CN106636044A - Nitrilase mutant as well as coding gene and application thereof - Google Patents
Nitrilase mutant as well as coding gene and application thereof Download PDFInfo
- Publication number
- CN106636044A CN106636044A CN201710129680.0A CN201710129680A CN106636044A CN 106636044 A CN106636044 A CN 106636044A CN 201710129680 A CN201710129680 A CN 201710129680A CN 106636044 A CN106636044 A CN 106636044A
- Authority
- CN
- China
- Prior art keywords
- ala
- leu
- ser
- glu
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/05—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in nitriles (3.5.5)
- C12Y305/05001—Nitrilase (3.5.5.1)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a nitrilase mutant and in particular relates to a nitrilase mutant and a coding gene thereof as well as application of the nitrilase mutant to preparation of optical activity 2-aryl propionic acid (2-APA). The mutant comprises an amino acid substitution on any one or more amino acid sites in an amino acid sequence shown as SEQ ID NO: 1, and the sites are 135, 41, 192 and 120. Compared with wild type nitrilase, the mutant has relatively high enzyme activity and/or stereoselectivity; according to the application of the nitrilase mutant to preparation of the optical activity 2-APA, the production cost can be reduced and the production efficiency can be improved when being compared with those of a chemical synthesis method; the requirements of industrial production are met.
Description
Technical field
The present invention relates to a kind of nitrilase mutants, more particularly to a kind of nitrilase mutants and its encoding gene,
And its application in optical activity 2- arylpropionic acid is prepared.
Background technology
In organic synthesis, cyano group easily introduces organic compound as " the stable carbanion of water ", and nitrile compounds are then
It is a kind of multiduty intermediate, amine, acid amides, carboxylic acid and carboxyl compound etc. can be converted into.It is acyl with microbial enzyme hydrolysis nitrile
When amine and carboxylic acid, because reaction condition is gentle and highly purified product makes a kind of method for receiving much concern, exist so far
Existing many successful examples in industrial production.In recent years, quite meaningfully microbial enzyme stereo selective hydrolysis are used in research
Nitrile prepares optical activity 2- arylpropionic acid (2-APA), optical activity 2-APA can as pharmaceutically active matrix, especially as
NSAIDs (NSAID) is applied.Because the clinical research of pharmacology shows only right in the enantiomer of the NSAID of 2-APA classes
The configuration of rotation shows high pharmacologically active, and laevo-configuration activity is low or without effect.In view of the chirality produced by general chemical reaction
Center always obtains a pair of mixture of enantiomers of equivalent, referred to as racemic modification.Optical voidness dextrorotation 2-APA to be obtained, splits
Racemic modification is one of main method.In general chiral derivatizing agent need to be used using chemical resolution, it is expensive, and process is superfluous
It is long, it is more difficult to obtain satisfied result.And being split with microbial enzyme method can then provide the selection of an economy.
Ketoprofen (Ketoprofen, KP) also known as Ketoprofen, ketoprofen, Ketoprofen, Ketoprofen or
Profenid, chemical entitled Alpha-Methyl -3- benzoylphenylacetic acids, be by french chemist Farge, Messer and
Moutounier is in the excellent 2- aryl propionic non-steroid anti-inflammation analgesis medicaments of exploitation in 1967.Its mechanism of action is mainly
By the biologically active for suppressing internal cyclooxygenase (COXs), lipoxidase (LOXs), so as to suppress inflammation-causing substance prostaglandin
(PGs), the synthesis of leukotriene (LTs), with antagonism bradykinin release, scavenging hydroxyl and stable lysosome membrane activity,
So as to produce good antipyretic, analgesia and antiinflammatory action, and strengthen its periphery analgesic effect.Clinical research shows that Ketoprofen is made
For important nonsteroidal anti-inflammatory drug, compared with similar drugs, with dosage it is little, curative effect is high, better tolerance and toxic and side effect are light
It is micro- to wait remarkable advantage, become treatment rheumatoid arthritis, rheumatic arthritis, osteoarthritis, poker back and pain
The ideal medicament of wind, is widely used in treating dysmenorrhoea, toothache, postoperative pain, cancer pain and neuritis, lupus erythematosus, throat
And the disease such as bronchitis, it is more preferable to the therapeutic effect of soft tissue injury.
Ketoprofen is 2- aryl propionic non-steroid antiphlogistics (NSAIDs), only d-isomer just have anti-inflammatory antirheumatic and
Analgesic activity, levo form is almost without pharmacologically active.The main manufacturing enterprise of Ketoprofen, foreign countries remove France Rhone-Poulenc
Outside company, also Germany Sanofi-Aventis, Italy SIMS, Cosma and BidaChem, India BEC Chemicals etc.
Company；Domestic SouthWest Synthetic Pharmaceutical Corp. Ltd (former Xi-nan Synthetic Medicine Factory), Shanghai Pharmaceutical Inst., Chinese Academy of Sciences
Product development and the process development work of Ketoprofen is more early carried out in experiment pharmaceutical factory.The process route of the Ketoprofen of chemical synthesis at present
It is highly developed, but the Ketoprofen of synthesis lacks hand-type selectivity.Because left-handed Ketoprofen does not have pharmacologically active, and have very
Big side effect.Therefore, it is directly synthesized dexketoprofen or left-handed Ketoprofen is transformed into dexketoprofen all with huge
Economic benefit.
Rite-directed mutagenesis refer to by the methods such as PCR (PCR) to target DNA fragment (can be genome,
Can also be plasmid) change (typically characterizing the change of beneficial direction) needed for middle introducing, including addition, deletion, the point of base
Mutation etc..Rite-directed mutagenesis can rapid, efficiently improve the proterties and sign of the destination protein expressed by DNA, be gene studies work
A kind of highly useful means in work.External site-directed mutagenesis technique is a kind of important in current biological, each area research of medical science
Laboratory facilities, are transformation, the convenient solution of optimization gene, are the effective means for exploring promoter regulatory site, are also research egg
The powerful of the complex relationship between white matter 26S Proteasome Structure and Function.The research of Fixedpoint mutation modified Alcaligenes faecalis nitrilase has
Splendid theoretical and using value.
The content of the invention
The purpose of the present invention is that Alcaligenes faecalis nitrilase gene is transformed by the method for rite-directed mutagenesis, makes transformation
Genetic engineering nitrilase afterwards increases in terms of enzyme activity and chiral selectivity so as to meet fragrant in catalytic production dextrorotation 2-
The demand of base propionic acid industrial applications.
