CN106636136B - A kind of NtHMA2 gene mutation body and application - Google Patents
A kind of NtHMA2 gene mutation body and application Download PDFInfo
- Publication number
- CN106636136B CN106636136B CN201710033488.1A CN201710033488A CN106636136B CN 106636136 B CN106636136 B CN 106636136B CN 201710033488 A CN201710033488 A CN 201710033488A CN 106636136 B CN106636136 B CN 106636136B
- Authority
- CN
- China
- Prior art keywords
- ser
- ala
- lys
- val
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses one kindNtHMA2Gene mutation body,NtHMA2The mutation of a nucleotide occurs in gene, it is unmutatedNtHMA2Sequence includes the nucleotide sequence of SEQ ID NO:1.Wherein, 877 C sport T, form terminator codon, terminate the gene in advance.Tobacco containing mutant nucleotide sequence reduces by 40% or so compared to the tobacco leaf cadmium content containing SEQ ID NO:1 sequence, and zinc, iron, lead, chromium, nickel equal size reduce by 30% or so, and arsenic content reduces by 10% or so.
Description
Technical field
The invention belongs to genetic engineering technology fields, and in particular to a kind ofNtHMA2Gene mutation body and application.
Background technique
Cadmium (Cd), arsenic (As), chromium (Cr), mercury (Hg) and lead (Pb) etc. are generally acknowledged to plant and human body harm
Bigger heavy metal element, plant essential trace element zinc (Zn), nickel (Ni), copper (Cu) if etc. excessive can also produce
Raw harm.So increasingly causing the attention of scientific research personnel about crop heavy metal pollution and its research for reducing method.Tobacco
(Nicotiana tabacum) industrial crops are important, it is Solanaceae annual herb plant.In recent years about a huge sum of money in tobacco
The research of category is increasingly becoming a hot spot of tobacco harm reduction research.
Heavy metal can have an adverse effect to cigarette quality.Nicotine content is an important indicator for measuring quality of tobacco,
The raising that nicotine is conducive to quality of tobacco is improved in a certain range, and Cd pollution can reduce nicotine content of tobacco leaves, and possible cause is
Root synthesis nicotinic pathway or nicotine are obstructed to top transport process.In addition, soluble sugar is extremely sensitive to Cd, Pb in tobacco leaf,
Slight pollution will lead to its content and be decreased obviously, this may be since heavy metal destroys tobacco chloroplast, photosynthesis by
Caused by resistance.Heavy metal will lead to tobacco leaf sugar alkali ratio and nitrogen base ratio increases, and chemical component composition is unbalance, and quality is affected.
Heavy metal is huge to the harm of human body, and such as excessive cadmium enters in human body and may damage to blood vessel;In addition cadmium
Element is inhibited to intestinal absorption iron, can also interfere the metabolic process of the microelements such as cobalt, copper, zinc, cause lung, kidney,
The human bodies organ injury such as liver, the effects of carcinogenic, teratogenesis and mutagenesis may finally be caused.Arsenic can induce many diseases, such as anxious
Property arsenic poisoning can cause central nervous system disorder cause total numbness, respiratory tract and Alimentary tract disease even quick death;Slowly
Property arsenic poisoning leads to the skins such as nerve problems, malaise, appetite stimulator, nausea and cutaneous pigmentation and keratosis
Lesion etc., and the diseases such as lung cancer, cutaneum carcinoma and bladder cancer can be caused.Zn-ef ficiency be human body important microelement it
One, there is vital effect to the growth and development of human body, intelligence, immune function even eyesight.But the zinc in human body
It is not The more the better.The zinc of human body excess intake, is easily converted to zinc chloride in gastric juice, has stronger corrosivity to stomach lining,
It can cause gastric mucosa congestion, oedema, even bleeding.Excessive blood zinc can inhibit the phagocytic function of leucocyte, be under resistance of human body
Drop is infected vulnerable to germ.Excessive zinc also will affect the absorption and metabolism of other inorganic salts of human body, such as influences the absorption of iron, makes
It is excessively high to be damaged into cu zn ratio for iron metabolism in liver;Cholesterol metabolic is influenced, hypercholesterolemia etc. is formed.Nickel and its esters
Toxicity it is lower, but since itself has biochemical activity, therefore a series of enzyme (arginase, carboxylic can be activated or inhibited
Change enzyme, acid phosphatase and open up decarboxylase) and play its toxicity.Nickel can cause contact dermatitis.It is directly entered the nickel salt of blood
Toxicity is higher, and colloid nickel or nickel chloride are more toxic, and can cause central circulation and disordered breathing, go out cardiac muscle, brain, lung and kidney
Existing oedema, bleeding and denaturation.
Tobacco is the important industrial crops in China, and heavy metal pollution not only influences tobacco growth and development itself, to smoker
Health also have serious threat.Harm reduction is always an important directions of tobacco research work, wherein reducing heavy metal
Content is an important public relations goal.
Summary of the invention
The first object of the present invention is to provide one kindNtHMA2The EMS mutant of gene;Second is designed to provide institute
It statesNtHMA2The application of gene mutation body.
The first object of the present invention is achieved in that and wild-type tobaccoNtHMA2Gene has as in sequence table
Nucleotide sequence shown in SEQ ID No:1 is compared, what mutant containedNtHMA2The C that gene order is 877 sports T, shape
At terminator codon, terminate the gene in advance.
DescribedNtHMA2The preparation method of the EMS mutant of gene includes EMS mutagenesis and TILLING screening mutant.
EMS mutagenesis tobacco seed:
A: utilizing white water treatment tobacco seed, then rotating centrifugal and is filtered dry;
B: rinsing seed, removes bleaching water, influences seed by bleaching agent chemical component, then revolved
Turn centrifugation to be filtered dry;
C: it is impregnated 10 ~ 15 hours in the deionized water at a temperature of seed is placed on 10 DEG C ~ 30 DEG C, tobacco seed vernalization is sprouted
Then hair is carried out rotating centrifugal and is filtered dry with the uniform mutagenic treatment of sharp seed;
Seed: being placed on 10 ~ 15 hours of immersion treatment in 0.5% EMS (ethylmethane sulfonate) mutagenesis agent solution by D,
Then rotating centrifugal is carried out to be filtered dry;
E: seed being placed in rinsing aid solution and is rinsed, then is rinsed with deionized water, and 5 ~ 8 this processes are repeated,
Then Buchner funnel filter paper filtration drying.
TILLING screens the mutant of nucleotide variation
A: seed (M1 generation) sowing and crop field, single plant bagging after mutagenic treatment are selfed sowing and obtain M2 generation, each M1 generation
The M2 of single plant harvest sows 1 seed for seed.
B: M2 is taken to extract mutant material blade DNA using QIAGEN DNA extraction kit for mutant single-strain blade.
C: sample concentration measures and builds pond
By sample big minispread in sequence.16 channel Tecan infinite M200 instrument of 2ul DNA sample is taken respectively
Concentration mensuration is carried out on device.All sample concentrations are diluted to 40ng/ul, 8 times of ponds DNA is made and is analyzed for TILLING.
D: it is designed using Primer3NtHMA2Gene TILLING analyzes primer, HMA2-F:
AATATAGAGATGGCCAATGAAGGT and HMA2-R:CTAAAATTTATATGACCAAGTACTT, amplification length
For 1400bp or so.
E:TILLING analysis M2 screens the single plant of coding mutation for mutant, and carries out sequence verification, obtains one
Mutant, 520 C of CDS sport T, form terminator codon, terminate the gene in advance.
F: in M3 for the plant of mutant screening mutational site homozygosis, it is selfed sowing.
G: Cd uptake test is carried out to Mutants homozygous, specially in cigarette strain squaring period, by 100 μm of ol CdCL2Solution
500mL is poured in cigarette strain root.Blade is taken after 5 days, water-removing drying detects content of beary metal.
H: the tobacco containing mutant nucleotide sequence reduces by 40% left side compared to the tobacco leaf cadmium content containing SEQ ID NO:1 sequence
The right side, zinc, iron, lead, chromium, nickel equal size reduce by 30% or so, and arsenic content reduces by 10% or so.
The second object of the present invention is achieved in thatNtHMA2Gene mutation body can make tobacco leaf cadmium content reduce by 30 ~
50%, zinc, iron, lead, chromium, nickel equal size reduce by 20 ~ 40% or so, and arsenic content reduces by 5 ~ 15% or so.I.e. with describedNtHMA2Base
Because mutant obtains the tobacco of low-heavy metal content.
Detailed description of the invention
Fig. 1 is that peak figure is sequenced in mutant mutational site;
Fig. 2 is the present inventionNtHMA2Mutant and 87 blade cadmium content contrast schematic diagram of cloud and mist;
Fig. 3 is the present inventionNtHMA2Mutant and 87 blade Zn content contrast schematic diagram of cloud and mist;
Fig. 4 is the present inventionNtHMA2Mutant and 87 blade iron content balance schematic diagram of cloud and mist;
Fig. 5 is the present inventionNtHMA2Mutant and 87 blade arsenic content contrast schematic diagram of cloud and mist;
Fig. 6 is the present inventionNtHMA2Mutant and 87 blade chromium content contrast schematic diagram of cloud and mist;
Fig. 7 is the present inventionNtHMA2Mutant and 87 blade nickel content contrast schematic diagram of cloud and mist.
Specific embodiment
Below with reference to embodiment and attached drawing, the present invention is further illustrated, but is not subject in any way to the present invention
Limitation, based on present invention teach that it is made it is any transform or replace, all belong to the scope of protection of the present invention.
NtHMA2 gene mutation body of the present invention, with wild-type tobaccoNtHMA2Gene has as in sequence table
Nucleotide sequence shown in SEQ ID No:1 is compared, what mutant containedNtHMA2The C that gene order is 877 sports T, shape
At terminator codon, terminate the gene in advance.
NtHMA2The amino acid sequence of gene coding is as shown in SEQ ID No:2;
NtHMA2The nucleotide sequence of gene mutation body is as shown in SEQ ID No:3;
NtHMA2The amino acid sequence of gene mutation body coding is as shown in SEQ ID No:4;
DescribedNtHMA2The preparation method of the EMS mutant of gene includes EMS mutagenesis and TILLING screening mutant.
EMS mutagenesis tobacco seed:
A: utilizing white water treatment tobacco seed, then rotating centrifugal and is filtered dry;
B: rinsing seed, removes bleaching water, influences seed by bleaching agent chemical component, then revolved
Turn centrifugation to be filtered dry;
C: it is impregnated 10 ~ 15 hours in the deionized water at a temperature of seed is placed on 10 DEG C ~ 30 DEG C, tobacco seed vernalization is sprouted
Then hair is carried out rotating centrifugal and is filtered dry with the uniform mutagenic treatment of sharp seed;
Seed: being placed on 10 ~ 15 hours of immersion treatment in 0.5% EMS (ethylmethane sulfonate) mutagenesis agent solution by D,
Then rotating centrifugal is carried out to be filtered dry;
E: seed being placed in rinsing aid solution and is rinsed, then is rinsed with deionized water, and 5 ~ 8 this processes are repeated,
Then Buchner funnel filter paper filtration drying.
TILLING screens the mutant of nucleotide variation
A: seed (M1 generation) sowing and crop field, single plant bagging after mutagenic treatment are selfed sowing and obtain M2 generation, each M1 generation
The M2 of single plant harvest sows 1 seed for seed.
B: M2 is taken to extract mutant material blade DNA using QIAGEN DNA extraction kit for mutant single-strain blade.
C: sample concentration measures and builds pond
By sample big minispread in sequence.16 channel Tecan infinite M200 instrument of 2ul DNA sample is taken respectively
Concentration mensuration is carried out on device.All sample concentrations are diluted to 40ng/ul, 8 times of ponds DNA is made and is analyzed for TILLING.
D: it is designed using Primer3NtHMA2Gene TILLING analyzes primer,
HMA2-F:AATATAGAGATGGCCAATGAAGGT and
HMA2-R:CTAAAATTTATATGACCAAGTACTT, amplification length are 1400bp or so.
E:TILLING analysis M2 screens the single plant of coding mutation for mutant, and carries out sequence verification, obtains one
Mutant, 520 C of CDS sport T, form terminator codon, terminate the gene in advance.
F: in M3 for the plant of mutant screening mutational site homozygosis, it is selfed sowing.
G: Cd uptake test is carried out to Mutants homozygous, specially in cigarette strain squaring period, by 100 μm of ol CdCL2Solution
500mL is poured in cigarette strain root.Blade is taken after 5 days, water-removing drying detects content of beary metal.
H: the tobacco containing mutant nucleotide sequence reduces by 40% left side compared to the tobacco leaf cadmium content containing SEQ ID NO:1 sequence
The right side, zinc, iron, lead, chromium, nickel equal size reduce by 30% or so, and arsenic content reduces by 10% or so.
Application of the present invention isNtHMA2Gene mutation body can make tobacco leaf cadmium content reduce by 30 ~ 50% or so, zinc,
Iron, lead, chromium, nickel equal size reduce by 20 ~ 40% or so, and arsenic content reduces by 5 ~ 15% or so.I.e. with describedNtHMA2Gene mutation
The tobacco of body acquisition low-heavy metal content.
It is described further below with case is embodied to the present invention:
DescribedNtHMA2The preparation method of mutant, it is unmutatedNtHMA2Such as sequence table of the nucleotide sequence of mutant
Shown in middle SEQ ID No:1, nucleotide sequence 877 C of mutant sport T, specific preparation method the following steps are included:
(1) it selects 50% white water treatment cloud and mist, 87 seed 6 minutes, centrifugation is filtered dry;
(2) rinsing 1 minute is carried out to seed using deionization, centrifugation is filtered dry removal bleaching water constituent;
(3) room temperature condition, deionized water impregnated tobacco seed 10-12 hours, centrifugation is filtered dry;
(4) room temperature condition, 0.50%EMS ethylmethane sulfonate are handled tobacco seed 12 hours, and centrifugation is filtered dry;
(5) deionized water is added to rinse 1 minute, centrifugation is filtered dry, and repeats rinsing 8 times altogether.Then Buchner funnel filter paper filters
It is dry.
(6) seed after mutagenic treatment (M1 generation) sowing and crop field, single plant bagging are selfed sowing and obtain M2 generation, each M1 generation
The M2 of single plant harvest sows 1 seed for seed, obtains 1842 M2 altogether for single plant.
(7) M2 is taken to extract mutant material blade using QIAGEN DNA extraction kit for mutant single-strain blade
DNA.Specific step is as follows: collecting by sample liquid nitrogen grinding, and with 1.5ml centrifuge tube;The AP1 solution of 400ul is added, 4ul's
RNA enzyme mixes;Sample is put into 65 DEG C of water-bath water-bath 10min, is during which shaken up 3 times;It is molten that 130ul P3 is added into sample
Liquid, ice bath 5mim;High speed centrifugation, 13200rpm, 5min;Upper liquid is taken to pour into purple Filter column, 13200rpm, 2min centrifugation;
Filtrate is transferred to new 1.5mL centrifuge tube and the AW1 solution that 675ul is added mixes;Mixing sample solution point 2 times are transferred to yellowish
Chromogenic filter column simultaneously carries out 10000rpm, 1min centrifugation, reject filtrate;Faint yellow Filter column is put into new 2ml centrifuge tube simultaneously
The AW2 solution of 500ul is added, carries out 10000rpm, 1min centrifugation is abandoned filtrate (this step is repeated twice);Again reject filtrate
Faint yellow Filter column dallied (10000rpm, 1min), the faint yellow Filter column to have dallied is put into new 1.5ml and is centrifuged
5min is stood after 50ul AE solution is added in pipe, centrifuge is put into and carries out 10000rpm, 1min centrifugation removes yellowish chromogenic filter
Column is put into 4 DEG C of refrigerators and saves.
(8) sample concentration measures and builds pond
By sample big minispread in sequence.16 channel Tecan infinite M200 instrument of 2ul DNA sample is taken respectively
Concentration mensuration is carried out on device.All sample concentrations are diluted to 40ng/ul, 8 times of ponds DNA is made and is analyzed for TILLING.
(9) it is designed using Primer3NtHMA2Gene TILLING analyzes primer,
HMA2-F:AATATAGAGATGGCCAATGAAGGT and
HMA2-R:CTAAAATTTATATGACCAAGTACTT, amplification length are 1400bp or so.
(10) TILLING analyzes M2 for mutant, amplification system are as follows: 1.0 μ l 10 × buffer, 0.8 μ l dNTP
(2.5mM), 0.16 μ l HMA2-F primer (10 μM), 0.16 μ l HMA2-R primer (10uM), 6.78 μ l
H2O, 1.0 μ l DNA profilings (20ng/ul).Response procedures be 95 DEG C of 3min, 94 DEG C of 30s, 62 DEG C of 30s, -1 DEG C/follow
Ring, 72 DEG C of 1min, 7 circulations;94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, 40 circulations, 72 DEG C of 5min;99℃ 10min;70
DEG C 20s, -0.3 DEG C/circulation, 70 circulations, 4 DEG C of preservations.Amplified production is analyzed by Capillary Electrophoresis.
(11) single plant of the coding mutation filtered out carries out sequence verification, obtains a mutant,NtHMA2Gene
520 C of CDS sport T, form terminator codon, terminate the gene in advance.
(12) sowing is selfed for the plant (Fig. 1) for screening mutational site homozygosis in mutant by sequencing in M3.
NtHMA2Mutant reduce tobacco leaf content of beary metal method the following steps are included:
(1) Cd uptake test is carried out to Mutants homozygous, specially in chamber planting Mutants homozygous and wild type control,
Cigarette strain squaring period, by 100 μm of ol CdCL2Solution 500mL is poured and is taken blade behind cigarette strain root, 5 days, water-removing drying.Utilize tobacco
The method of professional standard YC/T380-2010 detects tobacco leaf content of beary metal.
(2) tobacco containing mutant nucleotide sequence reduces by 40% left side compared to the tobacco leaf cadmium content containing SEQ ID NO:1 sequence
The right side, zinc, iron, lead, chromium, nickel equal size reduce by 30% or so, and arsenic content reduces by 10% or so (table 1, Fig. 2 ~ Fig. 7).
1 tobacco leaf content of beary metal of table
。
SEQUENCE LISTING
<110>Yunnan Academy of Tobacco Agricultural Science
<120>a kind of NtHMA2 mutant and application
<130> 2017
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 4212
<212> DNA
<213>NtHMA2 gene nucleotide
<400> 1
atggtggaaa gtgaaaaaat gaatgaaaca aagaagttga gcaagagcta ttttgatgtt 60
ttgggaattt gctgtacttc agaagttgtt ctagttgaaa aaattctcaa gaatcttgaa 120
ggggttaaag aggtttcagt aattgtcaca acaaagactg tcattgttat tcatgattct 180
cttctcattt ctccgcaaca aattgttaaa gcattgaatc aagcaagatt agaagcaagc 240
ataagagtga aaggagagaa aaactaccaa aagaaatggc caagtccatt tgcaattggc 300
agtggaatat tgcttggact ctcatttttg aagtactttt ttgcaccttt ccaatggtta 360
gcacttgcag ctgttgcagt tgggattcct ccaattattt ttagaggtgt ggctgccgtg 420
cgaaacctca ctcttgacat caacattctt gttttaatag cagtggctgg atcaattgtt 480
ttacacgatt attgggaagc tggtactatt gtcttcttat tcgccattgc agaatggcta 540
gagtcaaggg caagtcacaa ggctaccgct gctatgtcat cactggtcaa tatagtccct 600
ccaacagcag ttttagctga aagcggagaa gtcgtaaatg ttgatgaagt caaggtgaat 660
agcattcttg ctgtgaaagc tggtgaaact atacctattg atggagttgt agtggaaggg 720
gaatgtgacg tggacgagaa aacactgaca ggcgagtcgt ttccagtttc taagcaaaga 780
gattcaacgg tctgggctgg cactacaaat ctaaatggct atatcagtgt taagactacg 840
gctttggctg aagattgtgc ggtggctagg atggcacagc ttgtcgaaga tgctcagaac 900
aagaaatcaa aaacccaaag atacatcgac aagtgtgcta aatattatac accagcaatt 960
gtggctatat cagcttcttt ggcaattgtt cctactgcat taagagttca caatcgaaat 1020
gaatggtatc gcttggcttt ggtcacattg gtgagtgcat gtccgtgtgc acttgttcta 1080
tctacaccag ttgccatgtg ttgcgcactt tcaaaagcag caacgtccgg tcttctgttt 1140
aaaggagcag agtaccttga gactctagct aaaatcaaaa tcatggcttt tgacaaaaca 1200
gggactataa ctaaaggaga atttatggtg accgagttca agtctctgat tgatggtttt 1260
agtctcaata cactgcttta ctgggtttca agcattgaga gcaagtcagg tcatccgatg 1320
gcagccgctc tggtggacta tgcacaatca aattccgttg agccaaagcc tgatagagtt 1380
gagcagtttc aaaattttcc tggtgaaggg atatttggaa gaattgatgg aatggaaatc 1440
tatgtcggga ataggaaaat ttcttcaaga gctggatgta ccacagtacc agaaatagag 1500
ggtgatagtt tcaaaggaaa gtctgttgga tacatatttt tgggatcatc tccagctgga 1560
attttcagtc tttccgatgt ttgtcgaatt ggtgtaaaag aagcaatgag agaactgaag 1620
cagatgggta tcaaaaccgc gatgcttact ggtgattgtt atgcagctgc caaccatgtg 1680
caggatcagt taggtggagc tttggatgaa tttcaagcag aactcctacc agaggacaag 1740
gcaacaatca tcaagggttt tcagaaggaa gctccaacag cgatgatagg cgacggcctt 1800
aatgatgctc ctgcattagc aacagctgac attggcatct caatgggcat ctctgggtca 1860
gctctcgcta aagaaacagg ccatgttata ctaatgacaa atgacatcgg aagaataccg 1920
aaagctgcac gtcttgctag aagagttcga aggaagattg ttgagaatat gattatatca 1980
gtcgttacaa aggctgccat agttgcattg gcaatagcag gttatccatt ggtttgggct 2040
gctgtcctcg cagatactgg gacatgcttg ctagtgattt tgaacagcat gctacttcta 2100
cgaggaggca cacgcagaca tgggaaaaaa tgttggagat cttctactcc ttcgcatgct 2160
ccccaccaca aagacaaagc ttcatgttgc aagtcggaaa atgctcccca gctgtgttgc 2220
tctgatattg agtcacaaaa gaaatgtaca agtcaatcat gctcgtccga ggtgtgtgtt 2280
ccaagatgtc aacctgtctc ctcaggatca aagtcatgtg gaaataatca gtgcccagac 2340
tccattgaaa atagtggttt tcattctcat ccccgtcctc aatgctgctc gtcgaagatg 2400
gctgctaaag catgccaatc tgcagtttca gaatcaaagt catgcggaaa taatcagtgc 2460
ccagactccg ttgaaaatag tggttttcat tctcatcccc gtcctgaatg ctgctcgtcg 2520
aagatggctg ctaaagcgtg ccaatctgca gtttcagaat caaagtcatg tggaaataat 2580
cagtgcccag actccgttga aaatagtggt tttcattctc atccccgtcc tcaatgctgt 2640
tcatcgaaga tggctgctaa agcaggccaa tctgcacttt cagaatcaaa gtcatgtgga 2700
aataacaatt gctcagactc cattcacaag agtaattgtc attctttaac taactctcta 2760
gtatgttctt ccaagatgtc tgctccacaa tgtcattctg ctacttcaag caacaaatca 2820
tgtggaagta ccaagtgctc cgacttcagt gacaaaaaat gttgtcaatc cgacaaaatt 2880
cctcaaacgt gctctaccaa gaagtctgct ccaggatgtc aatctgcagt ttctgggtct 2940
aaatcatgtg gaaatagcaa gtgttcagac tcaaaagaca atagtagcca tccttcacat 3000
cccgatcatc aaacatgcat gtctaagttg tgtgctccac aaagccaatc tgcaacttca 3060
agctccagga catgtggaaa tacaaagtgc tcggacacca atagcaagaa ttcttgttat 3120
tcacaaacca actctgaatc atgctcttca aagatgtctg gtccatcatg caaaactgct 3180
aattcaggtt caaggtcatg cagaaataag aagtgccagg actctgcaac cgagaacagt 3240
tttcattcac cacttactaa tccactcagt ggggaaaagc tttcggagca gaaaagcttg 3300
gatttagtcc gaaaagataa ggaatcaagt catgatcttc gtcatggctg ctctgacgag 3360
gaacatgatc atacaaattt agacaaggca tatgacagtt gtgccttaca agaatgttgt 3420
tattcggttc aaggcaataa aactgatgta tcagaaactg gaatccagga aactgctcat 3480
tgtgacagca ccaatcaaac atgccaaact gcaagttcag gatcgatgac atgcggaaat 3540
gataagatcc tggactctct aagcatccat ggttgtcatt cgcatgataa tccactccac 3600
gaggagaaca acttggagca gaaaatcttg gatgttgttg gagaaggtat aaaatcacct 3660
catgctgtcg gtcatggctg ttcggacaag gaacacgatc actcacatcc agaaaaggca 3720
tatgacagtt gtgcaacaga tgattgttgt ttttcagttc aagtccatgg cattgacgac 3780
gtatcaaaaa gtgaaattca agaaactgct cattgtgaca gcacaaagca gagcatggtc 3840
atctccagca gctgcaaaca tgaaccaaaa gatcaggtaa atcactgtgg acttcactct 3900
aaaactactc caactgatga agaactagcc aagctggtta gaagatgctg caaatacaaa 3960
ccatgccacg acgtccgttc tggctgcagg aagcatgctg cagaatgtgg tccaaccgtt 4020
cgatcaacca tcaatatctt acgggacaac catcatcatt acctagactg cagtggtcgt 4080
aaggtttgtt cgctgttgga gaagagacac atcggtggat gctgtgacag cttcagaaaa 4140
gaatgttgtg ccaagaaaaa acaccttgga gcaagttttg gaggaggttt atcagaaatt 4200
gtcatagagt ag 4212
<210> 2
<211> 1403
<212> PRT
<213>NtHMA2 aminopeptidase gene acid
<400> 2
Met Val Glu Ser Glu Lys Met Asn Glu Thr Lys Lys Leu Ser Lys Ser
1 5 10 15
Tyr Phe Asp Val Leu Gly Ile Cys Cys Thr Ser Glu Val Val Leu Val
20 25 30
Glu Lys Ile Leu Lys Asn Leu Glu Gly Val Lys Glu Val Ser Val Ile
35 40 45
Val Thr Thr Lys Thr Val Ile Val Ile His Asp Ser Leu Leu Ile Ser
50 55 60
Pro Gln Gln Ile Val Lys Ala Leu Asn Gln Ala Arg Leu Glu Ala Ser
65 70 75 80
Ile Arg Val Lys Gly Glu Lys Asn Tyr Gln Lys Lys Trp Pro Ser Pro
85 90 95
Phe Ala Ile Gly Ser Gly Ile Leu Leu Gly Leu Ser Phe Leu Lys Tyr
100 105 110
Phe Phe Ala Pro Phe Gln Trp Leu Ala Leu Ala Ala Val Ala Val Gly
115 120 125
Ile Pro Pro Ile Ile Phe Arg Gly Val Ala Ala Val Arg Asn Leu Thr
130 135 140
Leu Asp Ile Asn Ile Leu Val Leu Ile Ala Val Ala Gly Ser Ile Val
145 150 155 160
Leu His Asp Tyr Trp Glu Ala Gly Thr Ile Val Phe Leu Phe Ala Ile
165 170 175
Ala Glu Trp Leu Glu Ser Arg Ala Ser His Lys Ala Thr Ala Ala Met
180 185 190
Ser Ser Leu Val Asn Ile Val Pro Pro Thr Ala Val Leu Ala Glu Ser
195 200 205
Gly Glu Val Val Asn Val Asp Glu Val Lys Val Asn Ser Ile Leu Ala
210 215 220
Val Lys Ala Gly Glu Thr Ile Pro Ile Asp Gly Val Val Val Glu Gly
225 230 235 240
Glu Cys Asp Val Asp Glu Lys Thr Leu Thr Gly Glu Ser Phe Pro Val
245 250 255
Ser Lys Gln Arg Asp Ser Thr Val Trp Ala Gly Thr Thr Asn Leu Asn
260 265 270
Gly Tyr Ile Ser Val Lys Thr Thr Ala Leu Ala Glu Asp Cys Ala Val
275 280 285
Ala Arg Met Ala Gln Leu Val Glu Asp Ala Gln Asn Lys Lys Ser Lys
290 295 300
Thr Gln Arg Tyr Ile Asp Lys Cys Ala Lys Tyr Tyr Thr Pro Ala Ile
305 310 315 320
Val Ala Ile Ser Ala Ser Leu Ala Ile Val Pro Thr Ala Leu Arg Val
325 330 335
His Asn Arg Asn Glu Trp Tyr Arg Leu Ala Leu Val Thr Leu Val Ser
340 345 350
Ala Cys Pro Cys Ala Leu Val Leu Ser Thr Pro Val Ala Met Cys Cys
355 360 365
Ala Leu Ser Lys Ala Ala Thr Ser Gly Leu Leu Phe Lys Gly Ala Glu
370 375 380
Tyr Leu Glu Thr Leu Ala Lys Ile Lys Ile Met Ala Phe Asp Lys Thr
385 390 395 400
Gly Thr Ile Thr Lys Gly Glu Phe Met Val Thr Glu Phe Lys Ser Leu
405 410 415
Ile Asp Gly Phe Ser Leu Asn Thr Leu Leu Tyr Trp Val Ser Ser Ile
420 425 430
Glu Ser Lys Ser Gly His Pro Met Ala Ala Ala Leu Val Asp Tyr Ala
435 440 445
Gln Ser Asn Ser Val Glu Pro Lys Pro Asp Arg Val Glu Gln Phe Gln
450 455 460
Asn Phe Pro Gly Glu Gly Ile Phe Gly Arg Ile Asp Gly Met Glu Ile
465 470 475 480
Tyr Val Gly Asn Arg Lys Ile Ser Ser Arg Ala Gly Cys Thr Thr Val
485 490 495
Pro Glu Ile Glu Gly Asp Ser Phe Lys Gly Lys Ser Val Gly Tyr Ile
500 505 510
Phe Leu Gly Ser Ser Pro Ala Gly Ile Phe Ser Leu Ser Asp Val Cys
515 520 525
Arg Ile Gly Val Lys Glu Ala Met Arg Glu Leu Lys Gln Met Gly Ile
530 535 540
Lys Thr Ala Met Leu Thr Gly Asp Cys Tyr Ala Ala Ala Asn His Val
545 550 555 560
Gln Asp Gln Leu Gly Gly Ala Leu Asp Glu Phe Gln Ala Glu Leu Leu
565 570 575
Pro Glu Asp Lys Ala Thr Ile Ile Lys Gly Phe Gln Lys Glu Ala Pro
580 585 590
Thr Ala Met Ile Gly Asp Gly Leu Asn Asp Ala Pro Ala Leu Ala Thr
595 600 605
Ala Asp Ile Gly Ile Ser Met Gly Ile Ser Gly Ser Ala Leu Ala Lys
610 615 620
Glu Thr Gly His Val Ile Leu Met Thr Asn Asp Ile Gly Arg Ile Pro
625 630 635 640
Lys Ala Ala Arg Leu Ala Arg Arg Val Arg Arg Lys Ile Val Glu Asn
645 650 655
Met Ile Ile Ser Val Val Thr Lys Ala Ala Ile Val Ala Leu Ala Ile
660 665 670
Ala Gly Tyr Pro Leu Val Trp Ala Ala Val Leu Ala Asp Thr Gly Thr
675 680 685
Cys Leu Leu Val Ile Leu Asn Ser Met Leu Leu Leu Arg Gly Gly Thr
690 695 700
Arg Arg His Gly Lys Lys Cys Trp Arg Ser Ser Thr Pro Ser His Ala
705 710 715 720
Pro His His Lys Asp Lys Ala Ser Cys Cys Lys Ser Glu Asn Ala Pro
725 730 735
Gln Leu Cys Cys Ser Asp Ile Glu Ser Gln Lys Lys Cys Thr Ser Gln
740 745 750
Ser Cys Ser Ser Glu Val Cys Val Pro Arg Cys Gln Pro Val Ser Ser
755 760 765
Gly Ser Lys Ser Cys Gly Asn Asn Gln Cys Pro Asp Ser Ile Glu Asn
770 775 780
Ser Gly Phe His Ser His Pro Arg Pro Gln Cys Cys Ser Ser Lys Met
785 790 795 800
Ala Ala Lys Ala Cys Gln Ser Ala Val Ser Glu Ser Lys Ser Cys Gly
805 810 815
Asn Asn Gln Cys Pro Asp Ser Val Glu Asn Ser Gly Phe His Ser His
820 825 830
Pro Arg Pro Glu Cys Cys Ser Ser Lys Met Ala Ala Lys Ala Cys Gln
835 840 845
Ser Ala Val Ser Glu Ser Lys Ser Cys Gly Asn Asn Gln Cys Pro Asp
850 855 860
Ser Val Glu Asn Ser Gly Phe His Ser His Pro Arg Pro Gln Cys Cys
865 870 875 880
Ser Ser Lys Met Ala Ala Lys Ala Gly Gln Ser Ala Leu Ser Glu Ser
885 890 895
Lys Ser Cys Gly Asn Asn Asn Cys Ser Asp Ser Ile His Lys Ser Asn
900 905 910
Cys His Ser Leu Thr Asn Ser Leu Val Cys Ser Ser Lys Met Ser Ala
915 920 925
Pro Gln Cys His Ser Ala Thr Ser Ser Asn Lys Ser Cys Gly Ser Thr
930 935 940
Lys Cys Ser Asp Phe Ser Asp Lys Lys Cys Cys Gln Ser Asp Lys Ile
945 950 955 960
Pro Gln Thr Cys Ser Thr Lys Lys Ser Ala Pro Gly Cys Gln Ser Ala
965 970 975
Val Ser Gly Ser Lys Ser Cys Gly Asn Ser Lys Cys Ser Asp Ser Lys
980 985 990
Asp Asn Ser Ser His Pro Ser His Pro Asp His Gln Thr Cys Met Ser
995 1000 1005
Lys Leu Cys Ala Pro Gln Ser Gln Ser Ala Thr Ser Ser Ser Arg
1010 1015 1020
Thr Cys Gly Asn Thr Lys Cys Ser Asp Thr Asn Ser Lys Asn Ser
1025 1030 1035
Cys Tyr Ser Gln Thr Asn Ser Glu Ser Cys Ser Ser Lys Met Ser
1040 1045 1050
Gly Pro Ser Cys Lys Thr Ala Asn Ser Gly Ser Arg Ser Cys Arg
1055 1060 1065
Asn Lys Lys Cys Gln Asp Ser Ala Thr Glu Asn Ser Phe His Ser
1070 1075 1080
Pro Leu Thr Asn Pro Leu Ser Gly Glu Lys Leu Ser Glu Gln Lys
1085 1090 1095
Ser Leu Asp Leu Val Arg Lys Asp Lys Glu Ser Ser His Asp Leu
1100 1105 1110
Arg His Gly Cys Ser Asp Glu Glu His Asp His Thr Asn Leu Asp
1115 1120 1125
Lys Ala Tyr Asp Ser Cys Ala Leu Gln Glu Cys Cys Tyr Ser Val
1130 1135 1140
Gln Gly Asn Lys Thr Asp Val Ser Glu Thr Gly Ile Gln Glu Thr
1145 1150 1155
Ala His Cys Asp Ser Thr Asn Gln Thr Cys Gln Thr Ala Ser Ser
1160 1165 1170
Gly Ser Met Thr Cys Gly Asn Asp Lys Ile Leu Asp Ser Leu Ser
1175 1180 1185
Ile His Gly Cys His Ser His Asp Asn Pro Leu His Glu Glu Asn
1190 1195 1200
Asn Leu Glu Gln Lys Ile Leu Asp Val Val Gly Glu Gly Ile Lys
1205 1210 1215
Ser Pro His Ala Val Gly His Gly Cys Ser Asp Lys Glu His Asp
1220 1225 1230
His Ser His Pro Glu Lys Ala Tyr Asp Ser Cys Ala Thr Asp Asp
1235 1240 1245
Cys Cys Phe Ser Val Gln Val His Gly Ile Asp Asp Val Ser Lys
1250 1255 1260
Ser Glu Ile Gln Glu Thr Ala His Cys Asp Ser Thr Lys Gln Ser
1265 1270 1275
Met Val Ile Ser Ser Ser Cys Lys His Glu Pro Lys Asp Gln Val
1280 1285 1290
Asn His Cys Gly Leu His Ser Lys Thr Thr Pro Thr Asp Glu Glu
1295 1300 1305
Leu Ala Lys Leu Val Arg Arg Cys Cys Lys Tyr Lys Pro Cys His
1310 1315 1320
Asp Val Arg Ser Gly Cys Arg Lys His Ala Ala Glu Cys Gly Pro
1325 1330 1335
Thr Val Arg Ser Thr Ile Asn Ile Leu Arg Asp Asn His His His
1340 1345 1350
Tyr Leu Asp Cys Ser Gly Arg Lys Val Cys Ser Leu Leu Glu Lys
1355 1360 1365
Arg His Ile Gly Gly Cys Cys Asp Ser Phe Arg Lys Glu Cys Cys
1370 1375 1380
Ala Lys Lys Lys His Leu Gly Ala Ser Phe Gly Gly Gly Leu Ser
1385 1390 1395
Glu Ile Val Ile Glu
1400
<210> 3
<211> 4212
<212> DNA
<213>NtHMA2 gene mutation body nucleotide
<400> 3
atggtggaaa gtgaaaaaat gaatgaaaca aagaagttga gcaagagcta ttttgatgtt 60
ttgggaattt gctgtacttc agaagttgtt ctagttgaaa aaattctcaa gaatcttgaa 120
ggggttaaag aggtttcagt aattgtcaca acaaagactg tcattgttat tcatgattct 180
cttctcattt ctccgcaaca aattgttaaa gcattgaatc aagcaagatt agaagcaagc 240
ataagagtga aaggagagaa aaactaccaa aagaaatggc caagtccatt tgcaattggc 300
agtggaatat tgcttggact ctcatttttg aagtactttt ttgcaccttt ccaatggtta 360
gcacttgcag ctgttgcagt tgggattcct ccaattattt ttagaggtgt ggctgccgtg 420
cgaaacctca ctcttgacat caacattctt gttttaatag cagtggctgg atcaattgtt 480
ttacacgatt attgggaagc tggtactatt gtcttcttat tcgccattgc agaatggcta 540
gagtcaaggg caagtcacaa ggctaccgct gctatgtcat cactggtcaa tatagtccct 600
ccaacagcag ttttagctga aagcggagaa gtcgtaaatg ttgatgaagt caaggtgaat 660
agcattcttg ctgtgaaagc tggtgaaact atacctattg atggagttgt agtggaaggg 720
gaatgtgacg tggacgagaa aacactgaca ggcgagtcgt ttccagtttc taagcaaaga 780
gattcaacgg tctgggctgg cactacaaat ctaaatggct atatcagtgt taagactacg 840
gctttggctg aagattgtgc ggtggctagg atggcatagc ttgtcgaaga tgctcagaac 900
aagaaatcaa aaacccaaag atacatcgac aagtgtgcta aatattatac accagcaatt 960
gtggctatat cagcttcttt ggcaattgtt cctactgcat taagagttca caatcgaaat 1020
gaatggtatc gcttggcttt ggtcacattg gtgagtgcat gtccgtgtgc acttgttcta 1080
tctacaccag ttgccatgtg ttgcgcactt tcaaaagcag caacgtccgg tcttctgttt 1140
aaaggagcag agtaccttga gactctagct aaaatcaaaa tcatggcttt tgacaaaaca 1200
gggactataa ctaaaggaga atttatggtg accgagttca agtctctgat tgatggtttt 1260
agtctcaata cactgcttta ctgggtttca agcattgaga gcaagtcagg tcatccgatg 1320
gcagccgctc tggtggacta tgcacaatca aattccgttg agccaaagcc tgatagagtt 1380
gagcagtttc aaaattttcc tggtgaaggg atatttggaa gaattgatgg aatggaaatc 1440
tatgtcggga ataggaaaat ttcttcaaga gctggatgta ccacagtacc agaaatagag 1500
ggtgatagtt tcaaaggaaa gtctgttgga tacatatttt tgggatcatc tccagctgga 1560
attttcagtc tttccgatgt ttgtcgaatt ggtgtaaaag aagcaatgag agaactgaag 1620
cagatgggta tcaaaaccgc gatgcttact ggtgattgtt atgcagctgc caaccatgtg 1680
caggatcagt taggtggagc tttggatgaa tttcaagcag aactcctacc agaggacaag 1740
gcaacaatca tcaagggttt tcagaaggaa gctccaacag cgatgatagg cgacggcctt 1800
aatgatgctc ctgcattagc aacagctgac attggcatct caatgggcat ctctgggtca 1860
gctctcgcta aagaaacagg ccatgttata ctaatgacaa atgacatcgg aagaataccg 1920
aaagctgcac gtcttgctag aagagttcga aggaagattg ttgagaatat gattatatca 1980
gtcgttacaa aggctgccat agttgcattg gcaatagcag gttatccatt ggtttgggct 2040
gctgtcctcg cagatactgg gacatgcttg ctagtgattt tgaacagcat gctacttcta 2100
cgaggaggca cacgcagaca tgggaaaaaa tgttggagat cttctactcc ttcgcatgct 2160
ccccaccaca aagacaaagc ttcatgttgc aagtcggaaa atgctcccca gctgtgttgc 2220
tctgatattg agtcacaaaa gaaatgtaca agtcaatcat gctcgtccga ggtgtgtgtt 2280
ccaagatgtc aacctgtctc ctcaggatca aagtcatgtg gaaataatca gtgcccagac 2340
tccattgaaa atagtggttt tcattctcat ccccgtcctc aatgctgctc gtcgaagatg 2400
gctgctaaag catgccaatc tgcagtttca gaatcaaagt catgcggaaa taatcagtgc 2460
ccagactccg ttgaaaatag tggttttcat tctcatcccc gtcctgaatg ctgctcgtcg 2520
aagatggctg ctaaagcgtg ccaatctgca gtttcagaat caaagtcatg tggaaataat 2580
cagtgcccag actccgttga aaatagtggt tttcattctc atccccgtcc tcaatgctgt 2640
tcatcgaaga tggctgctaa agcaggccaa tctgcacttt cagaatcaaa gtcatgtgga 2700
aataacaatt gctcagactc cattcacaag agtaattgtc attctttaac taactctcta 2760
gtatgttctt ccaagatgtc tgctccacaa tgtcattctg ctacttcaag caacaaatca 2820
tgtggaagta ccaagtgctc cgacttcagt gacaaaaaat gttgtcaatc cgacaaaatt 2880
cctcaaacgt gctctaccaa gaagtctgct ccaggatgtc aatctgcagt ttctgggtct 2940
aaatcatgtg gaaatagcaa gtgttcagac tcaaaagaca atagtagcca tccttcacat 3000
cccgatcatc aaacatgcat gtctaagttg tgtgctccac aaagccaatc tgcaacttca 3060
agctccagga catgtggaaa tacaaagtgc tcggacacca atagcaagaa ttcttgttat 3120
tcacaaacca actctgaatc atgctcttca aagatgtctg gtccatcatg caaaactgct 3180
aattcaggtt caaggtcatg cagaaataag aagtgccagg actctgcaac cgagaacagt 3240
tttcattcac cacttactaa tccactcagt ggggaaaagc tttcggagca gaaaagcttg 3300
gatttagtcc gaaaagataa ggaatcaagt catgatcttc gtcatggctg ctctgacgag 3360
gaacatgatc atacaaattt agacaaggca tatgacagtt gtgccttaca agaatgttgt 3420
tattcggttc aaggcaataa aactgatgta tcagaaactg gaatccagga aactgctcat 3480
tgtgacagca ccaatcaaac atgccaaact gcaagttcag gatcgatgac atgcggaaat 3540
gataagatcc tggactctct aagcatccat ggttgtcatt cgcatgataa tccactccac 3600
gaggagaaca acttggagca gaaaatcttg gatgttgttg gagaaggtat aaaatcacct 3660
catgctgtcg gtcatggctg ttcggacaag gaacacgatc actcacatcc agaaaaggca 3720
tatgacagtt gtgcaacaga tgattgttgt ttttcagttc aagtccatgg cattgacgac 3780
gtatcaaaaa gtgaaattca agaaactgct cattgtgaca gcacaaagca gagcatggtc 3840
atctccagca gctgcaaaca tgaaccaaaa gatcaggtaa atcactgtgg acttcactct 3900
aaaactactc caactgatga agaactagcc aagctggtta gaagatgctg caaatacaaa 3960
ccatgccacg acgtccgttc tggctgcagg aagcatgctg cagaatgtgg tccaaccgtt 4020
cgatcaacca tcaatatctt acgggacaac catcatcatt acctagactg cagtggtcgt 4080
aaggtttgtt cgctgttgga gaagagacac atcggtggat gctgtgacag cttcagaaaa 4140
gaatgttgtg ccaagaaaaa acaccttgga gcaagttttg gaggaggttt atcagaaatt 4200
gtcatagagt ag 4212
<210> 4
<211> 292
<212> PRT
<213>NtHMA2 gene mutation body amino acid
<400> 4
Met Val Glu Ser Glu Lys Met Asn Glu Thr Lys Lys Leu Ser Lys Ser
1 5 10 15
Tyr Phe Asp Val Leu Gly Ile Cys Cys Thr Ser Glu Val Val Leu Val
20 25 30
Glu Lys Ile Leu Lys Asn Leu Glu Gly Val Lys Glu Val Ser Val Ile
35 40 45
Val Thr Thr Lys Thr Val Ile Val Ile His Asp Ser Leu Leu Ile Ser
50 55 60
Pro Gln Gln Ile Val Lys Ala Leu Asn Gln Ala Arg Leu Glu Ala Ser
65 70 75 80
Ile Arg Val Lys Gly Glu Lys Asn Tyr Gln Lys Lys Trp Pro Ser Pro
85 90 95
Phe Ala Ile Gly Ser Gly Ile Leu Leu Gly Leu Ser Phe Leu Lys Tyr
100 105 110
Phe Phe Ala Pro Phe Gln Trp Leu Ala Leu Ala Ala Val Ala Val Gly
115 120 125
Ile Pro Pro Ile Ile Phe Arg Gly Val Ala Ala Val Arg Asn Leu Thr
130 135 140
Leu Asp Ile Asn Ile Leu Val Leu Ile Ala Val Ala Gly Ser Ile Val
145 150 155 160
Leu His Asp Tyr Trp Glu Ala Gly Thr Ile Val Phe Leu Phe Ala Ile
165 170 175
Ala Glu Trp Leu Glu Ser Arg Ala Ser His Lys Ala Thr Ala Ala Met
180 185 190
Ser Ser Leu Val Asn Ile Val Pro Pro Thr Ala Val Leu Ala Glu Ser
195 200 205
Gly Glu Val Val Asn Val Asp Glu Val Lys Val Asn Ser Ile Leu Ala
210 215 220
Val Lys Ala Gly Glu Thr Ile Pro Ile Asp Gly Val Val Val Glu Gly
225 230 235 240
Glu Cys Asp Val Asp Glu Lys Thr Leu Thr Gly Glu Ser Phe Pro Val
245 250 255
Ser Lys Gln Arg Asp Ser Thr Val Trp Ala Gly Thr Thr Asn Leu Asn
260 265 270
Gly Tyr Ile Ser Val Lys Thr Thr Ala Leu Ala Glu Asp Cys Ala Val
275 280 285
Ala Arg Met Ala
290
<210> 5
<211> 24
<212> DNA
<213> HMA2-F
<400> 5
aatatagaga tggccaatga aggt 24
<210> 6
<211> 25
<212> DNA
<213> HMA2-R
<400> 6
ctaaaattta tatgaccaag tactt 25
Claims (2)
1. a kind ofNtHMA2Gene mutation body, it is characterised in that describedNtHMA2The nucleotide sequence of gene mutation body such as SEQ ID
Shown in No:3, with wild-type tobacco shown in SEQ ID No:1NtHMA2Gene nucleotide series are compared, what mutant containedNtHMA2The C that gene order is 877 sports T, forms terminator codon, terminates the gene in advance.
2. described in a kind of claim 1NtHMA2Gene mutation body in reducing tobacco leaf cadmium, zinc, iron, lead, chromium, nickel, in arsenic content
Application.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710033488.1A CN106636136B (en) | 2017-01-18 | 2017-01-18 | A kind of NtHMA2 gene mutation body and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710033488.1A CN106636136B (en) | 2017-01-18 | 2017-01-18 | A kind of NtHMA2 gene mutation body and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106636136A CN106636136A (en) | 2017-05-10 |
CN106636136B true CN106636136B (en) | 2019-09-20 |
Family
ID=58840910
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710033488.1A Active CN106636136B (en) | 2017-01-18 | 2017-01-18 | A kind of NtHMA2 gene mutation body and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106636136B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107586880A (en) * | 2017-10-31 | 2018-01-16 | 云南省烟草农业科学研究院 | A kind of molecular labeling and application for differentiating tobacco cadmium transporter gene NtHMA2 wild types and mutant |
CN109439669B (en) * | 2018-11-17 | 2022-03-29 | 云南省烟草农业科学研究院 | Tobacco arsenic transport gene NtNIP7-1 and cloning method and application thereof |
CN115927373B (en) * | 2022-08-05 | 2024-05-28 | 云南省烟草农业科学研究院 | NtMYC2a gene mutant for improving nicotine content of tobacco leaves and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20130199553A1 (en) * | 2012-02-08 | 2013-08-08 | Patsy Elizabeth Elliott | Tobacco Having Altered Amounts Of Environmental Contaminants And Methods For Producing Such Lines |
CN103981194A (en) * | 2014-06-10 | 2014-08-13 | 云南省烟草农业科学研究院 | Tobacco cadmium transporter gene NtHMA2, and cloning method and application thereof |
-
2017
- 2017-01-18 CN CN201710033488.1A patent/CN106636136B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20130199553A1 (en) * | 2012-02-08 | 2013-08-08 | Patsy Elizabeth Elliott | Tobacco Having Altered Amounts Of Environmental Contaminants And Methods For Producing Such Lines |
CN103981194A (en) * | 2014-06-10 | 2014-08-13 | 云南省烟草农业科学研究院 | Tobacco cadmium transporter gene NtHMA2, and cloning method and application thereof |
Non-Patent Citations (3)
Title |
---|
"GenBank: HF675181.1";Hermand,V. 等;《GenBank》;20130922;第1-2页 * |
"Inactivation of two newly identified tobacco heavy metal ATPases leads to reduced Zn and Cd accumulation in shoots and reduced pollen germination";Victor Hermand et al.,;《Metallomics》;20150514;第6卷(第8期);第1427-1440页,尤其是第1432页第3段、第1433页第2段、第1438页第5段 * |
"胡杨PeXTH基因的克隆及其转基因烟草的抗镉性分析";韩彦莎等;《西北农林科技大学学报(自然科学版)》;20160506;第42卷(第1期);第37-46页 * |
Also Published As
Publication number | Publication date |
---|---|
CN106636136A (en) | 2017-05-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106636136B (en) | A kind of NtHMA2 gene mutation body and application | |
Wang et al. | The role of root anatomy, organic acids and iron plaque on mercury accumulation in rice | |
CN106636137B (en) | A kind of preparation method and application of NtHMA4 gene mutation body | |
CN104694491B (en) | The anthocyanin reductase RrANR genes and its coding albumen of rose and application | |
Chen et al. | Generation of low-cadmium rice germplasms via knockout of OsLCD using CRISPR/Cas9 | |
Al-Soqeer et al. | Isolation and identification of allergens and biogenic amines of Prosopis juliflora genotypes | |
Katoh | Studies on the algal cytochrome of c-type | |
Guo et al. | Critical review on anthocyanins in blue honeysuckle (Lonicera caerulea L.) and their function | |
Landoni et al. | Opportunities and challenges of castor bean (Ricinus communis L.) genetic improvement | |
CN109182582A (en) | A kind of withered germ of water-melon qualitative detection primer and detection method | |
CN106497935A (en) | Overexpression GhJAZ1 genes amplification Genes For Plant Tolerance low temperature stress | |
EP1789065A2 (en) | Biologically active composition | |
Matthiesen et al. | Tuber composition in yellow nutsedge (Cyperus esculentus (L.)) variants | |
CN106966888A (en) | A kind of preparation method and application of the novel anthraquinone analog compound with activity of resisting tobacco mosaic virus | |
CN108456258B (en) | Preparation method of dendrobium officinale selenium polysaccharide | |
CN110129376A (en) | Gingko endogenous fungus metabolite and preparing the application in antioxidant | |
Chun et al. | Characterization of Colletotrichum siamense causing crown rot of strawberry in Jingzhou, Hubei Province | |
WO2018214641A1 (en) | Use of agrimonia pilosa extract in preparation of drug for removing plant virus in tomato plants | |
CN107337721B (en) | Aphid-resistant gene PPA-7, preparation, encoded protein and application | |
COOLBORN et al. | Biochemical, hematological and histological effect of Spondias mombin L fruit juice on some physiological properties of Wistar rats | |
Lu et al. | Comparison of Genomic DNA Extraction Methods for Chenopodium quinoa Willd | |
Duressa et al. | Protein and polyphenol profile changes in soybean roots under aluminum stress | |
Ma et al. | Interactive effects of drought and cadmium stress on adzuki bean seedling growth, DNA damage repair, and Cd accumulation | |
CN116064589B (en) | Tobacco NtPht1-7 gene mutant and application thereof | |
CN110433199B (en) | Traditional Chinese medicine composition with components of tonifying qi, activating blood and detoxifying for treating cerebral ischemia and preparation method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |