation body and application.

Background technique

Cadmium (Cd), arsenic (As), chromium (Cr), mercury (Hg) and lead (Pb) etc. are generally acknowledged to plant and human body harm Bigger heavy metal element, plant essential trace element zinc (Zn), nickel (Ni), copper (Cu) if etc. excessive can also produce Raw harm.So increasingly causing the attention of scientific research personnel about crop heavy metal pollution and its research for reducing method.Tobacco (Nicotiana tabacum) industrial crops are important, it is Solanaceae annual herb plant.In recent years about a huge sum of money in tobacco The research of category is increasingly becoming a hot spot of tobacco harm reduction research.

Heavy metal can have an adverse effect to cigarette quality.Nicotine content is an important indicator for measuring quality of tobacco, The raising that nicotine is conducive to quality of tobacco is improved in a certain range, and Cd pollution can reduce nicotine content of tobacco leaves, and possible cause is Root synthesis nicotinic pathway or nicotine are obstructed to top transport process.In addition, soluble sugar is extremely sensitive to Cd, Pb in tobacco leaf, Slight pollution will lead to its content and be decreased obviously, this may be since heavy metal destroys tobacco chloroplast, photosynthesis by Caused by resistance.Heavy metal will lead to tobacco leaf sugar alkali ratio and nitrogen base ratio increases, and chemical component composition is unbalance, and quality is affected.

Heavy metal is huge to the harm of human body, and such as excessive cadmium enters in human body and may damage to blood vessel；In addition cadmium Element is inhibited to intestinal absorption iron, can also interfere the metabolic process of the microelements such as cobalt, copper, zinc, cause lung, kidney, The human bodies organ injury such as liver, the effects of carcinogenic, teratogenesis and mutagenesis may finally be caused.Arsenic can induce many diseases, such as anxious Property arsenic poisoning can cause central nervous system disorder cause total numbness, respiratory tract and Alimentary tract disease even quick death；Slowly Property arsenic poisoning leads to the skins such as nerve problems, malaise, appetite stimulator, nausea and cutaneous pigmentation and keratosis Lesion etc., and the diseases such as lung cancer, cutaneum carcinoma and bladder cancer can be caused.Zn-ef ficiency be human body important microelement it One, there is vital effect to the growth and development of human body, intelligence, immune function even eyesight.But the zinc in human body It is not The more the better.The zinc of human body excess intake, is easily converted to zinc chloride in gastric juice, has stronger corrosivity to stomach lining, It can cause gastric mucosa congestion, oedema, even bleeding.Excessive blood zinc can inhibit the phagocytic function of leucocyte, be under resistance of human body Drop is infected vulnerable to germ.Excessive zinc also will affect the absorption and metabolism of other inorganic salts of human body, such as influences the absorption of iron, makes It is excessively high to be damaged into cu zn ratio for iron metabolism in liver；Cholesterol metabolic is influenced, hypercholesterolemia etc. is formed.Nickel and its esters Toxicity it is lower, but since itself has biochemical activity, therefore a series of enzyme (arginase, carboxylic can be activated or inhibited Change enzyme, acid phosphatase and open up decarboxylase) and play its toxicity.Nickel can cause contact dermatitis.It is directly entered the nickel salt of blood Toxicity is higher, and colloid nickel or nickel chloride are more toxic, and can cause central circulation and disordered breathing, go out cardiac muscle, brain, lung and kidney Existing oedema, bleeding and denaturation.

Tobacco is the important industrial crops in China, and heavy metal pollution not only influences tobacco growth and development itself, to smoker Health also have serious threat.Harm reduction is always an important directions of tobacco research work, wherein reducing heavy metal Content is an important public relations goal.

Summary of the invention

The first object of the present invention is to provide one kindNtHMA2The EMS mutant of gene；Second is designed to provide institute It statesNtHMA2The application of gene mutation body.

The first object of the present invention is achieved in that and wild-type tobaccoNtHMA2Gene has as in sequence table Nucleotide sequence shown in SEQ ID No:1 is compared, what mutant containedNtHMA2The C that gene order is 877 sports T, shape At terminator codon, terminate the gene in advance.

DescribedNtHMA2The preparation method of the EMS mutant of gene includes EMS mutagenesis and TILLING screening mutant.

EMS mutagenesis tobacco seed:

A: utilizing white water treatment tobacco seed, then rotating centrifugal and is filtered dry；

B: rinsing seed, removes bleaching water, influences seed by bleaching agent chemical component, then revolved Turn centrifugation to be filtered dry；

C: it is impregnated 10 ~ 15 hours in the deionized water at a temperature of seed is placed on 10 DEG C ~ 30 DEG C, tobacco seed vernalization is sprouted Then hair is carried out rotating centrifugal and is filtered dry with the uniform mutagenic treatment of sharp seed；

Seed: being placed on 10 ~ 15 hours of immersion treatment in 0.5% EMS (ethylmethane sulfonate) mutagenesis agent solution by D, Then rotating centrifugal is carried out to be filtered dry；

E: seed being placed in rinsing aid solution and is rinsed, then is rinsed with deionized water, and 5 ~ 8 this processes are repeated, Then Buchner funnel filter paper filtration drying.

TILLING screens the mutant of nucleotide variation

A: seed (M1 generation) sowing and crop field, single plant bagging after mutagenic treatment are selfed sowing and obtain M2 generation, each M1 generation The M2 of single plant harvest sows 1 seed for seed.

B: M2 is taken to extract mutant material blade DNA using QIAGEN DNA extraction kit for mutant single-strain blade.

C: sample concentration measures and builds pond

By sample big minispread in sequence.16 channel Tecan infinite M200 instrument of 2ul DNA sample is taken respectively Concentration mensuration is carried out on device.All sample concentrations are diluted to 40ng/ul, 8 times of ponds DNA is made and is analyzed for TILLING.

D: it is designed using Primer3NtHMA2Gene TILLING analyzes primer, HMA2-F:

AATATAGAGATGGCCAATGAAGGT and HMA2-R:CTAAAATTTATATGACCAAGTACTT, amplification length For 1400bp or so.

E:TILLING analysis M2 screens the single plant of coding mutation for mutant, and carries out sequence verification, obtains one Mutant, 520 C of CDS sport T, form terminator codon, terminate the gene in advance.

F: in M3 for the plant of mutant screening mutational site homozygosis, it is selfed sowing.

G: Cd uptake test is carried out to Mutants homozygous, specially in cigarette strain squaring period, by 100 μm of ol CdCL₂Solution 500mL is poured in cigarette strain root.Blade is taken after 5 days, water-removing drying detects content of beary metal.

H: the tobacco containing mutant nucleotide sequence reduces by 40% left side compared to the tobacco leaf cadmium content containing SEQ ID NO:1 sequence The right side, zinc, iron, lead, chromium, nickel equal size reduce by 30% or so, and arsenic content reduces by 10% or so.

The second object of the present invention is achieved in thatNtHMA2Gene mutation body can make tobacco leaf cadmium content reduce by 30 ~ 50%, zinc, iron, lead, chromium, nickel equal size reduce by 20 ~ 40% or so, and arsenic content reduces by 5 ~ 15% or so.I.e. with describedNtHMA2Base Because mutant obtains the tobacco of low-heavy metal content.

Detailed description of the invention

Fig. 1 is that peak figure is sequenced in mutant mutational site；

Fig. 2 is the present inventionNtHMA2Mutant and 87 blade cadmium content contrast schematic diagram of cloud and mist；

Fig. 3 is the present inventionNtHMA2Mutant and 87 blade Zn content contrast schematic diagram of cloud and mist；

Fig. 4 is the present inventionNtHMA2Mutant and 87 blade iron content balance schematic diagram of cloud and mist；

Fig. 5 is the present inventionNtHMA2Mutant and 87 blade arsenic content contrast schematic diagram of cloud and mist；

Fig. 6 is the present inventionNtHMA2Mutant and 87 blade chromium content contrast schematic diagram of cloud and mist；

Fig. 7 is the present inventionNtHMA2Mutant and 87 blade nickel content contrast schematic diagram of cloud and mist.

Specific embodiment

Below with reference to embodiment and attached drawing, the present invention is further illustrated, but is not subject in any way to the present invention Limitation, based on present invention teach that it is made it is any transform or replace, all belong to the scope of protection of the present invention.

NtHMA2 gene mutation body of the present invention, with wild-type tobaccoNtHMA2Gene has as in sequence table Nucleotide sequence shown in SEQ ID No:1 is compared, what mutant containedNtHMA2The C that gene order is 877 sports T, shape At terminator codon, terminate the gene in advance.

NtHMA2The amino acid sequence of gene coding is as shown in SEQ ID No:2；

NtHMA2The nucleotide sequence of gene mutation body is as shown in SEQ ID No:3；

NtHMA2The amino acid sequence of gene mutation body coding is as shown in SEQ ID No:4；

DescribedNtHMA2The preparation method of the EMS mutant of gene includes EMS mutagenesis and TILLING screening mutant.

EMS mutagenesis tobacco seed:

A: utilizing white water treatment tobacco seed, then rotating centrifugal and is filtered dry；

B: rinsing seed, removes bleaching water, influences seed by bleaching agent chemical component, then revolved Turn centrifugation to be filtered dry；

C: it is impregnated 10 ~ 15 hours in the deionized water at a temperature of seed is placed on 10 DEG C ~ 30 DEG C, tobacco seed vernalization is sprouted Then hair is carried out rotating centrifugal and is filtered dry with the uniform mutagenic treatment of sharp seed；

Seed: being placed on 10 ~ 15 hours of immersion treatment in 0.5% EMS (ethylmethane sulfonate) mutagenesis agent solution by D, Then rotating centrifugal is carried out to be filtered dry；

E: seed being placed in rinsing aid solution and is rinsed, then is rinsed with deionized water, and 5 ~ 8 this processes are repeated, Then Buchner funnel filter paper filtration drying.

TILLING screens the mutant of nucleotide variation

A: seed (M1 generation) sowing and crop field, single plant bagging after mutagenic treatment are selfed sowing and obtain M2 generation, each M1 generation The M2 of single plant harvest sows 1 seed for seed.

B: M2 is taken to extract mutant material blade DNA using QIAGEN DNA extraction kit for mutant single-strain blade.

C: sample concentration measures and builds pond

By sample big minispread in sequence.16 channel Tecan infinite M200 instrument of 2ul DNA sample is taken respectively Concentration mensuration is carried out on device.All sample concentrations are diluted to 40ng/ul, 8 times of ponds DNA is made and is analyzed for TILLING.

D: it is designed using Primer3NtHMA2Gene TILLING analyzes primer,

HMA2-F:AATATAGAGATGGCCAATGAAGGT and

HMA2-R:CTAAAATTTATATGACCAAGTACTT, amplification length are 1400bp or so.

E:TILLING analysis M2 screens the single plant of coding mutation for mutant, and carries out sequence verification, obtains one Mutant, 520 C of CDS sport T, form terminator codon, terminate the gene in advance.

F: in M3 for the plant of mutant screening mutational site homozygosis, it is selfed sowing.

G: Cd uptake test is carried out to Mutants homozygous, specially in cigarette strain squaring period, by 100 μm of ol CdCL₂Solution 500mL is poured in cigarette strain root.Blade is taken after 5 days, water-removing drying detects content of beary metal.

H: the tobacco containing mutant nucleotide sequence reduces by 40% left side compared to the tobacco leaf cadmium content containing SEQ ID NO:1 sequence The right side, zinc, iron, lead, chromium, nickel equal size reduce by 30% or so, and arsenic content reduces by 10% or so.

Application of the present invention isNtHMA2Gene mutation body can make tobacco leaf cadmium content reduce by 30 ~ 50% or so, zinc, Iron, lead, chromium, nickel equal size reduce by 20 ~ 40% or so, and arsenic content reduces by 5 ~ 15% or so.I.e. with describedNtHMA2Gene mutation The tobacco of body acquisition low-heavy metal content.

It is described further below with case is embodied to the present invention:

DescribedNtHMA2The preparation method of mutant, it is unmutatedNtHMA2Such as sequence table of the nucleotide sequence of mutant Shown in middle SEQ ID No:1, nucleotide sequence 877 C of mutant sport T, specific preparation method the following steps are included:

(1) it selects 50% white water treatment cloud and mist, 87 seed 6 minutes, centrifugation is filtered dry；

(2) rinsing 1 minute is carried out to seed using deionization, centrifugation is filtered dry removal bleaching water constituent；

(3) room temperature condition, deionized water impregnated tobacco seed 10-12 hours, centrifugation is filtered dry；

(4) room temperature condition, 0.50%EMS ethylmethane sulfonate are handled tobacco seed 12 hours, and centrifugation is filtered dry；

(5) deionized water is added to rinse 1 minute, centrifugation is filtered dry, and repeats rinsing 8 times altogether.Then Buchner funnel filter paper filters It is dry.

(6) seed after mutagenic treatment (M1 generation) sowing and crop field, single plant bagging are selfed sowing and obtain M2 generation, each M1 generation The M2 of single plant harvest sows 1 seed for seed, obtains 1842 M2 altogether for single plant.

(7) M2 is taken to extract mutant material blade using QIAGEN DNA extraction kit for mutant single-strain blade DNA.Specific step is as follows: collecting by sample liquid nitrogen grinding, and with 1.5ml centrifuge tube；The AP1 solution of 400ul is added, 4ul's RNA enzyme mixes；Sample is put into 65 DEG C of water-bath water-bath 10min, is during which shaken up 3 times；It is molten that 130ul P3 is added into sample Liquid, ice bath 5mim；High speed centrifugation, 13200rpm, 5min；Upper liquid is taken to pour into purple Filter column, 13200rpm, 2min centrifugation； Filtrate is transferred to new 1.5mL centrifuge tube and the AW1 solution that 675ul is added mixes;Mixing sample solution point 2 times are transferred to yellowish Chromogenic filter column simultaneously carries out 10000rpm, 1min centrifugation, reject filtrate；Faint yellow Filter column is put into new 2ml centrifuge tube simultaneously The AW2 solution of 500ul is added, carries out 10000rpm, 1min centrifugation is abandoned filtrate (this step is repeated twice)；Again reject filtrate Faint yellow Filter column dallied (10000rpm, 1min), the faint yellow Filter column to have dallied is put into new 1.5ml and is centrifuged 5min is stood after 50ul AE solution is added in pipe, centrifuge is put into and carries out 10000rpm, 1min centrifugation removes yellowish chromogenic filter Column is put into 4 DEG C of refrigerators and saves.

(8) sample concentration measures and builds pond

By sample big minispread in sequence.16 channel Tecan infinite M200 instrument of 2ul DNA sample is taken respectively Concentration mensuration is carried out on device.All sample concentrations are diluted to 40ng/ul, 8 times of ponds DNA is made and is analyzed for TILLING.

(9) it is designed using Primer3NtHMA2Gene TILLING analyzes primer,

HMA2-F:AATATAGAGATGGCCAATGAAGGT and

HMA2-R:CTAAAATTTATATGACCAAGTACTT, amplification length are 1400bp or so.

(10) TILLING analyzes M2 for mutant, amplification system are as follows: 1.0 μ l 10 × buffer, 0.8 μ l dNTP (2.5mM), 0.16 μ l HMA2-F primer (10 μM), 0.16 μ l HMA2-R primer (10uM), 6.78 μ l H₂O, 1.0 μ l DNA profilings (20ng/ul).Response procedures be 95 DEG C of 3min, 94 DEG C of 30s, 62 DEG C of 30s, -1 DEG C/follow Ring, 72 DEG C of 1min, 7 circulations；94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, 40 circulations, 72 DEG C of 5min；99℃ 10min；70 DEG C 20s, -0.3 DEG C/circulation, 70 circulations, 4 DEG C of preservations.Amplified production is analyzed by Capillary Electrophoresis.

(11) single plant of the coding mutation filtered out carries out sequence verification, obtains a mutant,NtHMA2Gene 520 C of CDS sport T, form terminator codon, terminate the gene in advance.

(12) sowing is selfed for the plant (Fig. 1) for screening mutational site homozygosis in mutant by sequencing in M3.

NtHMA2Mutant reduce tobacco leaf content of beary metal method the following steps are included:

(1) Cd uptake test is carried out to Mutants homozygous, specially in chamber planting Mutants homozygous and wild type control, Cigarette strain squaring period, by 100 μm of ol CdCL₂Solution 500mL is poured and is taken blade behind cigarette strain root, 5 days, water-removing drying.Utilize tobacco The method of professional standard YC/T380-2010 detects tobacco leaf content of beary metal.

(2) tobacco containing mutant nucleotide sequence reduces by 40% left side compared to the tobacco leaf cadmium content containing SEQ ID NO:1 sequence The right side, zinc, iron, lead, chromium, nickel equal size reduce by 30% or so, and arsenic content reduces by 10% or so (table 1, Fig. 2 ~ Fig. 7).

1 tobacco leaf content of beary metal of table

。

SEQUENCE LISTING

<110>Yunnan Academy of Tobacco Agricultural Science

<120>a kind of NtHMA2 mutant and application

<130> 2017

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 4212

<212> DNA

<213>NtHMA2 gene nucleotide

<400> 1

atggtggaaa gtgaaaaaat gaatgaaaca aagaagttga gcaagagcta ttttgatgtt 60

ttgggaattt gctgtacttc agaagttgtt ctagttgaaa aaattctcaa gaatcttgaa 120

ggggttaaag aggtttcagt aattgtcaca acaaagactg tcattgttat tcatgattct 180

cttctcattt ctccgcaaca aattgttaaa gcattgaatc aagcaagatt agaagcaagc 240

ataagagtga aaggagagaa aaactaccaa aagaaatggc caagtccatt tgcaattggc 300

agtggaatat tgcttggact ctcatttttg aagtactttt ttgcaccttt ccaatggtta 360

gcacttgcag ctgttgcagt tgggattcct ccaattattt ttagaggtgt ggctgccgtg 420

cgaaacctca ctcttgacat caacattctt gttttaatag cagtggctgg atcaattgtt 480

ttacacgatt attgggaagc tggtactatt gtcttcttat tcgccattgc agaatggcta 540

gagtcaaggg caagtcacaa ggctaccgct gctatgtcat cactggtcaa tatagtccct 600

ccaacagcag ttttagctga aagcggagaa gtcgtaaatg ttgatgaagt caaggtgaat 660

agcattcttg ctgtgaaagc tggtgaaact atacctattg atggagttgt agtggaaggg 720

gaatgtgacg tggacgagaa aacactgaca ggcgagtcgt ttccagtttc taagcaaaga 780

gattcaacgg tctgggctgg cactacaaat ctaaatggct atatcagtgt taagactacg 840

gctttggctg aagattgtgc ggtggctagg atggcacagc ttgtcgaaga tgctcagaac 900

aagaaatcaa aaacccaaag atacatcgac aagtgtgcta aatattatac accagcaatt 960

gtggctatat cagcttcttt ggcaattgtt cctactgcat taagagttca caatcgaaat 1020

gaatggtatc gcttggcttt ggtcacattg gtgagtgcat gtccgtgtgc acttgttcta 1080

tctacaccag ttgccatgtg ttgcgcactt tcaaaagcag caacgtccgg tcttctgttt 1140

aaaggagcag agtaccttga gactctagct aaaatcaaaa tcatggcttt tgacaaaaca 1200

gggactataa ctaaaggaga atttatggtg accgagttca agtctctgat tgatggtttt 1260

agtctcaata cactgcttta ctgggtttca agcattgaga gcaagtcagg tcatccgatg 1320

gcagccgctc tggtggacta tgcacaatca aattccgttg agccaaagcc tgatagagtt 1380

gagcagtttc aaaattttcc tggtgaaggg atatttggaa gaattgatgg aatggaaatc 1440

tatgtcggga ataggaaaat ttcttcaaga gctggatgta ccacagtacc agaaatagag 1500

ggtgatagtt tcaaaggaaa gtctgttgga tacatatttt tgggatcatc tccagctgga 1560

attttcagtc tttccgatgt ttgtcgaatt ggtgtaaaag aagcaatgag agaactgaag 1620

cagatgggta tcaaaaccgc gatgcttact ggtgattgtt atgcagctgc caaccatgtg 1680

caggatcagt taggtggagc tttggatgaa tttcaagcag aactcctacc agaggacaag 1740

gcaacaatca tcaagggttt tcagaaggaa gctccaacag cgatgatagg cgacggcctt 1800

aatgatgctc ctgcattagc aacagctgac attggcatct caatgggcat ctctgggtca 1860

gctctcgcta aagaaacagg ccatgttata ctaatgacaa atgacatcgg aagaataccg 1920

aaagctgcac gtcttgctag aagagttcga aggaagattg ttgagaatat gattatatca 1980

gtcgttacaa aggctgccat agttgcattg gcaatagcag gttatccatt ggtttgggct 2040

gctgtcctcg cagatactgg gacatgcttg ctagtgattt tgaacagcat gctacttcta 2100

cgaggaggca cacgcagaca tgggaaaaaa tgttggagat cttctactcc ttcgcatgct 2160

ccccaccaca aagacaaagc ttcatgttgc aagtcggaaa atgctcccca gctgtgttgc 2220

tctgatattg agtcacaaaa gaaatgtaca agtcaatcat gctcgtccga ggtgtgtgtt 2280

ccaagatgtc aacctgtctc ctcaggatca aagtcatgtg gaaataatca gtgcccagac 2340

tccattgaaa atagtggttt tcattctcat ccccgtcctc aatgctgctc gtcgaagatg 2400

gctgctaaag catgccaatc tgcagtttca gaatcaaagt catgcggaaa taatcagtgc 2460

ccagactccg ttgaaaatag tggttttcat tctcatcccc gtcctgaatg ctgctcgtcg 2520

aagatggctg ctaaagcgtg ccaatctgca gtttcagaat caaagtcatg tggaaataat 2580

cagtgcccag actccgttga aaatagtggt tttcattctc atccccgtcc tcaatgctgt 2640

tcatcgaaga tggctgctaa agcaggccaa tctgcacttt cagaatcaaa gtcatgtgga 2700

aataacaatt gctcagactc cattcacaag agtaattgtc attctttaac taactctcta 2760

gtatgttctt ccaagatgtc tgctccacaa tgtcattctg ctacttcaag caacaaatca 2820

tgtggaagta ccaagtgctc cgacttcagt gacaaaaaat gttgtcaatc cgacaaaatt 2880

cctcaaacgt gctctaccaa gaagtctgct ccaggatgtc aatctgcagt ttctgggtct 2940

aaatcatgtg gaaatagcaa gtgttcagac tcaaaagaca atagtagcca tccttcacat 3000

cccgatcatc aaacatgcat gtctaagttg tgtgctccac aaagccaatc tgcaacttca 3060

agctccagga catgtggaaa tacaaagtgc tcggacacca atagcaagaa ttcttgttat 3120

tcacaaacca actctgaatc atgctcttca aagatgtctg gtccatcatg caaaactgct 3180

aattcaggtt caaggtcatg cagaaataag aagtgccagg actctgcaac cgagaacagt 3240

tttcattcac cacttactaa tccactcagt ggggaaaagc tttcggagca gaaaagcttg 3300

gatttagtcc gaaaagataa ggaatcaagt catgatcttc gtcatggctg ctctgacgag 3360

gaacatgatc atacaaattt agacaaggca tatgacagtt gtgccttaca agaatgttgt 3420

tattcggttc aaggcaataa aactgatgta tcagaaactg gaatccagga aactgctcat 3480

tgtgacagca ccaatcaaac atgccaaact gcaagttcag gatcgatgac atgcggaaat 3540

gataagatcc tggactctct aagcatccat ggttgtcatt cgcatgataa tccactccac 3600

gaggagaaca acttggagca gaaaatcttg gatgttgttg gagaaggtat aaaatcacct 3660

catgctgtcg gtcatggctg ttcggacaag gaacacgatc actcacatcc agaaaaggca 3720

tatgacagtt gtgcaacaga tgattgttgt ttttcagttc aagtccatgg cattgacgac 3780

gtatcaaaaa gtgaaattca agaaactgct cattgtgaca gcacaaagca gagcatggtc 3840

atctccagca gctgcaaaca tgaaccaaaa gatcaggtaa atcactgtgg acttcactct 3900

aaaactactc caactgatga agaactagcc aagctggtta gaagatgctg caaatacaaa 3960

ccatgccacg acgtccgttc tggctgcagg aagcatgctg cagaatgtgg tccaaccgtt 4020

cgatcaacca tcaatatctt acgggacaac catcatcatt acctagactg cagtggtcgt 4080

aaggtttgtt cgctgttgga gaagagacac atcggtggat gctgtgacag cttcagaaaa 4140

gaatgttgtg ccaagaaaaa acaccttgga gcaagttttg gaggaggttt atcagaaatt 4200

gtcatagagt ag 4212

<210> 2

<211> 1403

<212> PRT

<213>NtHMA2 aminopeptidase gene acid

<400> 2

Met Val Glu Ser Glu Lys Met Asn Glu Thr Lys Lys Leu Ser Lys Ser

1 5 10 15

Tyr Phe Asp Val Leu Gly Ile Cys Cys Thr Ser Glu Val Val Leu Val

20 25 30

Glu Lys Ile Leu Lys Asn Leu Glu Gly Val Lys Glu Val Ser Val Ile

35 40 45

Val Thr Thr Lys Thr Val Ile Val Ile His Asp Ser Leu Leu Ile Ser

50 55 60

Pro Gln Gln Ile Val Lys Ala Leu Asn Gln Ala Arg Leu Glu Ala Ser

65 70 75 80

Ile Arg Val Lys Gly Glu Lys Asn Tyr Gln Lys Lys Trp Pro Ser Pro

85 90 95

Phe Ala Ile Gly Ser Gly Ile Leu Leu Gly Leu Ser Phe Leu Lys Tyr

100 105 110

Phe Phe Ala Pro Phe Gln Trp Leu Ala Leu Ala Ala Val Ala Val Gly

115 120 125

Ile Pro Pro Ile Ile Phe Arg Gly Val Ala Ala Val Arg Asn Leu Thr

130 135 140

Leu Asp Ile Asn Ile Leu Val Leu Ile Ala Val Ala Gly Ser Ile Val

145 150 155 160

Leu His Asp Tyr Trp Glu Ala Gly Thr Ile Val Phe Leu Phe Ala Ile

165 170 175

Ala Glu Trp Leu Glu Ser Arg Ala Ser His Lys Ala Thr Ala Ala Met

180 185 190

Ser Ser Leu Val Asn Ile Val Pro Pro Thr Ala Val Leu Ala Glu Ser

195 200 205

Gly Glu Val Val Asn Val Asp Glu Val Lys Val Asn Ser Ile Leu Ala

210 215 220

Val Lys Ala Gly Glu Thr Ile Pro Ile Asp Gly Val Val Val Glu Gly

225 230 235 240

Glu Cys Asp Val Asp Glu Lys Thr Leu Thr Gly Glu Ser Phe Pro Val

245 250 255

Ser Lys Gln Arg Asp Ser Thr Val Trp Ala Gly Thr Thr Asn Leu Asn

260 265 270

Gly Tyr Ile Ser Val Lys Thr Thr Ala Leu Ala Glu Asp Cys Ala Val

275 280 285

Ala Arg Met Ala Gln Leu Val Glu Asp Ala Gln Asn Lys Lys Ser Lys

290 295 300

Thr Gln Arg Tyr Ile Asp Lys Cys Ala Lys Tyr Tyr Thr Pro Ala Ile

305 310 315 320

Val Ala Ile Ser Ala Ser Leu Ala Ile Val Pro Thr Ala Leu Arg Val

325 330 335

His Asn Arg Asn Glu Trp Tyr Arg Leu Ala Leu Val Thr Leu Val Ser

340 345 350

Ala Cys Pro Cys Ala Leu Val Leu Ser Thr Pro Val Ala Met Cys Cys

355 360 365

Ala Leu Ser Lys Ala Ala Thr Ser Gly Leu Leu Phe Lys Gly Ala Glu

370 375 380

Tyr Leu Glu Thr Leu Ala Lys Ile Lys Ile Met Ala Phe Asp Lys Thr

385 390 395 400

Gly Thr Ile Thr Lys Gly Glu Phe Met Val Thr Glu Phe Lys Ser Leu

405 410 415

Ile Asp Gly Phe Ser Leu Asn Thr Leu Leu Tyr Trp Val Ser Ser Ile

420 425 430

Glu Ser Lys Ser Gly His Pro Met Ala Ala Ala Leu Val Asp Tyr Ala

435 440 445

Gln Ser Asn Ser Val Glu Pro Lys Pro Asp Arg Val Glu Gln Phe Gln

450 455 460

Asn Phe Pro Gly Glu Gly Ile Phe Gly Arg Ile Asp Gly Met Glu Ile

465 470 475 480

Tyr Val Gly Asn Arg Lys Ile Ser Ser Arg Ala Gly Cys Thr Thr Val

485 490 495

Pro Glu Ile Glu Gly Asp Ser Phe Lys Gly Lys Ser Val Gly Tyr Ile

500 505 510

Phe Leu Gly Ser Ser Pro Ala Gly Ile Phe Ser Leu Ser Asp Val Cys

515 520 525

Arg Ile Gly Val Lys Glu Ala Met Arg Glu Leu Lys Gln Met Gly Ile

530 535 540

Lys Thr Ala Met Leu Thr Gly Asp Cys Tyr Ala Ala Ala Asn His Val

545 550 555 560

Gln Asp Gln Leu Gly Gly Ala Leu Asp Glu Phe Gln Ala Glu Leu Leu

565 570 575

Pro Glu Asp Lys Ala Thr Ile Ile Lys Gly Phe Gln Lys Glu Ala Pro

580 585 590

Thr Ala Met Ile Gly Asp Gly Leu Asn Asp Ala Pro Ala Leu Ala Thr

595 600 605

Ala Asp Ile Gly Ile Ser Met Gly Ile Ser Gly Ser Ala Leu Ala Lys

610 615 620

Glu Thr Gly His Val Ile Leu Met Thr Asn Asp Ile Gly Arg Ile Pro

625 630 635 640

Lys Ala Ala Arg Leu Ala Arg Arg Val Arg Arg Lys Ile Val Glu Asn

645 650 655

Met Ile Ile Ser Val Val Thr Lys Ala Ala Ile Val Ala Leu Ala Ile

660 665 670

Ala Gly Tyr Pro Leu Val Trp Ala Ala Val Leu Ala Asp Thr Gly Thr

675 680 685

Cys Leu Leu Val Ile Leu Asn Ser Met Leu Leu Leu Arg Gly Gly Thr

690 695 700

Arg Arg His Gly Lys Lys Cys Trp Arg Ser Ser Thr Pro Ser His Ala

705 710 715 720

Pro His His Lys Asp Lys Ala Ser Cys Cys Lys Ser Glu Asn Ala Pro

725 730 735

Gln Leu Cys Cys Ser Asp Ile Glu Ser Gln Lys Lys Cys Thr Ser Gln

740 745 750

Ser Cys Ser Ser Glu Val Cys Val Pro Arg Cys Gln Pro Val Ser Ser

755 760 765

Gly Ser Lys Ser Cys Gly Asn Asn Gln Cys Pro Asp Ser Ile Glu Asn

770 775 780

Ser Gly Phe His Ser His Pro Arg Pro Gln Cys Cys Ser Ser Lys Met

785 790 795 800

Ala Ala Lys Ala Cys Gln Ser Ala Val Ser Glu Ser Lys Ser Cys Gly

805 810 815

Asn Asn Gln Cys Pro Asp Ser Val Glu Asn Ser Gly Phe His Ser His

820 825 830

Pro Arg Pro Glu Cys Cys Ser Ser Lys Met Ala Ala Lys Ala Cys Gln

835 840 845

Ser Ala Val Ser Glu Ser Lys Ser Cys Gly Asn Asn Gln Cys Pro Asp

850 855 860

Ser Val Glu Asn Ser Gly Phe His Ser His Pro Arg Pro Gln Cys Cys

865 870 875 880

Ser Ser Lys Met Ala Ala Lys Ala Gly Gln Ser Ala Leu Ser Glu Ser

885 890 895

Lys Ser Cys Gly Asn Asn Asn Cys Ser Asp Ser Ile His Lys Ser Asn

900 905 910

Cys His Ser Leu Thr Asn Ser Leu Val Cys Ser Ser Lys Met Ser Ala

915 920 925

Pro Gln Cys His Ser Ala Thr Ser Ser Asn Lys Ser Cys Gly Ser Thr

930 935 940

Lys Cys Ser Asp Phe Ser Asp Lys Lys Cys Cys Gln Ser Asp Lys Ile

945 950 955 960

Pro Gln Thr Cys Ser Thr Lys Lys Ser Ala Pro Gly Cys Gln Ser Ala

965 970 975

Val Ser Gly Ser Lys Ser Cys Gly Asn Ser Lys Cys Ser Asp Ser Lys

980 985 990

Asp Asn Ser Ser His Pro Ser His Pro Asp His Gln Thr Cys Met Ser

995 1000 1005

Lys Leu Cys Ala Pro Gln Ser Gln Ser Ala Thr Ser Ser Ser Arg

1010 1015 1020

Thr Cys Gly Asn Thr Lys Cys Ser Asp Thr Asn Ser Lys Asn Ser

1025 1030 1035

Cys Tyr Ser Gln Thr Asn Ser Glu Ser Cys Ser Ser Lys Met Ser

1040 1045 1050

Gly Pro Ser Cys Lys Thr Ala Asn Ser Gly Ser Arg Ser Cys Arg

1055 1060 1065

Asn Lys Lys Cys Gln Asp Ser Ala Thr Glu Asn Ser Phe His Ser

1070 1075 1080

Pro Leu Thr Asn Pro Leu Ser Gly Glu Lys Leu Ser Glu Gln Lys

1085 1090 1095

Ser Leu Asp Leu Val Arg Lys Asp Lys Glu Ser Ser His Asp Leu

1100 1105 1110

Arg His Gly Cys Ser Asp Glu Glu His Asp His Thr Asn Leu Asp

1115 1120 1125

Lys Ala Tyr Asp Ser Cys Ala Leu Gln Glu Cys Cys Tyr Ser Val

1130 1135 1140

Gln Gly Asn Lys Thr Asp Val Ser Glu Thr Gly Ile Gln Glu Thr

1145 1150 1155

Ala His Cys Asp Ser Thr Asn Gln Thr Cys Gln Thr Ala Ser Ser

1160 1165 1170

Gly Ser Met Thr Cys Gly Asn Asp Lys Ile Leu Asp Ser Leu Ser

1175 1180 1185

Ile His Gly Cys His Ser His Asp Asn Pro Leu His Glu Glu Asn

1190 1195 1200

Asn Leu Glu Gln Lys Ile Leu Asp Val Val Gly Glu Gly Ile Lys

1205 1210 1215

Ser Pro His Ala Val Gly His Gly Cys Ser Asp Lys Glu His Asp

1220 1225 1230

His Ser His Pro Glu Lys Ala Tyr Asp Ser Cys Ala Thr Asp Asp

1235 1240 1245

Cys Cys Phe Ser Val Gln Val His Gly Ile Asp Asp Val Ser Lys

1250 1255 1260

Ser Glu Ile Gln Glu Thr Ala His Cys Asp Ser Thr Lys Gln Ser

1265 1270 1275

Met Val Ile Ser Ser Ser Cys Lys His Glu Pro Lys Asp Gln Val

1280 1285 1290

Asn His Cys Gly Leu His Ser Lys Thr Thr Pro Thr Asp Glu Glu

1295 1300 1305

Leu Ala Lys Leu Val Arg Arg Cys Cys Lys Tyr Lys Pro Cys His

1310 1315 1320

Asp Val Arg Ser Gly Cys Arg Lys His Ala Ala Glu Cys Gly Pro

1325 1330 1335

Thr Val Arg Ser Thr Ile Asn Ile Leu Arg Asp Asn His His His

1340 1345 1350

Tyr Leu Asp Cys Ser Gly Arg Lys Val Cys Ser Leu Leu Glu Lys

1355 1360 1365

Arg His Ile Gly Gly Cys Cys Asp Ser Phe Arg Lys Glu Cys Cys

1370 1375 1380

Ala Lys Lys Lys His Leu Gly Ala Ser Phe Gly Gly Gly Leu Ser

1385 1390 1395

Glu Ile Val Ile Glu

1400

<210> 3

<211> 4212

<212> DNA

<213>NtHMA2 gene mutation body nucleotide

<400> 3

atggtggaaa gtgaaaaaat gaatgaaaca aagaagttga gcaagagcta ttttgatgtt 60

ttgggaattt gctgtacttc agaagttgtt ctagttgaaa aaattctcaa gaatcttgaa 120

ggggttaaag aggtttcagt aattgtcaca acaaagactg tcattgttat tcatgattct 180

cttctcattt ctccgcaaca aattgttaaa gcattgaatc aagcaagatt agaagcaagc 240

ataagagtga aaggagagaa aaactaccaa aagaaatggc caagtccatt tgcaattggc 300

agtggaatat tgcttggact ctcatttttg aagtactttt ttgcaccttt ccaatggtta 360

gcacttgcag ctgttgcagt tgggattcct ccaattattt ttagaggtgt ggctgccgtg 420

cgaaacctca ctcttgacat caacattctt gttttaatag cagtggctgg atcaattgtt 480

ttacacgatt attgggaagc tggtactatt gtcttcttat tcgccattgc agaatggcta 540

gagtcaaggg caagtcacaa ggctaccgct gctatgtcat cactggtcaa tatagtccct 600

ccaacagcag ttttagctga aagcggagaa gtcgtaaatg ttgatgaagt caaggtgaat 660

agcattcttg ctgtgaaagc tggtgaaact atacctattg atggagttgt agtggaaggg 720

gaatgtgacg tggacgagaa aacactgaca ggcgagtcgt ttccagtttc taagcaaaga 780

gattcaacgg tctgggctgg cactacaaat ctaaatggct atatcagtgt taagactacg 840

gctttggctg aagattgtgc ggtggctagg atggcatagc ttgtcgaaga tgctcagaac 900

aagaaatcaa aaacccaaag atacatcgac aagtgtgcta aatattatac accagcaatt 960

gtggctatat cagcttcttt ggcaattgtt cctactgcat taagagttca caatcgaaat 1020

gaatggtatc gcttggcttt ggtcacattg gtgagtgcat gtccgtgtgc acttgttcta 1080

tctacaccag ttgccatgtg ttgcgcactt tcaaaagcag caacgtccgg tcttctgttt 1140

aaaggagcag agtaccttga gactctagct aaaatcaaaa tcatggcttt tgacaaaaca 1200

gggactataa ctaaaggaga atttatggtg accgagttca agtctctgat tgatggtttt 1260

agtctcaata cactgcttta ctgggtttca agcattgaga gcaagtcagg tcatccgatg 1320

gcagccgctc tggtggacta tgcacaatca aattccgttg agccaaagcc tgatagagtt 1380

gagcagtttc aaaattttcc tggtgaaggg atatttggaa gaattgatgg aatggaaatc 1440

tatgtcggga ataggaaaat ttcttcaaga gctggatgta ccacagtacc agaaatagag 1500

ggtgatagtt tcaaaggaaa gtctgttgga tacatatttt tgggatcatc tccagctgga 1560

attttcagtc tttccgatgt ttgtcgaatt ggtgtaaaag aagcaatgag agaactgaag 1620

cagatgggta tcaaaaccgc gatgcttact ggtgattgtt atgcagctgc caaccatgtg 1680

caggatcagt taggtggagc tttggatgaa tttcaagcag aactcctacc agaggacaag 1740

gcaacaatca tcaagggttt tcagaaggaa gctccaacag cgatgatagg cgacggcctt 1800

aatgatgctc ctgcattagc aacagctgac attggcatct caatgggcat ctctgggtca 1860

gctctcgcta aagaaacagg ccatgttata ctaatgacaa atgacatcgg aagaataccg 1920

aaagctgcac gtcttgctag aagagttcga aggaagattg ttgagaatat gattatatca 1980

gtcgttacaa aggctgccat agttgcattg gcaatagcag gttatccatt ggtttgggct 2040

gctgtcctcg cagatactgg gacatgcttg ctagtgattt tgaacagcat gctacttcta 2100

cgaggaggca cacgcagaca tgggaaaaaa tgttggagat cttctactcc ttcgcatgct 2160

ccccaccaca aagacaaagc ttcatgttgc aagtcggaaa atgctcccca gctgtgttgc 2220

tctgatattg agtcacaaaa gaaatgtaca agtcaatcat gctcgtccga ggtgtgtgtt 2280

ccaagatgtc aacctgtctc ctcaggatca aagtcatgtg gaaataatca gtgcccagac 2340

tccattgaaa atagtggttt tcattctcat ccccgtcctc aatgctgctc gtcgaagatg 2400

gctgctaaag catgccaatc tgcagtttca gaatcaaagt catgcggaaa taatcagtgc 2460

ccagactccg ttgaaaatag tggttttcat tctcatcccc gtcctgaatg ctgctcgtcg 2520

aagatggctg ctaaagcgtg ccaatctgca gtttcagaat caaagtcatg tggaaataat 2580

cagtgcccag actccgttga aaatagtggt tttcattctc atccccgtcc tcaatgctgt 2640

tcatcgaaga tggctgctaa agcaggccaa tctgcacttt cagaatcaaa gtcatgtgga 2700

aataacaatt gctcagactc cattcacaag agtaattgtc attctttaac taactctcta 2760

gtatgttctt ccaagatgtc tgctccacaa tgtcattctg ctacttcaag caacaaatca 2820

tgtggaagta ccaagtgctc cgacttcagt gacaaaaaat gttgtcaatc cgacaaaatt 2880

cctcaaacgt gctctaccaa gaagtctgct ccaggatgtc aatctgcagt ttctgggtct 2940

aaatcatgtg gaaatagcaa gtgttcagac tcaaaagaca atagtagcca tccttcacat 3000

cccgatcatc aaacatgcat gtctaagttg tgtgctccac aaagccaatc tgcaacttca 3060

agctccagga catgtggaaa tacaaagtgc tcggacacca atagcaagaa ttcttgttat 3120

tcacaaacca actctgaatc atgctcttca aagatgtctg gtccatcatg caaaactgct 3180

aattcaggtt caaggtcatg cagaaataag aagtgccagg actctgcaac cgagaacagt 3240

tttcattcac cacttactaa tccactcagt ggggaaaagc tttcggagca gaaaagcttg 3300

gatttagtcc gaaaagataa ggaatcaagt catgatcttc gtcatggctg ctctgacgag 3360

gaacatgatc atacaaattt agacaaggca tatgacagtt gtgccttaca agaatgttgt 3420

tattcggttc aaggcaataa aactgatgta tcagaaactg gaatccagga aactgctcat 3480

tgtgacagca ccaatcaaac atgccaaact gcaagttcag gatcgatgac atgcggaaat 3540

gataagatcc tggactctct aagcatccat ggttgtcatt cgcatgataa tccactccac 3600

gaggagaaca acttggagca gaaaatcttg gatgttgttg gagaaggtat aaaatcacct 3660

catgctgtcg gtcatggctg ttcggacaag gaacacgatc actcacatcc agaaaaggca 3720

tatgacagtt gtgcaacaga tgattgttgt ttttcagttc aagtccatgg cattgacgac 3780

gtatcaaaaa gtgaaattca agaaactgct cattgtgaca gcacaaagca gagcatggtc 3840

atctccagca gctgcaaaca tgaaccaaaa gatcaggtaa atcactgtgg acttcactct 3900

aaaactactc caactgatga agaactagcc aagctggtta gaagatgctg caaatacaaa 3960

ccatgccacg acgtccgttc tggctgcagg aagcatgctg cagaatgtgg tccaaccgtt 4020

cgatcaacca tcaatatctt acgggacaac catcatcatt acctagactg cagtggtcgt 4080

aaggtttgtt cgctgttgga gaagagacac atcggtggat gctgtgacag cttcagaaaa 4140

gaatgttgtg ccaagaaaaa acaccttgga gcaagttttg gaggaggttt atcagaaatt 4200

gtcatagagt ag 4212

<210> 4

<211> 292

<212> PRT

<213>NtHMA2 gene mutation body amino acid

<400> 4

Met Val Glu Ser Glu Lys Met Asn Glu Thr Lys Lys Leu Ser Lys Ser

1 5 10 15

Tyr Phe Asp Val Leu Gly Ile Cys Cys Thr Ser Glu Val Val Leu Val

20 25 30

Glu Lys Ile Leu Lys Asn Leu Glu Gly Val Lys Glu Val Ser Val Ile

35 40 45

Val Thr Thr Lys Thr Val Ile Val Ile His Asp Ser Leu Leu Ile Ser

50 55 60

Pro Gln Gln Ile Val Lys Ala Leu Asn Gln Ala Arg Leu Glu Ala Ser

65 70 75 80

Ile Arg Val Lys Gly Glu Lys Asn Tyr Gln Lys Lys Trp Pro Ser Pro

85 90 95

Phe Ala Ile Gly Ser Gly Ile Leu Leu Gly Leu Ser Phe Leu Lys Tyr

100 105 110

Phe Phe Ala Pro Phe Gln Trp Leu Ala Leu Ala Ala Val Ala Val Gly

115 120 125

Ile Pro Pro Ile Ile Phe Arg Gly Val Ala Ala Val Arg Asn Leu Thr

130 135 140

Leu Asp Ile Asn Ile Leu Val Leu Ile Ala Val Ala Gly Ser Ile Val

145 150 155 160

Leu His Asp Tyr Trp Glu Ala Gly Thr Ile Val Phe Leu Phe Ala Ile

165 170 175

Ala Glu Trp Leu Glu Ser Arg Ala Ser His Lys Ala Thr Ala Ala Met

180 185 190

Ser Ser Leu Val Asn Ile Val Pro Pro Thr Ala Val Leu Ala Glu Ser

195 200 205

Gly Glu Val Val Asn Val Asp Glu Val Lys Val Asn Ser Ile Leu Ala

210 215 220

Val Lys Ala Gly Glu Thr Ile Pro Ile Asp Gly Val Val Val Glu Gly

225 230 235 240

Glu Cys Asp Val Asp Glu Lys Thr Leu Thr Gly Glu Ser Phe Pro Val

245 250 255

Ser Lys Gln Arg Asp Ser Thr Val Trp Ala Gly Thr Thr Asn Leu Asn

260 265 270

Gly Tyr Ile Ser Val Lys Thr Thr Ala Leu Ala Glu Asp Cys Ala Val

275 280 285

Ala Arg Met Ala

290

<210> 5

<211> 24

<212> DNA

<213> HMA2-F

<400> 5

aatatagaga tggccaatga aggt 24

<210> 6

<211> 25

<212> DNA

<213> HMA2-R

<400> 6

ctaaaattta tatgaccaag tactt 25

Claims (2)

1. a kind ofNtHMA2Gene mutation body, it is characterised in that describedNtHMA2The nucleotide sequence of gene mutation body such as SEQ ID Shown in No:3, with wild-type tobacco shown in SEQ ID No:1NtHMA2Gene nucleotide series are compared, what mutant containedNtHMA2The C that gene order is 877 sports T, forms terminator codon, terminates the gene in advance.

2. described in a kind of claim 1NtHMA2Gene mutation body in reducing tobacco leaf cadmium, zinc, iron, lead, chromium, nickel, in arsenic content Application.