The technical solution used in the present invention is：
The present invention provides a kind of nitrilase mutants, and the mutant includes SEQ ID NO：Amino acid sequence shown in 1
In 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor on following any one or more amino acid sites, the site is 135,41,192,120；Wherein,
The valine of the 135th is sported alanine or tyrosine；
The aspartic acid of the 41st is sported alanine；
192nd leucine is sported valine；
The lysine of the 120th is sported isoleucine.
Preferably, in certain embodiments, the nitrilase mutants include SEQ ID NO：Amino acid sequence shown in 1
In the valine of the 135th sported alanine or tyrosine.Also comprising on following any one or more amino acid sites
49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor, the site be selected from 41,134,120,82,192,319.The aspartic acid of preferred 41st is sported
Alanine, the histidine of the 134th is sported valine, and the lysine of the 120th is sported isoleucine, the 82nd
Alanine is sported tryptophan, and the 192nd leucine is sported valine, and the serine of the 319th is sported different bright
Propylhomoserin.
Preferably, in certain embodiments, the nitrilase mutants include SEQ ID NO：Amino acid sequence shown in 1
In the valine of the 135th sported alanine or tyrosine.Also comprising on following any one or more amino acid sites
49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor, the site be selected from 41,192,120.The aspartic acid of preferred 41st is sported alanine, the
192 leucines are sported valine, and the lysine of the 120th is sported isoleucine.
Preferably, in certain embodiments, the nitrilase mutants include SEQ ID NO：Amino acid sequence shown in 1
In the histidine of the 134th sported valine, the valine of the 135th is sported alanine or tyrosine.
Preferably, in certain embodiments, the nitrilase mutants include SEQ ID NO：Amino acid sequence shown in 1
In the histidine of the 134th sported valine, the valine of the 135th is sported alanine or tyrosine.Also include
49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor on following any one or more amino acid sites, the site is selected from 41,82,192,120,319, preferably
The aspartic acid of the 41st sported alanine, the alanine of the 82nd is sported tryptophan, the 192nd leucine quilt
Valine is sported, the lysine of the 120th is sported isoleucine, and the serine of the 319th is sported isoleucine.
Preferably, in certain embodiments, the nitrilase mutants include SEQ ID NO：Amino acid sequence shown in 1
In the histidine of the 134th sported valine, the valine of the 135th is sported alanine or tyrosine.Also include
49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor on following any one or more amino acid sites, the site is selected from the 41,192,120, the preferred 41st
The aspartic acid of position is sported alanine, and the 192nd leucine is sported valine, and the lysine of the 120th is mutated
For isoleucine.
It is highly preferred that in certain embodiments, the nitrilase mutants, comprising SEQ ID NO：Amino acid shown in 1
Selected from the group of following amino acid mutation composition in sequence：
1)V135A+D41A；
2)V135A+K120I；
3)V135A+L192V；
4)H134V+V135A；
5)H134V+V135A+L192V；
6)H134V+V135A+L192V+D41A；
7)H134V+V135A+L192V+K120I。
The invention further relates to a kind of polynucleotides, its above-described nitrilase mutants of coding.
The invention further relates to a kind of recombinant vector comprising above-mentioned polynucleotides.
The present invention also provides a kind of recombination engineering bacteria for being converted by the recombinant vector and being prepared.
Additionally, the present invention also provides a kind of application of nitrilase mutants in optical activity 2-APA is prepared.
The present invention provides a kind of nitrilase mutants, the mutant and wild type nitrile water by way of rite-directed mutagenesis
Solution enzyme is compared with higher enzyme activity and/or stereoselectivity, and the nitrilase mutants are in optical activity 2-APA is prepared
Using, compared with chemical synthesis, production cost can be reduced, improve production efficiency adapts to the demand of industrialized production.
Description of the drawings
The wild-type nitri agarose gel electrophoresis figure of 1 embodiment of accompanying drawing 1；
The nitrilase mutants stereoselectivity catalyzing hydrolysis cyano group Ketoprofen of 2 embodiment of accompanying drawing 5；
The nitrilase mutants agarose gel electrophoresis figure of 3 embodiment of accompanying drawing 5；
The wild-type nitri three dimensional structure simulation figure of accompanying drawing 4.
Specific embodiment
Other features and superiority of the present invention can be embodied by detailed description below.It should be understood, however, that only
Detailed description and specific embodiment are given in an exemplary fashion to show embodiment of the present invention, this is because for ability
From described detailed description, within the spirit and scope of the present invention various changes and improvement are aobvious and easy to domain those of skill in the art
See.
Term is defined
" 2- arylpropionic acids (2-APA) " of the present invention refers to the compound with structure shown in formula I, also referred to as aryl -2-
Propionic acid.
Term " aryl " can be it is monocyclic, it is bicyclic, and the carbocyclic ring system of three rings, wherein, at least one member ring systems are fragrance
Race, each of which member ring systems include 3-7 atom.Specifically, the 2- arylpropionic acids with antiinflammation described herein
The including but not limited to following citing of class medicine, such as Ketoprofen (Ketoprofen), naprosyn
(naproxene), brufen (Ibrufen), suprofen (Sutoprofen), fenoprofen (Fenoprofen), benzene are disliked
Ibuprofen (Bennoxaprofen), Carprofen (Carprofen), cicloprofen (Cicloprofen), Flurbiprofen
And Fluprofen (Fluprofen) etc. (Flurbiprofen).
" activity of nitrilase " described herein is referred to, nitrilase catalyzing hydrolysis nitrile is acid amides and carboxylic acid, excellent herein
Choosing is hydrolyzed to carboxylic acid.
" enzyme activity " described herein or " conversion ratio " refer to the ability that nitrilase catalyzing hydrolysis nitrile is carboxylic acid, or nitrilase
Catalyzing hydrolysis nitrile is converted into the ratio of carboxylic acid.Nitrile is higher for the ratio of carboxylic acid by catalyzing hydrolysis, and enzyme activity is higher, i.e., conversion ratio is got over
Height, enzyme activity is higher.
" optical activity 2- arylpropionic acid " described herein, refers to the 2- arylpropionic acids with pharmacologically active, further,
For S (+) -2-APA.
" ee% " described herein means enantiomer excess, i.e., in chiral synthesis, generate target product (a certain specific
Stereoisomer) percentage composition deduct the percentage composition of accessory substance (another kind of isomers).For example, ee% is 98%, i.e. table
The content for showing the target product of generation is 99%." dextrorotation ee% " described herein=(the left-handed % of dextrorotation %-)/(dextrorotation %+ is left
Rotation %)
Nitrilase mutants specifically described herein, except the 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor mentioned in text, also comprising on common meaning
Conserved amino acid replaces, and " the conserved amino acid replacement " may include that native amino acid residues are replaced by non-natural residues so that
The little or no impact of polarity or electric charge on the amino acid residue on the position.Conserved amino acid replaces and also include generally
The non-naturally occurring amino acid residue mixed by peptide symthesis chemically rather than by synthesis in biosystem.
These include other inverted versions or reverse form of peptide mimics (peptidomimetics) and amino acid moiety.Common
Conserved amino acid replacement is shown in Table A.
Table A
| Amino acid | 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor |
| Alaninc | D-Ala, Gly, Aib, β-Ala, L-Cys, D-Cys |
| Argininc | D-Arg, Lys, D-Lys, Orn D-Om |
| Asparagine | D-Asn.Asp, D-Asp, Glu, D-Glu Gln, D-Gln |
| Aspartic Acid | D-Asp, D-Asn.Asn.Glu.D-Glu, Gln, D-Gln |
| Cysteine | D-Cys, S-Me-Cys, Met, D-Met, Thr, D-Thr, L-Ser, D-Ser |
| Glutaminc | D-Gln, Asn, D-Asn, Glu, D-Glu, Asp, D-Asp |
| Glutamic Acid | D-Glu, D-Asp, Asp, Asn, D-Asn, Gln, D-Gln |
| Glycinc | Ala, D-Ala, Pro, D-Pro, Aib, β-Ala |
| Isoleucine | D-Ile, Val, D-Val, leu, D-Leu, Met, D-Met |
| Leucine | Val, D-Val, Met, D-Met, D-Ile, D-Leu, lle |
| Lysinc | D-Lys, Arg, D-Arg, Orn, D-Om |
| Methionine | D-Met, S-Me-Cys, lle, D-Ile, Leu, D-Leu, Val, D-Val |
| Phcnylalaninc | D-Phc, Tyr, D-Tyr, His, D-His, Trp, D-Trp |
Nitrilase mutants, preparation method and application
Nagasawa T etc. have found the nitrilase that rhodococcus rhodochrous (Rhodococcus rhodochrous) J1 is produced
Both aliphatic nitrile had been can serve as, it is also possible to act on aromatic series and be hydrolyzed to corresponding carboxylic acid, hereafter, Mauger J etc. isolate excrement product
Aryl acetonitrile can be hydrolyzed to corresponding carboxylic acid by alkali bacillus (Alcaligenes faecalis) JM3.Inventor divides in soil
One plant of Bacillus foecalis alkaligenes is separated out, and extracts wild-type nitri, it is found that it has in optical activity 2-APA is prepared relatively low
Conversion ratio and stereoselectivity is not good.Inventor is simulated (see Fig. 4) by the three-dimensional structure to the nitrilase, screening
Go out 25 sites that may be played a crucial role to catalyzing hydrolysis：R127、V135、L167、V57、W164、S189、L192、K203、
M206、S106、K131、P169、M314、L322、P330、I344、V12、D41、A82、K120、H134、V139、S319、W58、
H134, the region that these sites are located is referred to as catalytic pocket, there may be in terms of with Binding Capacity or stereoselectivity compared with
Big to affect, inventor carries out respectively rite-directed mutagenesis to them, it is unexpected obtain 7 beneficial mutational site V135, L192, D41,
A82, K120, S319, H134, wherein the nitrilase mutants comprising these site mutations, in catalytic conversion and/or solid
Selective aspect has strengthened.
In certain embodiments, the present invention provides a kind of nitrilase mutants, and the mutant includes SEQ ID NO：1
49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor in shown amino acid sequence on following any one or more amino acid sites, the site be 135,41,
192、120.The valine of wherein the 135th is sported alanine or tyrosine；The aspartic acid of the 41st is sported third
Propylhomoserin；192nd leucine is sported valine；The lysine of the 120th is sported isoleucine.
In certain embodiments, the nitrilase mutants include SEQ ID NO：The 135th in amino acid sequence shown in 1
The valine of position is sported alanine or tyrosine.Also comprising the amino acid on following any one or more amino acid sites
Replace, the site is selected from 41,134,120,82,192,319.The aspartic acid of preferred 41st is sported alanine,
The histidine of the 134th is sported valine, and the lysine of the 120th is sported isoleucine, the alanine of the 82nd
Tryptophan is sported, the 192nd leucine is sported valine, and the serine of the 319th is sported isoleucine.
In certain embodiments, the nitrilase mutants include SEQ ID NO：The 135th in amino acid sequence shown in 1
The valine of position is sported alanine or tyrosine.Also comprising the amino acid on following any one or more amino acid sites
Replace, the site is selected from 41,192,120.The aspartic acid of preferred 41st is sported alanine, the 192nd bright ammonia
Acid is sported valine, and the lysine of the 120th is sported isoleucine.
In certain embodiments, the nitrilase mutants include SEQ ID NO：The 134th in amino acid sequence shown in 1
The histidine of position is sported valine, and the valine of the 135th is sported alanine or tyrosine.
In certain embodiments, the nitrilase mutants include SEQ ID NO：The 134th in amino acid sequence shown in 1
The histidine of position is sported valine, and the valine of the 135th is sported alanine or tyrosine.Also comprising following any
49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor on one or more amino acid sites, the site is selected from 41,82,192,120,319, preferred 41st
Aspartic acid sported alanine, the alanine of the 82nd is sported tryptophan, and the 192nd leucine is sported figured silk fabrics
Propylhomoserin, the lysine of the 120th is sported isoleucine, and the serine of the 319th is sported isoleucine.
In certain embodiments, the nitrilase mutants include SEQ ID NO：The 134th in amino acid sequence shown in 1
The histidine of position is sported valine, and the valine of the 135th is sported alanine or tyrosine.Also comprising following any
49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor on one or more amino acid sites, the site is selected from 41,192,120, the asparagus fern of preferred 41st
Propylhomoserin is sported alanine, and the 192nd leucine is sported valine, and the lysine of the 120th is sported different bright ammonia
Acid.
In some preferred embodiments, the nitrilase mutants, comprising SEQ ID NO：In amino acid sequence shown in 1
Selected from the group of following amino acid mutation composition：
1)V135A+D41A；
2)V135A+K120I；
3)V135A+L192V；
4)H134V+V135A；
5)H134V+V135A+L192V；
6)H134V+V135A+L192V+D41A；
7)H134V+V135A+L192V+K120I；
The invention further relates to a kind of polynucleotides, its above-described nitrilase mutants of coding.
The invention further relates to a kind of recombinant vector comprising above-mentioned polynucleotides.
The present invention also provides a kind of recombination engineering bacteria for being converted by the recombinant vector and being prepared.
Additionally, the present invention also provides the application that a kind of nitrilase mutants are prepared in optical activity 2-APA.
Reagent used herein can be by being commercially available.
Embodiment
The clone of the wild-type nitri gene of embodiment 1
(1) acquisition of wild-type nitri gene
One plant of Bacillus foecalis alkaligenes HEC-AF001 is filtered out from industrial wastewater nearby soil use OMEGA bacterial genomes
Kit carries out the extraction of total genomic dna, and using following primer amplification the genetic fragment of 1.1kb sizes is about.
HEC-AF001-F：CCCATATGCAGACAAGAAAAATC(SEQ ID NO：17)
HEC-AF001-R：CCAAGCTTTCAGGACGGTTCTTG(SEQ ID NO：18)
PCR reaction systems are shown in Table 1
Table 1
| Composition | System (μ l) |
| 5×PrimeSTAR PCR HS Buffer | 10 |
| Primer 1 | 1 |
| Primer 2 | 1 |
| Template (<0.2μg) | 1 |
| dNTPs(2.5mM) | 4 |
| PrimeSTAR PCR HS Polymerase | 0.5 |
| ddH2O | 50 |
PCR amplification programs：98 DEG C, denaturation 20s；98 DEG C, denaturation 10s；60 DEG C of annealing 10s；72 DEG C of extension 60s；Repeat
30 circulations；72 DEG C are continued to extend 10min.
PCR primer Jing agarose gel electrophoresis is purified, and using Ago-Gel DNA QIAquick Gel Extraction Kits 1100bp or so is reclaimed
Target stripe (see Fig. 1).
Send Guangzhou Ai Ji biotech firms to be sequenced, confirmation is purpose band, so obtain a complete nitrilase total length
Gene order, is named as NIT1, total length 1071bp, SEQ ID No in base sequence such as sequence table：Shown in 2, using software to this
Gene order is analyzed, and obtains the wild-type nitri amino acid sequence SEQ ID No as shown in SEQ ID No.2：1.
The preparation of the recombinant expression plasmid of embodiment 2 and recombinant expression transformants
By the PCR primer of the gained of embodiment 1 at 37 DEG C with the double digestion 4h of restriction enzyme NdeI and Hind III, Jing agar
Sugar is gel purified, and using Ago-Gel DNA QIAquick Gel Extraction Kits target fragment is reclaimed, wherein containing being properly inserted piece
Section.Target fragment is mixed with the same plasmid pET28a Jing after NdeI and the digestions of Hind III, in the effect of T4DNA ligases
Under, 16 DEG C of connection 4h obtain recombinant expression plasmid pET28a-NIT1.
Above-mentioned recombinant expression plasmid is transformed into E.coli Top10 competent cells.In the resistance containing kanamycins
(medium component LB culture mediums, peptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L and agar 2%, antibiotic contains flat board
Amount 50mg/L) on positive recombinants are screened, picking monoclonal, cultivate recombinant bacterial strain, plasmid is extracted after plasmid amplification,
Jing after sequence verification is correct, convert again into E.coli BL21 (DE3) competent cell.Conversion fluid be applied to containing card that
On the LB flat boards of mycin (50mg/L), 37 DEG C of inversion overnight incubations, acquisition positive restructuring E. coli BL21 (DE3)/
PET28a-NIT1, is named as HEC-NIT1.
The expression of the restructuring nitrilase of embodiment 3
By the recombination bacillus coli of the gained of embodiment 2, in being seeded to the LB culture mediums containing kanamycins (50mg/L), 37 DEG C
Shaken cultivation is overnight.By 2 ‰ (v/v) inoculum concentration access equipped with 50ml LB culture mediums 250ml conical flasks in, put 37 DEG C,
180rpm shaking table concussion and cultivates.As the OD of nutrient solution600When reaching 0.8, the IPTG for adding final concentration of 0.5mmol/L is lured
Lead.After 30 DEG C of induction 8h, by medium centrifugal, cell is collected, obtain 0.3g wet cells.
Embodiment 4 is using NIT1 restructuring nitrilase catalyzing hydrolysis cyano group Ketoprofens
Enzymic catalytic reaction：Embodiment 4 is obtained nitrilase wet thallus respectively are added to (the work of substrate solution containing 25ml
Concentration is 1mM, weighs 0.235g cyano group Ketoprofens, using methyl alcohol 90ml, 1M kaliumphosphate buffer (pH7.8) 90ml, H2O
720ml is dissolved) triangular flask in, react 48h under the conditions of 30 DEG C, 250rpm, take out triangular flask, be separately added into 10ml first
Alcoholic solution is completely dissolved cyano group Ketoprofen substrate, and 8000rpm, 10min centrifugation, reject bacteria residue collects supernatant.
Reaction system is post-processed：The supernatant for obtaining is waved except methyl alcohol respectively with Rotary Evaporators under the conditions of 40 DEG C, is used
1M HCl adjust pH value of solution to 2～3 or so；Add isopyknic ethyl acetate, be well mixed, collect ethyl acetate phase；Take acetic acid
Methacrylate layer is dried up, and takes 200 μ l90% n-hexanes (isopropanol) redissolution, crosses 0.45um filter membranes, stand-by.
HPLC detects conversion ratio：Chromatographic column, Waters XBridge C18；Column temperature, 30 DEG C；Mobile phase, 0.02M
NaClO4- acetonitrile, the results are shown in Table 5.
HPLC detections are chiral：：Chromatographic column, Chiral ND posts；Column temperature, 30 DEG C；Mobile phase, n-hexane (0.15%TFA)：
Isopropanol=93:7, testing result is shown in Table 5.
Embodiment 5：Wild-type nitri directional transformation
With reference to wild-type nitri gene order (SEQ ID NO：2) two Oligonucleolide primers, are designed and synthesized, and
Using unmutated recombinant plasmid, the method expanded by PCR obtains nitrilase mutants in table 2：
Table 2
The primer being related to is shown in Table 3
Table 3
PCR reaction systems are shown in Table 4
Table 4
| Composition | System (μ l) |
| PrimeSTAR Max Premix | 25 |
| Primer 1 | 2 |
| Primer 2 | 2 |
| Template (about 300ng) | 3 |
| Aqua sterilisa | Up to 50 |
PCR procedure conditions are set as：98 DEG C of denaturations 5min；98 DEG C of denaturation 20s, 60 DEG C of annealing 20s, 72 DEG C of extensions
2min, 30 circulations；72 DEG C extend eventually 5min.1% nucleic acid electrophoresis testing result is shown in Fig. 3.
Alcohol precipitation process is carried out to the PCR primer that amplification is obtained, reuse Dpn I carries out digestion process to template, finally uses
DNA glue reclaims kit carries out rubber tapping recovery.
The product electricity that recycling is obtained is converted into Electrocompetent cells E.coli BL21 (DE3), transfer cell is extremely
Resistance containing kana (final concentration of 50 μ g/ml) flat board overnight incubation under the conditions of 37 DEG C obtains a large amount of transformants.Carry out after spreading cultivation
Sequence verification, verifies that correct transformant is genetic engineering nitrilase producing strains.
Genetic engineering nitrilase producing strains are accessed (resistance containing kana, end in the LB liquid medium of 50ml/250ml
Concentration is 50 μ g/ml), 37 DEG C of culture OD600During to 0.8 or so, Fiber differentiation 6h is carried out under the conditions of 30 DEG C using IPTG, received
Bacterium.
Thalline 4 DEG C of centrifugation 10min in centrifuge maximum (top) speed collect albumen.Determine the enzymatic conversion rate of albumen and chiral choosing
Selecting property (method and embodiment 4) is identical, and measurement result is shown in Table 5.
Table 5
| Catastrophe | Conversion ratio (enzyme activity) | Dextrorotation ee% values |
| Wild type | 18% | 8.9% |
| D41A | 90% | 86% |
| A82W | 84% | 77% |
| K120I | 89% | 85% |
| V135A | 90% | 90% |
| L192V | 96% | 67% |
| S319I | 82% | 70% |
| V135A、D41A | 93% | 91% |
| V135A、K120I | 92% | 92% |
| V135A、L192V | 98% | 80% |
| V135Y | 65% | 70% |
| H134V、V135A | 93% | 98% |
| H134V、V135A、L192V | 96% | 99% |
| H134V、V135A、L192V、D41A | 99% | 99% |
| H134V、V135A、L192V、K120I | 98% | 99% |
Interpretation of result：In single site mutation, D41A, A82W, K120I, V135A, V135Y, L192V, S319I show
Go out the enzyme activity or stereoselectivity better than wild-type nitri, L192V is optimum in terms of enzyme activity is improved, V135A is in three-dimensional choosing
Selecting property aspect is optimum, and in multisite mutation, 135,192,41,120 also show beneficial effect.In the combination of three site mutations
The 4th mutational site H134 of middle addition, can be such that effect further improves, and according to 3-D solid structure H134V, V135A are speculated
The mutation in site, destruction is conducive to the factor of R type Binding Capacities, reduces to R type catalysis activities.His134 may be in R type substrates
In the positioning of preferential conformation have important function, there may be between the imidazole radicals and substrate phenyl ring of His134 π-π interact or
Cation-π interaction, is unfavorable for the formation of left-handed product.
SEQUENCE LISTING
<110>Dongguan Dongyang light medicament research and development Co., Ltd;Huangshi Shixing Pharmaceutical Co., Ltd.
<120>Nitrilase mutants and its encoding gene and application
<130> 2017
<160> 34
<170> PatentIn version 3.5
<210> 1
<211> 356
<212> PRT
<213> Alcaligenes faecalis
<400> 1
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr His Val Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Leu
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 2
<211> 1071
<212> DNA
<213> Alcaligenes faecalis
<400> 2
atgcagacaa gaaaaatcgt ccgggcagcc gccgtacagg ccgcctctcc caactacgat 60
ctggcagcag gggttgataa aaccattgag ctggctcgtc aggcccgcga tgagggctgc 120
gacctgatcg tgtttggtga aacctggcta ccaggctacc ccttccacgt ctggttgggc 180
gcaccggcct ggtcgctgaa atacagtgcc cgctactatg ccaactcgct ctcgctggac 240
agtgcggaat ttcaacgcat tgcccaggcc gcacggacct tgggcatttt cattgccttg 300
ggctatagcg agcgcagtgg tggcagcctg tatctgggcc aatgcctgat tgacgacaaa 360
ggcgagatgc tgtggtcgcg ccgcaaactt aaacccacac atgtcgagcg caccgtgttt 420
ggtgaaggct atgcccgtga tctgattgtg tccgacaccg agctgggccg cgtcggtgcg 480
ctgtgctgct gggagcacct gtctcccttg agcaagtacg cgctgtactc ccagcacgaa 540
gccattcaca ttgccgcctg gccgtctttt tcgctgtaca gtgaacaggc ccatgctctc 600
agcgccaaag taaacatggc tgcctcgcaa atctattcgg tcgaaggcca atgctttacc 660
atcgccgcca gcagtgtggt cactcaagag acgctggaca tgctggaagt gggagagcac 720
aacgcctcct tattgaccgt gggcggtggc agttccatga tttttgcgcc agacggacgc 780
acactggccc cctacctgcc gcacgatgcc gaaggcctga tcattgccga cctgaacatg 840
gaagaaattg ccttcgccaa ggcaatcaac gaccccgcag gtcactattc caaacctgag 900
gctacccgtt tggtactgga tttggggcac cgtgagccca tgacacgggt tcactcccaa 960
agcctgatca aggaagaggc ctgcgaacca ctcacaccca gtacgattgc accagttgcc 1020
atcagccaga tccaggaatc ggacacactg ctggtgcaag aaccgtcctg a 1071
<210> 3
<211> 356
<212> PRT
<213>Artificial sequence
<400> 3
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Ala Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr His Val Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Leu
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 4
<211> 356
<212> PRT
<213>Artificial sequence
<400> 4
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Trp Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr His Val Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Leu
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 5
<211> 356
<212> PRT
<213>Artificial sequence
<400> 5
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Ile Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr His Val Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Leu
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 6
<211> 356
<212> PRT
<213>Artificial sequence
<400> 6
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr His Ala Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Leu
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 7
<211> 356
<212> PRT
<213>Artificial sequence
<400> 7
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr His Val Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Val
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 8
<211> 356
<212> PRT
<213>Artificial sequence
<400> 8
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr His Val Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Leu
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ile Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 9
<211> 356
<212> PRT
<213>Artificial sequence
<400> 9
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Ala Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr His Ala Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Leu
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 10
<211> 356
<212> PRT
<213>Artificial sequence
<400> 10
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Ile Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr His Ala Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Leu
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 11
<211> 356
<212> PRT
<213>Artificial sequence
<400> 11
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr His Ala Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Val
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 12
<211> 356
<212> PRT
<213>Artificial sequence
<400> 12
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr His Tyr Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Leu
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 13
<211> 356
<212> PRT
<213>Artificial sequence
<400> 13
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr Val Ala Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Leu
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 14
<211> 356
<212> PRT
<213>Artificial sequence
<400> 14
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr Val Ala Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Val
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 15
<211> 356
<212> PRT
<213>Artificial sequence
<400> 15
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Ala Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Lys Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr Val Ala Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Val
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 16
<211> 356
<212> PRT
<213>Artificial sequence
<400> 16
Met Gln Thr Arg Lys Ile Val Arg Ala Ala Ala Val Gln Ala Ala Ser
1 5 10 15
Pro Asn Tyr Asp Leu Ala Ala Gly Val Asp Lys Thr Ile Glu Leu Ala
20 25 30
Arg Gln Ala Arg Asp Glu Gly Cys Asp Leu Ile Val Phe Gly Glu Thr
35 40 45
Trp Leu Pro Gly Tyr Pro Phe His Val Trp Leu Gly Ala Pro Ala Trp
50 55 60
Ser Leu Lys Tyr Ser Ala Arg Tyr Tyr Ala Asn Ser Leu Ser Leu Asp
65 70 75 80
Ser Ala Glu Phe Gln Arg Ile Ala Gln Ala Ala Arg Thr Leu Gly Ile
85 90 95
Phe Ile Ala Leu Gly Tyr Ser Glu Arg Ser Gly Gly Ser Leu Tyr Leu
100 105 110
Gly Gln Cys Leu Ile Asp Asp Ile Gly Glu Met Leu Trp Ser Arg Arg
115 120 125
Lys Leu Lys Pro Thr Val Ala Glu Arg Thr Val Phe Gly Glu Gly Tyr
130 135 140
Ala Arg Asp Leu Ile Val Ser Asp Thr Glu Leu Gly Arg Val Gly Ala
145 150 155 160
Leu Cys Cys Trp Glu His Leu Ser Pro Leu Ser Lys Tyr Ala Leu Tyr
165 170 175
Ser Gln His Glu Ala Ile His Ile Ala Ala Trp Pro Ser Phe Ser Val
180 185 190
Tyr Ser Glu Gln Ala His Ala Leu Ser Ala Lys Val Asn Met Ala Ala
195 200 205
Ser Gln Ile Tyr Ser Val Glu Gly Gln Cys Phe Thr Ile Ala Ala Ser
210 215 220
Ser Val Val Thr Gln Glu Thr Leu Asp Met Leu Glu Val Gly Glu His
225 230 235 240
Asn Ala Ser Leu Leu Thr Val Gly Gly Gly Ser Ser Met Ile Phe Ala
245 250 255
Pro Asp Gly Arg Thr Leu Ala Pro Tyr Leu Pro His Asp Ala Glu Gly
260 265 270
Leu Ile Ile Ala Asp Leu Asn Met Glu Glu Ile Ala Phe Ala Lys Ala
275 280 285
Ile Asn Asp Pro Ala Gly His Tyr Ser Lys Pro Glu Ala Thr Arg Leu
290 295 300
Val Leu Asp Leu Gly His Arg Glu Pro Met Thr Arg Val His Ser Gln
305 310 315 320
Ser Leu Ile Lys Glu Glu Ala Cys Glu Pro Leu Thr Pro Ser Thr Ile
325 330 335
Ala Pro Val Ala Ile Ser Gln Ile Gln Glu Ser Asp Thr Leu Leu Val
340 345 350
Gln Glu Pro Ser
355
<210> 17
<211> 23
<212> DNA
<213>Artificial sequence
<400> 17
cccatatgca gacaagaaaa atc 23
<210> 18
<211> 23
<212> DNA
<213>Artificial sequence
<400> 18
ccaagctttc aggacggttc ttg 23
<210> 19
<211> 46
<212> DNA
<213>Artificial sequence
<400> 19
cgcaaactta aacccacaca tgcggagcgc accgtgtttg gtgaag 46
<210> 20
<211> 46
<212> DNA
<213>Artificial sequence
<400> 20
cttcaccaaa cacggtgcgc tccgcatgtg tgggtttaag tttgcg 46
<210> 21
<211> 46
<212> DNA
<213>Artificial sequence
<400> 21
cgcaaactta aacccacaca ttatgagcgc accgtgtttg gtgaag 46
<210> 22
<211> 46
<212> DNA
<213>Artificial sequence
<400> 22
cttcaccaaa cacggtgcgc tcataatgtg tgggtttaag tttgcg 46
<210> 23
<211> 44
<212> DNA
<213>Artificial sequence
<400> 23
ccgcaaactt aaacccacag tggcggagcg caccgtgttt ggtg 44
<210> 24
<211> 44
<212> DNA
<213>Artificial sequence
<400> 24
caccaaacac ggtgcgctcc gccactgtgg gtttaagttt gcgg 44
<210> 25
<211> 41
<212> DNA
<213>Artificial sequence
<400> 25
cgcctggccg tctttttcgg tgtacagtga acaggcccat g 41
<210> 26
<211> 41
<212> DNA
<213>Artificial sequence
<400> 26
catgggcctg ttcactgtac accgaaaaag acggccaggc g 41
<210> 27
<211> 45
<212> DNA
<213>Artificial sequence
<400> 27
caggcccgcg atgagggctg cgcactgatc gtgtttggtg aaacc 45
<210> 28
<211> 46
<212> DNA
<213>Artificial sequence
<400> 28
ggtttcacca aacacgatca gttgcgcagc cctcatcgcg ggcctg 46
<210> 29
<211> 45
<212> DNA
<213>Artificial sequence
<400> 29
aactcgctct cgctggacag ttgggaattt caacgcattg cccag 45
<210> 30
<211> 45
<212> DNA
<213>Artificial sequence
<400> 30
ctgggcaatg cgttgaaatt cccaactgtc cagcgagagc gagtt 45
<210> 31
<211> 45
<212> DNA
<213>Artificial sequence
<400> 31
ggccaatgcc tgattgacga catcggcgag atgctgtggt cgcgc 45
<210> 32
<211> 45
<212> DNA
<213>Artificial sequence
<400> 32
gcgcgaccac agcatctcgc cgatgtcgtc aatcaggcat tggcc 45
<210> 33
<211> 45
<212> DNA
<213>Artificial sequence
<400> 33
gagcccatga cacgggttca catccaaagc ctgatcaagg aagag 45
<210> 34
<211> 45
<212> DNA
<213>Artificial sequence
<400> 34
ctcttccttg atcaggcttt ggatgtgaac ccgtgtcatg ggctc 45
Claims (10)
1. nitrilase mutants according to claim 1, it is characterised in that the mutant includes SEQ ID NO：1
49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor in shown amino acid sequence on following any one or more amino acid sites, the site be 135,41,
192nd, 120, wherein,
The valine of the 135th is sported alanine or tyrosine；
The aspartic acid of the 41st is sported alanine；
192nd leucine is sported valine；
The lysine of the 120th is sported isoleucine.
2. nitrilase mutants according to claim 1, it is characterised in that the nitrilase mutants include SEQ
ID NO：The valine of the 135th is sported alanine or tyrosine in amino acid sequence shown in 1, also comprising following any one
49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor on individual or multiple amino acid sites, the site is selected from 41,134,120,82,192,319, wherein,
The aspartic acid of the 41st is sported alanine；
The histidine of the 134th is sported valine；
The lysine of the 120th is sported isoleucine；
The alanine of the 82nd is sported tryptophan；
192nd leucine is sported valine；
The serine of the 319th is sported isoleucine.
3. nitrilase mutants according to claim 1, it is characterised in that the nitrilase mutants include SEQ
ID NO：The valine of the 135th is sported alanine or tyrosine in amino acid sequence shown in 1, also comprising the 134th
Histidine is sported valine.
4. nitrilase mutants according to claim 3, it is characterised in that also comprising following any one or more ammonia
49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor on base acid site, the site is selected from 41,82,192,120,319, wherein,
The aspartic acid of the 41st is sported alanine；
The alanine of the 82nd is sported tryptophan；
192nd leucine is sported valine；
The lysine of the 120th is sported isoleucine；
The serine of the 319th is sported isoleucine.
5. nitrilase mutants according to claim 3, it is characterised in that also comprising following any one or more ammonia
49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor on base acid site, the site is selected from 41,192,120, wherein,
The aspartic acid of the 41st is sported alanine；
192nd leucine is sported valine；
The lysine of the 120th is sported isoleucine.
6. nitrilase mutants according to claim 1, it is characterised in that comprising SEQ ID NO：Amino acid shown in 1
Selected from the group of following amino acid mutation composition in sequence：
1)V135A+D41A；
2)V135A+K120I；
3)V135A+L192V；
4)H134V+V135A；
5)H134V+V135A+L192V；
6)H134V+V135A+L192V+D41A；
7)H134V+V135A+L192V+K120I。
7. polynucleotides, the nitrilase mutants in its coding claim 1-6 described in any one.
8. carrier, it includes the polynucleotides described in claim 7.
9. host cell, it includes the carrier described in claim 8.
10. the nitrilase mutants in claim 1-6 described in any one are in terms of optical activity 2- aryl-propionic acid is prepared
Application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710129680.0A CN106636044B (en) | 2017-03-07 | 2017-03-07 | Nitrilase mutants and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710129680.0A CN106636044B (en) | 2017-03-07 | 2017-03-07 | Nitrilase mutants and its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106636044A true CN106636044A (en) | 2017-05-10 |
| CN106636044B CN106636044B (en) | 2019-10-18 |
Family
ID=58847168
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710129680.0A Active CN106636044B (en) | 2017-03-07 | 2017-03-07 | Nitrilase mutants and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636044B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111094560A (en) * | 2017-07-17 | 2020-05-01 | 地中海感染基金会 | Novel mutant PTE enzyme |
| CN112210549A (en) * | 2019-07-09 | 2021-01-12 | 中国科学院天津工业生物技术研究所 | Nitrilase mutant protein and application thereof in catalytic synthesis of (R) -3-substituted-4-cyanobutyric acid compounds |
| CN112852789A (en) * | 2019-11-28 | 2021-05-28 | 中国科学院天津工业生物技术研究所 | Nitrilase mutant and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101072871B (en) * | 2004-08-16 | 2011-08-31 | 纳幕尔杜邦公司 | Production of 3-hydroxycarboxylic acid using nitrilase mutants |
| CN1849391B (en) * | 2002-05-15 | 2014-06-11 | 维莱尼姆公司 | Nitrilases, nucleic acids encoding them and methods for making and using them |
| CN104212784A (en) * | 2014-08-12 | 2014-12-17 | 浙江工业大学 | Recombinant nitrilase, coding gene, mutant, engineering bacteria and application thereof |
| CN104774825A (en) * | 2015-03-23 | 2015-07-15 | 浙江工业大学 | Nitrilase mutant and application thereof |
| CN105505904A (en) * | 2016-01-19 | 2016-04-20 | 浙江工业大学 | Nitrilase mutant, gene, carrier, engineering bacteria and application |
| CN103667228B (en) * | 2013-12-14 | 2016-08-17 | 江南大学 | Fungal nitrilase mutant that a kind of catalysis activity and heat endurance improve and construction method thereof |
| CN106148310A (en) * | 2016-08-11 | 2016-11-23 | 南京工业大学 | A kind of nitrilase mutants and the application in prepared by nicotinic acid thereof |
-
2017
- 2017-03-07 CN CN201710129680.0A patent/CN106636044B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1849391B (en) * | 2002-05-15 | 2014-06-11 | 维莱尼姆公司 | Nitrilases, nucleic acids encoding them and methods for making and using them |
| CN102796750B (en) * | 2002-05-15 | 2015-09-16 | 巴斯夫酶有限责任公司 | The nucleic acid of nitrilase, encoding nitrilase enzyme, and the method preparing and use them |
| CN105296512A (en) * | 2002-05-15 | 2016-02-03 | 巴斯夫酶有限责任公司 | Nitrilases, nucleic acids encoding them and methods for making and using them |
| CN101072871B (en) * | 2004-08-16 | 2011-08-31 | 纳幕尔杜邦公司 | Production of 3-hydroxycarboxylic acid using nitrilase mutants |
| CN103667228B (en) * | 2013-12-14 | 2016-08-17 | 江南大学 | Fungal nitrilase mutant that a kind of catalysis activity and heat endurance improve and construction method thereof |
| CN104212784A (en) * | 2014-08-12 | 2014-12-17 | 浙江工业大学 | Recombinant nitrilase, coding gene, mutant, engineering bacteria and application thereof |
| CN104774825A (en) * | 2015-03-23 | 2015-07-15 | 浙江工业大学 | Nitrilase mutant and application thereof |
| CN105505904A (en) * | 2016-01-19 | 2016-04-20 | 浙江工业大学 | Nitrilase mutant, gene, carrier, engineering bacteria and application |
| CN106148310A (en) * | 2016-08-11 | 2016-11-23 | 南京工业大学 | A kind of nitrilase mutants and the application in prepared by nicotinic acid thereof |
Non-Patent Citations (3)
| Title |
|---|
| QU XIAO 等: "Hydrolysis of ibuprofenoyl-CoA and other 2-APA-CoA esters by human acyl-CoA thioesterases-1 and 2 and their possible role in the chiral inversion of profens.", 《BIOCHEM PHARMACOL》 * |
| 徐诗伟 等: "酶法拆分腈类制备光学活性2-芳基丙酸", 《微生物学通报》 * |
| 胡艾希 等: "2-芳基丙酸类消炎药的酶催化拆分研究进展", 《中国医药工业杂志》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111094560A (en) * | 2017-07-17 | 2020-05-01 | 地中海感染基金会 | Novel mutant PTE enzyme |
| CN111094560B (en) * | 2017-07-17 | 2023-11-07 | 地中海感染基金会 | Novel mutant PTE enzyme |
| CN112210549A (en) * | 2019-07-09 | 2021-01-12 | 中国科学院天津工业生物技术研究所 | Nitrilase mutant protein and application thereof in catalytic synthesis of (R) -3-substituted-4-cyanobutyric acid compounds |
| CN112210549B (en) * | 2019-07-09 | 2022-06-10 | 中国科学院天津工业生物技术研究所 | Nitrilase mutant protein and application thereof in catalytic synthesis of (R) -3-substituted-4-cyanobutyric acid compounds |
| CN112852789A (en) * | 2019-11-28 | 2021-05-28 | 中国科学院天津工业生物技术研究所 | Nitrilase mutant and application thereof |
| CN112852789B (en) * | 2019-11-28 | 2022-04-05 | 中国科学院天津工业生物技术研究所 | Nitrilase mutant and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106636044B (en) | 2019-10-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105441403B (en) | Transaminase for producing C4H9NO2 | |
| CN106636044B (en) | Nitrilase mutants and its encoding gene and application | |
| CN110643559B (en) | Application of transfer vector gene for improving L-tryptophan production efficiency in escherichia coli | |
| CN106754806A (en) | A kind of improved transaminase and its application in the preparation of (R) 3 amino butanol | |
| CN106047837B (en) | Serratia lipase mutant, recombinant expression transformant, enzyme preparation and application | |
| CN104560905B (en) | A kind of thioether monooxygenase and its synthesis application from pseudomonad | |
| CN106520719A (en) | S-shaped omega-transaminase ATA-W12 as well as gene and application thereof | |
| CN105112385A (en) | Recombinant esterase, coding gene, carrier, engineering bacterium and application | |
| CN101659698B (en) | Violacein synthesized related protein system, coding gene cluster thereof and application thereof | |
| CN103981160A (en) | Thermomyces lanuginosus lipase mutant, coding genes, and applications of thermomyces lanuginosus lipase mutant | |
| CN107488639A (en) | Toluene monooxygenase and its application in the synthesis of chiral sulfoxide living things catalysis | |
| CN110592045B (en) | Recombinant esterase, gene, engineering bacterium and application of recombinant esterase to resolution of (R, S) -indoline-2-ethyl formate | |
| CN109321494B (en) | Kluyveromyces intermedia ZJB-17004 and application thereof | |
| CN105296513A (en) | Marine esterase as well as coding gene E22 and application thereof | |
| CN110129305A (en) | A kind of Cephalosporin C acylase mutant being used to prepare 7-ACA | |
| CN112553185B (en) | Nitrilase mutant with improved nitrile hydrolysis activity specificity and application thereof | |
| CN107603934A (en) | The engineered strain of one plant of heterogenous expression histon deacetylase (HDAC) inhibitor and its application | |
| CN110438194B (en) | Application of lipase in preparation of D-tropine methyl ester | |
| CN105950595A (en) | (-)-[gamma]-lactamase, gene, mutant, vector as well as preparation method and application of (-)-[gamma]-lactamase | |
| CN109609479B (en) | Aspergillus usamii epoxide hydrolase mutant with improved enantioselectivity | |
| CN112760298A (en) | Cytochrome P450BM3 oxidase mutant and preparation method and application thereof | |
| CN112746066B (en) | L-lysine decarboxylase mutant and application thereof | |
| CN109097374A (en) | A kind of preparation method, bacterial strain and its application of pseudomonas aeruginosa engineered strain | |
| CN104531630B (en) | A kind of design and preparation method of epoxide hydrolase mutant | |
| CN105062986B (en) | The application of carbonyl reduction enzyme gene, the engineering bacteria containing the gene and its catalytic reduction reaction method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |