CN106596976A

CN106596976A - Human C-reactive protein colloidal gold quantitative detection card

Info

Publication number: CN106596976A
Application number: CN201710037822.0A
Authority: CN
Inventors: 马永; 丁娜
Original assignee: Jiangsu Jinghong Biological Medicine Technology Co Ltd
Current assignee: Jiangsu Jinghong Biological Medicine Technology Co Ltd
Priority date: 2017-01-19
Filing date: 2017-01-19
Publication date: 2017-04-26
Anticipated expiration: 2037-01-19
Also published as: CN106596976B

Abstract

The invention relates to a human C-reactive protein colloidal gold quantitative detection card, two anti-human C-reactive protein (CRP) antibodies adopted for the card, and a preparation method of the antibodies. Multiple antibodies are prepared by an inventor, paired and screened, and antibody combinations (P20 and P02) with sensitivity and specificity both meeting requirements are obtained. Mass production is convenient, and the requirements of large-scale clinical application in future can be met. The antibody combinations are subjected to debugging optimization work of a detection system, the human C-reactive protein colloidal gold immunochromatography quantitative detection card which is easy and convenient to operate and has sensitivity, specificity and relevant detection performance greatly improved is obtained, and the clinical sample detection requirements are completely met.

Description

. Human C-reactiveprotein gold colloidal quantitative test card

Technical field

The invention belongs to biological technical field, is specifically related to Human C-reactiveprotein gold colloidal quantitative test card and its makes Two kinds of anti-human C reactive protein (CRP) antibody used.

Background technology

C reactive protein (C reactive protein, CRP) is a member in protein familieses, is that a kind of acute stage is anti- Albumen is answered, plasma concentration is drastically raised in tissue injury and bacterium infection, be the important defense molecule of body, mainly by liver Produce and secrete.CRP is combined into stable disk-like structure with non-covalently bonded by five identical spherical monomers, just belongs to Pentamer family.CRP is symmetrical pentahedron in structure, and monomer is made up of 206 aminoacid, and molecular weight is about 23KDa, The total molecular weight of CRP is about 118KDa.CRP participates in internal various inflammation and immunoreation, is coronary atherosclerotic The important symbol thing of heart disease (coronary heart disease).Numerous studies show：High-caliber CRP is peripheral vascular disease, myocardial infarction, brain The independent risk predictor of angiopathy and vascular death.

In normal human serum, CRP contents are few, and concentration is 0.062-8.2mg/L, about 15 hours half-life.Work as generation Bacterium infection started to raise after 2 hours, increased by 1 times within average 8 hours, reached peak within 48 hours, and which then will not in virus infection Raise.CRP is persistently raised, and points out body to there is chronic inflammatory disease or autoimmune disease.CRP changes are not by the individuality of patient The impact of difference, fuselage state and medicine.In addition, CRP also plays an important role in other field：1. by chronic The effect of CRP in the independent hazard factor of inflammation initiation cardiovascular disease has been found to, and the level of monitoring CRP changes to the heart in time The intervention and prognosis of angiopathy plays an important role.Some scholars are it is even contemplated that CRP can be used as the gold mark of cardiovascular danger assessment Standard, and CRP levels are higher, the danger that cardiovascular and cerebrovascular vessel occur is bigger；2. CRP can be used to the serious journey for evaluating acute pancreatitis Degree, when there are extensive necrosis pancreatitiss, in serum, the level of CRP may be up to 250mg/L；3. such as CRP is joined with alpha-fetoprotein Application is closed, can be used to differentiate liver malignancy and benign disease, formulated for clinical treatment and guidance is provided；In addition, CRP is surveyed Fixed treatment and prognosis to tumor also has positive meaning, and malignant tumor patient CRP levels are mostly raised, after ocal resection CRP levels can then decline, and it is very little to carry out the impact of radiotherapy, chemotherapy and corticosteroid therapy to serum CA125, so determining blood The level change of clear CRP contributes to the clinical progression for estimating malignant tumor in each tract.4. assess patient's prognosis： CRP levels are higher, point out disease control not good, prognosis malas.

In view of important function of the CRP in various fields, prepares CRP antibody and for preparing CRP immue quantitative detection reagent boxes With important clinical value.CRP is determined typically by antibody nephelometry or immunoturbidimetry, and their detection In more than 3-5mg/L, this level is suitable only for the prediction to infecting to ability, and for arteria coronaria and cerebrovascular risk prediction It is far from being enough.In addition to above-mentioned technology, using the CRP test cards of gold colloidal and fluorogenic quantitative detection technology, can meet fast The demand detected by speed detection and bed.Whole CRP detection methods wherein based on the quantitative chromatographic technique of gold colloidal had both had entirely certainly The accuracy of dynamic biochemical instruments Immunity transmission turbidity reagent, while detection is easier, quick, is adapted to diagnose by bed, it is easy to Carry out in outpatient service, emergency treatment or ICU wards.

The content of the invention

The technical problem to be solved in the present invention is to provide can the effective, antibody of specific binding Human C-reactiveprotein.More Specifically：

The first object of the present invention is to provide two kinds of anti-human C reactive protein antibody.

The first anti-human C reactive protein antibody (P20),

Its weight chain variable district contains following complementary determining region：Aminoacid sequence such as sequence SEQ ID NO：Shown in 1 HCDR1, such as sequence SEQ ID NO：HCDR2 and/or such as sequence SEQ ID NO shown in 2：HCDR3 shown in 3；

Its light-chain variable sequence contains following complementary determining region：Aminoacid sequence such as sequence SEQ ID NO：Shown in 4 LCDR1, such as sequence SEQ ID NO：LCDR2 and/or such as sequence SEQ ID NO shown in 5：LCDR3 shown in 6.

The aminoacid sequence such as SEQ ID NO of the weight chain variable district of the antibody P20 preferably in the present invention:Shown in 7, gently The aminoacid sequence of chain variable region such as SEQ ID NO:Shown in 8.

Second anti-human C reactive protein antibody (P02),

Its weight chain variable district contains following complementary determining region：Aminoacid sequence such as sequence SEQ ID NO：Shown in 9 HCDR1, such as sequence SEQ ID NO：HCDR2 and/or such as sequence SEQ ID NO shown in 10：HCDR3 shown in 11；

Its light-chain variable sequence contains following complementary determining region：Aminoacid sequence such as sequence SEQ ID NO：Shown in 12 LCDR1, such as sequence SEQ ID NO：LCDR2 and/or such as sequence SEQ ID NO shown in 13：LCDR3 shown in 14.

The aminoacid sequence such as SEQ ID NO of the weight chain variable district of antibody P02 preferably in the present invention:Shown in 15, resist The aminoacid sequence of body light chain variable district such as SEQ ID NO:Shown in 16.

Second purpose of the invention is to provide two kinds of single-chain antibodies, the aminoacid sequence such as SEQ of the single-chain antibody P20 ID NO:Shown in 17；The aminoacid sequence of the single-chain antibody P02 such as SEQ ID NO:Shown in 18.

The 3rd purpose of the present invention is to provide two kinds of nucleotide sequences for encoding above-mentioned single-chain antibody, encodes single-chain antibody The nucleotide sequence of P20 such as SEQ ID NO:Shown in 19, and the nucleotide sequence such as SEQ ID NO of coding single-chain antibody P02:20 It is shown.

4th purpose of the invention is to provide a kind of expression vector containing above-mentioned nucleotide sequence.

5th purpose of the invention is to provide a kind of recombinant host cell containing above-mentioned expression vector.Affiliated host cell Can be escherichia coli, yeast or mammalian cell, preferably escherichia coli.

6th purpose of the invention is to provide a kind of method for producing above-mentioned single-chain antibody, including：

1) above-mentioned recombinant host bacterium expression antibody is cultivated under suitable conditions；

2) and then from Host Strains purification, collect antibody.

7th purpose of the present invention is to provide above-mentioned anti-human C reactive protein antibody to contain in detection Human C-reactiveprotein Application in amount.

8th purpose of the present invention is to provide one group to be matched and be detected the antibody of Human C-reactiveprotein to group Close P20 and P02；The antibody is high to the detection sensitivity for combining, and specificity is good.

9th purpose of the present invention is to provide a kind of using the anti-human C reactive protein antibody test human C-reactive The colloidal gold immunochromatographimethod quantitative test card of albumen, including sample absorption pad, gold standard pad, reaction film and adsorptive pads；The gold mark Pad is coated with the antibody P02 or P20 of colloid gold particle labelling, has detection band and quality control band, detection band position on the reaction film Antibody P20 or P02 are coated with, quality control band position is coated with anti-His tag antibodies or Protein L.The preferred nitric acid of the reaction film Cellulose membrane.The anti-His antibody of the preferred Mus of the anti-His tag antibodies.

The present invention is prepared for Multiple Antibodies, and carries out pairing screening, obtains sensitivity and specificity can meet demand Antibody Combination (P20 and P02)；Its convenient a large amount of production, can meet the demand of larger scale clinical application in the future simultaneously.To above-mentioned anti- Body combination carries out the debugging Optimization Work of detection system, obtains easy to operate, sensitivity, specificity and coherent detection performance Meet the colloidal gold immunochromatographimethod quantitative test card of the Human C-reactiveprotein of people's clinical sample detection.

Description of the drawings

Fig. 1：PCR identifies P20 and P02 heavy chain of antibody and light chain variable district agarose gel electrophoresis figure.

Wherein, Lane 1 is 200bp DNA Ladder；Lane 2 is antibody P20 weight chain variable district DNA sequence；Lane 3 For antibody P20 light chain variable district DNA sequence；Lane 4 is antibody P02 weight chain variable district DNA sequence；Lane 5 is that antibody P02 is light Chain variable region DNA sequence.

Fig. 2：Single-chain antibody structural representation.V_HRepresent weight chain variabl area sequence, V_LRepresent light-chain variable sequence, His marks Sign as six histidine.

Fig. 3：Abduction delivering qualification figures of the single-chain antibody P20 and P02 in recombination bacillus coli engineering bacteria.

Wherein, Fig. 3-a are abduction delivering SDS-PAGEs of the single-chain antibody P20 and P02 in recombination bacillus coli engineering bacteria Gel electrophoresis figure.Albumen loading Marker of the swimming lane 1 for the pre-dyed of (10-230kDa) wide scope；Swimming lane 2 is not add IPTG to lure The single-chain antibody P20 recombination bacillus coli engineering bacteria lysates led；Swimming lane 3 is recombinated for the single-chain antibody P20 for adding IPTG inductions Colibacillus engineering lysate；Swimming lane 4 is cracked for the single-chain antibody P02 recombination bacillus colis engineering bacteria for not adding IPTG inductions Liquid；Single-chain antibody P02 recombination bacillus coli engineering bacteria lysate of the swimming lane 5 for addition IPTG inductions.

Fig. 3-b are induction expression protein immunoblottings of the single-chain antibody P20 and P02 in recombination bacillus coli engineering bacteria Figure.Albumen loading Marker of the swimming lane 1 for the pre-dyed of (10-230kDa) wide scope；Swimming lane 2 is single-stranded for do not add IPTG to induce Antibody P20 recombination bacillus coli engineering bacteria lysates；Single-chain antibody P20 recombination bacillus coli of the swimming lane 3 for addition IPTG inductions Engineering bacteria lysate；Swimming lane 4 is the single-chain antibody P02 recombination bacillus coli engineering bacteria lysates for not adding IPTG to induce；Swimming lane 5 To add the single-chain antibody P02 recombination bacillus coli engineering bacteria lysates of IPTG inductions.

Fig. 4：Single-chain antibody P20 and P02 recombination bacillus coli engineering bacteria lysate is through the affine column purifications of HisTrap HP Collect peak and merge sample PAGE gel electrophoretogram.Albumen loading of the swimming lane 1 for the pre-dyed of (10-230kDa) wide scope Marker；Swimming lane 2 is single-chain antibody P20 recombination bacillus coli engineering bacteria lysates through HisTrap HP affinity column purified pools Peak merges sample；Swimming lane 3 is single-chain antibody P02 recombination bacillus coli engineering bacteria lysates through the affine column purifications of HisTrap HP Collect peak and merge sample.

Fig. 5：Colloidal gold immunochromatographimethod quantitative test card structural representation of the present invention.1 is sample pad, 2 is reaction film, 3 are Absorption pad, 4 be nature controlling line (C lines), 5 be detection line (T lines), 6 be gold standard pad, 7 be PVC sheet.

Fig. 6：CRP colloidal-gold detecting-card detection range matched curves.

Fig. 7：CRP colloidal-gold detecting-card range of linearity matched curves.

Fig. 8：CRP colloidal-gold detecting-cards compare matched curve with reference product.

Specific embodiment

Definition

" antibody " is large-scale Y shape protein that a class is secreted by bone-marrow-derived lymphocyte, can pass through Y shape also known as immunoglobulin Two of which bifurcated top complementary site (antigen knot bound site) specifically bind target antigen immunoglobulin molecules, institute State target antigen such as protein, sugar, polynucleotide, fat, polypeptide, micromolecular compound etc..

" single-chain antibody " (scFv) refers to the weight chain variable district (V of antibody_H) and light chain variable district (V_L) by 15～20 The single chain fusion protein that amino acid short peptide (linker) connection is formed, the linker for connection are generally rich in glycine and silk Propylhomoserin, is beneficial to the stability and pliability of single-chain antibody.Connected mode can be by V_LN-terminal be connected to V_HC-terminal, Huo Zhexiang Instead.Although eliminating constant region and introducing linker, single-chain antibody still remains specificity of the antibody to antigen, and which has Molecular weight is little, penetration power is strong and the features such as weak antigenicity.

Complementary determining region (complementarity-determining region, CDR), also referred to as hypervariable region.Molding In the end of antibody monomer aminoacid, it is the most critical zone of target antigen and antibodies, in Artificial Immune Network Theory, each resists The complementary determining region of body is otherwise known as idiotype or genotype.

The preparation of 1. anti-human C reactive protein hybridoma cell strain of embodiment

1. animal immune

To be extracted from the C reactive protein (purchased from HyTest companies) of human plasma according to general immune programme for children immunity BALB/c Female mice (is purchased from this laboratory animal company limited of Changzhou Kabiven PI).Concrete Immunity referring to《Antibody preparation is tested with using Guide》.Immune serum titre is tracked using indirect elisa method, serum titer highest immune mouse is chosen, is carried out mice Splenocyte and murine myeloma cell carry out fusion experiment.

2. cell fusion

(1). the preparation of spleen cell

By immune mouse, pluck eyeball and take blood, be placed in the ethanol of 75% (v/v) Jing after disconnected cervical vertebra is put to death and soak 10min, in Its spleen is taken out in aseptic operating platform, is placed in cell screen clothes, be fully ground cell, cross screen cloth, with (the purchase of aseptic 1640 culture medium From Gibco companies) centrifuge washing for several times after, re-suspended cell is to make single cell suspension, and counts, standby.

(2). the preparation of feeder cells

Female BAl BIc/c the mices one of 8～10 week old are taken, eyeball is plucked and is obtained negative serum, the disconnected cervical vertebras of Jing put to death rearmounted 10min is soaked in 75% (v/v) ethanol；It is aseptic to open skin of abdomen, peritoneum is exposed, will about 10mL 1640HT trainings with syringe Foster base (being purchased from SIGMA companies) injection mouse peritoneal, gently abdomen massage piping and druming is for several times.Draw the culture containing macrophage It is standby in base injection 20%1640HAT culture medium；

Female BAl BIc/c the mices one of 2～3 week old are taken, is placed in 75% (v/v) ethanol Jing after disconnected cervical vertebra is put to death and is soaked 10min；, in cell screen clothes, screen cloth is crossed in grinding for the aseptic thymus that take, obtain thymocyte cell be placed in it is above-mentioned containing macrophage It is in 20%1640HAT culture medium, standby.

(3). cell fusion

The murine myeloma cell strain SP2/0 in exponential phase is selected, is collected and is counted.Take about 10⁸Individual above-mentioned spleen Cell and 2 × 10⁷Individual above-mentioned SP2/0 cell strains mix in adding fusion pipe, and 1000rpm abandons supernatant (as far as possible after being centrifuged 10 minutes Abandon net), fusion pipe is put and gently rubbed so that precipitation is loose back and forth on palm.Add 1mL preheatings after elder generation is slow in 60 seconds soon PEG1450 (Macrogol 1450, purchased from SIGMA companies), adds 1640HT culture medium 30mL to terminate, and 1000rpm is centrifuged 10 points Clock, removes supernatant, and gently friction makes precipitation loose, in the 1640HAT culture medium of add that step 2 obtained 20%.

After above-mentioned HAT culture medium is fully mixed, with 200 μ L/ hole subpackages into 96 porocyte culture plates, 37 DEG C are put, 5% CO₂Cell culture incubator in cultivate.20%1640HAT culture medium is replaced with 10%1640HT culture medium after one week, is taken after 3 days Detected clearly.

3. anti-human C reactive protein specific hybrid tumor strain screening

(1). the preparation of detection plate：With CB coating buffers dilution CRP (buying in HyTest companies) to 1 μ g/mL, 96 holes are coated with ELISA ELISA Plate, 100 μ L/ holes, 2～8 DEG C of coatings overnight, washed once and pat dry；Containing 2% bovine serum albumin (Bovine Serum Albumin, BSA, buy in Yancheng Sai Bao bio tech ltd) PBST buffer blinds (200ul/ holes), 37 DEG C are closed 2 hours；Pat dry, it is standby.

(2). the screening of positive colony：100 μ L/ holes of cells and supernatant to be checked are added in above-mentioned detection plate, in 37 DEG C Effect was washed and is patted dry after 30 minutes, added the sheep anti-mouse igg of the HRP labellings in 100 μ L/ holes, was washed after acting on 30 minutes in 37 DEG C Wash and pat dry, add the TMB nitrite ions in 100 μ L/ holes, develop the color 15 minutes in 37 DEG C of lucifuges, the 2M H of 50 μ L are added per hole₂SO₄Eventually Only react, and the reading numerical values at the OD450.Positive hole determines principle：OD450 values/negative control value >=2.1.Choose positive gram Grand strain carries out Cell-cloned screening.After the cloning screening of three to four-wheel, monoclonal cell strain positive rate 100% is i.e. true It is set to stable cell line, singling is carried out to cell strain.Hybridoma cell strain M20 and M02 are respectively provided with higher potency, subsequently enter then One step carries out antibody variable sequences sequencing analysis to above-mentioned hybridoma cell strain.

The measure of 2. hybridoma cell strain antibody variable sequences of embodiment

Above-mentioned hybridoma cell strain M20 and M02 antibody variable sequences are measured.

The extraction of a.RNA：Reference cell total serum IgE extraction agent box (being purchased from Roche companies) description is to above-mentioned hybridoma Cell strain M20 and M02 carry out Total RNAs extraction and carry out reverse transcription immediately；

B.RNA reverse transcriptions become DNA：With reference to Thermo Scientific Reverted First strand cDNA The total serum IgE of (being purchased from Thermo companies) to being extracted in previous step Synthesis Kit carries out reverse transcription, cDNA is obtained, freezes Be stored in -20 DEG C it is standby；

C. the PCR amplifications and recovery of variable region sequences：With in previous step gained cDNA as template, with Mus IgG hypotype lists Clonal antibody variable region sequences universal primer is primer, enters performing PCR amplification to the variable region sequences of heavy chain and light chain, PCR is produced Thing Jing DNA glue reclaim test kits (being purchased from TIANGEN companies) are reclaimed, and see accompanying drawing 1；

D. the clone of variable region sequences and sequencing：According to cloning vehicle pMD18-T kit (being purchased from Takara companies) Description, heavy chain and chain variable region gene are attached with pMD18-T carriers respectively, convert bacillus coli DH 5 alpha, picking Positive colony, transfers to Nanjing Genscript Biotechnology Co., Ltd. to be sequenced.

Sequencing obtains antibody (being designated as P20) the heavy chain variable amino acid sequence such as SEQ ID of hybridoma cell strain M20 NO:7 is shown, chain variable region amino acid sequence such as SEQ ID NO：Shown in 8.The above-mentioned sequence of Vbase2 database analysises, which is heavy The aminoacid sequence of each complementary determining region of chain variable region is respectively：Such as sequence SEQ ID NO：HCDR1 shown in 1, such as sequence SEQ ID NO：HCDR2 and/or such as sequence SEQ ID NO shown in 2：HCDR3 shown in 3；Each complementation of its light chain variable district Determine area aminoacid sequence be：Such as sequence SEQ ID NO：LCDR1, such as sequence SEQ ID NO shown in 4：Shown in 5 LCDR2 and/or such as sequence SEQ ID NO：LCDR3 shown in 6.

Sequencing obtains antibody (being designated as P02) the heavy chain variable amino acid sequence such as SEQ ID of hybridoma cell strain M02 NO:15 is shown, chain variable region amino acid sequence such as SEQ ID NO：Shown in 16.The above-mentioned sequence of Vbase2 database analysises, its The aminoacid sequence of each complementary determining region of weight chain variable district is respectively：Such as sequence SEQ ID NO：HCDR1 shown in 9, such as sequence Row SEQ ID NO：HCDR2 and/or such as sequence SEQ ID NO shown in 10：HCDR3 shown in 11；Its light chain variable district it is each The aminoacid sequence of complementary determining region is：Such as sequence SEQ ID NO：LCDR1, such as sequence SEQ ID NO shown in 12：Shown in 13 LCDR2 and/or such as sequence SEQ ID NO：LCDR3 shown in 14.

The recombinant expressed and purification of 3. single-chain antibody of embodiment

According to sequencing result in embodiment 2, connection will be added between M20 and M02 heavy chain of antibody and light chain variable district respectively Peptide (GGGGS)₃, and its full genome is synthesized, is carried out the expression vector establishment of single-chain antibody and recombinant expressed.Expressed To antibody be respectively designated as antibody P20 and antibody P02, its structure composition is as shown in Figure 2.The restructuring table of above-mentioned single-chain antibody Up to specific as follows：

A) single-chain antibody P20 and P02 expression plasmids build

The nucleotide sequence of single-chain antibody P20 such as SEQ ID NO:19 is shown, aminoacid sequence such as SEQ ID NO:17, it is single The nucleotide sequence of chain antibody P02 such as SEQ ID NO:20 is shown, aminoacid sequence such as SEQ ID NO:Shown in 18.Will be single-stranded anti- Body P20 and P02 full genome is building up in pUC57 plasmids (being provided by Nanjing Genscript Biotechnology Co., Ltd.), obtains one kind Long-term to preserve plasmid, plasmid is designated as pUC57-P20-scFv- (HIS) respectively₆With pUC57-P02-scFv- (HIS)₆.Enter performing PCR Amplification, wherein the upstream and downstream primer of amplification single-chain antibody P20 is P1 and P2, the upstream and downstream primer for expanding single-chain antibody P02 is P3 And P4

Forward primer P1：CTAGCCATGGAAGTTATGTTGGTTGAATC(SEQ ID NO:21)；

Downstream primer P2：CCGCTCGAGTTACTAGTGATGGTGATGG(SEQ ID NO:22).

After Standard PCR program, agarose gel electrophoresiies analysis shows that two kinds of primer sizes are in the same size with expection.By PCR After obtaining gene outcome recovery purifying, using NcoI (#R0193S, purchased from New England BioLabs companies) and XhoI (# R0146S, purchased from New England BioLabs companies) double digestion, with T4 ligases be connected to pET28a (69864, be purchased from Merck companies) in plasmid, it is transformed in DH5a competent cells (CB101, purchased from Beijing Tiangeng biochemical technology Co., Ltd), 37 DEG C of overnight incubations in the LB flat boards containing kanamycin (0408, purchased from Amresco companies).Second day screening positive clone Bacterium is sequenced, and compares, completely the same with expected sequence, that is, obtain the expression plasmid of single-chain antibody P20, be designated as pET28a-P20- scFv-(HIS)₆With pET28a-P02-scFv- (HIS)₆。

B) structure of single-chain antibody P20 and P02 recombination bacillus coli engineered strains, screening and expression

Comprise the following steps that：

Sequencing in 3 step a of embodiment is compared into correct pET28a-P20-scFv- (HIS)₆And pET28a-P02- scFv-(HIS)₆Plasmid is transformed into e. coli bl21 (DE3) competence bacterial strain, and (CB105 has purchased from Beijing Tiangeng biochemical technology Limit company) in, incubated overnight in 37 DEG C of kanamycin flat boards.Choose within second day positive bacterium colony respectively, access containing 50 μ g/mL cards that The LB culture fluid of mycin, 37 DEG C of overnight incubations.Take 50 μ L overnight cultures and access the 5mL inductions of the LB containing 50 μ g/mL kanamycin Culture fluid, 37 DEG C of shaken cultivation.When OD600=1.0, induction table is carried out with the IPTG (being purchased from Amresco companies) of 1mmol/L Reach.Negative control is done with the E. coli broth for not adding IPTG simultaneously.12000rpm after 4h, 3min collect bacterium solution, with advance Cold PBS precipitation, adds 5 × sds gel sample loading buffer, 100 DEG C of heating 10min, room temperature 12000rpm, 1min high speeds Centrifugation, takes supernatant.The E. coli broth of IPTG is not added by this step process yet.Respectively take and do not add IPTG obtained by 5 μ L With the sample for adding IPTG inductions, 12%SDS-PAGE gel electrophoresiss and Western blot analysis expression effect, Western In blot, one resists for anti-HIS-Tag antibody that (His-Tag (2A8) Mouse mAb, M20001 are purchased from the biological doctors of Shanghai Ai Bimate Medicine company limited) see Fig. 3-a and Fig. 3-b.

C) single-chain antibody P20 and P02 purification

Using histidine-tagged affinity column purification of single stranded antibody P20 and P02, pre-install pillar and select as HisTrap HP, tool Body step is as follows：

Take single-chain antibody P20 and P02 recombination bacillus coli engineered strain glycerol tube to be inoculated in containing 50 according to 1% inoculum concentration In the LB fluid mediums of μ g/ml kanamycin, 37 DEG C, 220rpm adds final concentration of 1mM when cultivating to OD600 ≈ 1.0 IPTG carries out abduction delivering, and thalline is collected by centrifugation after abduction delivering 4h.PBS with pre-cooling is resuspended, in 4 DEG C with 12000rpm, from Heart 15min；It is repeated once.Supernatant is sucked, claims bacterial sediment weight, per gram (thalline weight in wet base) to add 5mL combination buffers： 300mM NaCl, 20mM NaH₂PO4,10mM Imidazole, pH=7.5.After fully mixing, per gram of (thalline weight in wet base) thalline 5 μ L 100mmol/L PMSF, 5 μ L 100mg/mL lysozyme are added to be incubated 20min on ice.Sample is placed on ice, uses sonde-type Ultrasonoscope crushes thalline, and ultrasound 120 times, each 5s are spaced 5s, circulate three times, is recycled between cooling sample every time and is waited 2min, waits sample cooling.4 DEG C, 12000rpm is centrifuged 15min, crosses 0.45 μm of filter membrane.

HisTrap HP are affine column purification：With fully-automatic intelligent protein purification system (AKTA avant150, purchased from GE Healthcare companies) affinity purification is carried out respectively to the single-chain antibody P20 and P02 cell pyrolysis liquid that above-mentioned pretreatment is obtained, Pillar is HisTrap HP (17-5248-02, purchased from GE healthcare companies).Combination buffer is 300mM NaCl, 20mM NaH₂PO₄, 10mM Imidazole, pH7.5, elution buffer are 300mM NaCl, 20mM NaH₂PO₄, 500mM Imidazole, pH7.5.Linear elution is carried out during eluting, and collects each eluting peak.

By SDS-PAGE electroresis appraisal purity, merge purity higher satisfactory single-chain antibody P20 and P02 and collect Pipe, changes buffer and is PBS solution and is concentrated by ultrafiltration (1mg/ml) that filtration sterilization is saved backup in -20 DEG C.

Those skilled in the art know, recombiant protein can not tape label, also also can add other shapes with other labels The connection peptides of formula.Regardless of whether tape label or the label with multi-form can all adopt the affine filler purification of protein L.

The performance evaluation of 4. single-chain antibody of embodiment

1. the Western blot identifications of single-chain antibody P20 and P02

A. polyacrylamide gel electrophoresis：It is respectively configured 12% non-denaturing polyacrylamide gel and SDS- polyacrylamides Gel；Difference loading standard protein and natural CRP albumen (buying in HyTest companies), electrophoresis 1 hour under constant pressure；

B. transferring film：Under the conditions of constant current (35mA/ films), transferring film 1 hour, the protein in polyacrylamide gel is turned respectively Move on nitrocellulose filter.Coomassie brilliant blue G250 is dyeed to the polyacrylamide gel for completing transferring film, observes albumen Residual condition；

C. close：TBST buffer blinds (confining liquid) containing 5% defatted milk, 4 DEG C overnight；Cleaning mixture after closing (TBST, Refer to TaKaRa company's T BST buffer) wash three times, each 5min；

D. antigen antibody reaction：Confining liquid dilution (presses 1:400 volume ratios) horseradish peroxidase-labeled P20 (P20- HRP, 1mg/mL, our company adopt classical Over-voltage protection labelling, similarly hereinafter) and horseradish peroxidase-labeled P02 (P02-HRP, 1mg/mL, our company adopt classical Over-voltage protection labelling, similarly hereinafter), it is separately added in above-mentioned nitrocellulose filter, room temperature reaction 1h；TBST is washed 5 times, each 5min；

E. develop the color and take pictures：Blot residual liquid on nitrocellulose filter, it is steady that every nitrocellulose filter is separately added into 2mL Sizing Peroxidase Solution (1mL) and the mixed liquor (buying in Thermo companies) of luminol/enhancing agent solution (1mL), The surface of even moistening nitrocellulose filter, room temperature lucifuge are reacted one minute and are clapped after gel imaging system (buying in GE companies) According to leaving and taking result.

Test result indicate that, the natural CRP reactions that two kinds of antibody of the present invention can be extracted with degeneration and non denatured blood, card Understand the adhesion of two kinds of antibody of the present invention and natural CRP.

2. evaluations of the single-chain antibody P20 and P02 in gold colloidal detection platform

The antibody of purification in embodiment 3 is carried out into combinations of pairs, is matched respectively as coated antibody or traget antibody Detection C reactive protein (CRP), detecting step is as follows：

1) P20 or single-chain antibody P02 are diluted to into 1mg/ml with antibody coating buffer, are lined on nitrocellulose filter；

2) it is laid on pad after the P20 of colloid gold label or P02 being diluted 5 times with 0.01M PB buffer；

3) pad pasting, cutting as shown in accompanying drawing 5, are installed (specifically prepare referring to embodiment 5)

4) with Sample dilution dilution CRP standard substance (buying in HyTest companies), to concentration be 50ug/mL, 1ug/mL, The two concentration standards and zero standard's product (i.e. Sample dilution) are added into 50ul in colloidal-gold detecting-card respectively (P20 is coated with-P02 labellings or P02 coating-P20 labellings), detection card is placed on readout instrument after 10min carries out reading.As a result It is as shown in the table：

From the above results, it is seen that the double antibody sandwich method that P20 is constituted as traget antibody as coated antibody, P02 Detecting system can be applicable to gold colloidal detection platform, carry out the detection of natural CRP.

The preparation of the colloid gold immune detection card of 5 anti-human C reactive protein of embodiment

1st, solution is prepared

1) prepared by 0.01M PB buffer：Weigh Na₂HPO₄·12H₂O 3.22g, NaH₂PO₄·2H₂O 0.15g, plus it is pure Change water 1000mL, rotor is stirred to dissolving, its pH7.4 ± 0.1,0.45um membrane filtrations are determined with ph meters.

2) prepared by confining liquid：Bovine serum albumin 5g, plus 0.01M PB solution (PH7.4 ± 0.1) 50mL are weighed, rotor is stirred Mix to dissolving.

3) prepared by antibody coating buffer：0.2mL isopropanols are taken, 9.8mL 0.01M PB solution (PH7.4 ± 0.1) is added, is turned Son stirring 5-10min.

4) gold labeling antibody is redissolved liquid and is prepared：1g bovine serum albumin is weighed, 5g trehaloses add 100mL 0.01M PB molten Liquid (pH7.4 ± 0.1), rotor is stirred to dissolving, adds 25ul Tween-20, continuation to stir 5-10min with rotor.

5) prepared by Sample dilution：Weigh 12.5g bovine serum albumin add 500mL 0.01M PB solution (PH7.4 ± 0.1), rotor is stirred to dissolving, adds 0.5ml Proclin300, continuation to stir 5-10min with rotor.

2nd, prepared by Human C-reactiveprotein colloidal-gold detecting-card

1) labelling of gold colloidal

The colloid gold label (by taking 1ml colloidal gold solution labellings as an example) of antibody P02：Use K₂CO₃Adjust gold colloidal pH value (every 5ul 0.2M K are added in 1ml gold colloidals₂CO₃), 5-10min is stirred, antibody P02 is slowly added to in colloidal gold solution (per 1ml 25ug antibody P02 are added in gold colloidal), stirring at low speed 30min；Confining liquid BSA is added to its final concentration of 10% (quality percentage Than), stir 20min；Stand 12000rpm centrifugation 30min after 30min；Go supernatant 100uL gold labeling antibodies to redissolve liquid and redissolve to sink Shallow lake obtains final product the P02 antibody of colloid gold label.

2) gold standard pad and reaction film preparation

After P02 gold labeling antibodies are diluted 5 times, it is sprayed in gold standard pad 6, drying for standby；

Antibody P20 antibody diluents are diluted to after 1.5mg/mL, the T of reaction film 2 (nitrocellulose filter) is coated in 5 position of line；Anti- His tag antibodies antibody diluent is diluted to after 0.2mg/mL, 2 (celluloid of reaction film is coated in Film) 4 position of C lines, reaction film drying for standby.

3) pad pasting, cut film, assembling

Sample pad 1, gold standard pad 6, the nitrocellulose filter 2 for being coated with antibody, adsorptive pads 3 are set gradually from left to right (as shown in Figure 5), and should contact a little between any two, the T lines 5 of the nitrocellulose filter for being coated with antibody are in left, C lines 4 On the right side, and cut according to shell size, loaded shell, complete to detect that blocking is standby.

4) test kit assembling

The detection card for assembling, desiccant are loaded in aluminium foil bag, heat sealing machine sealing is labelled；

Sample dilution is carried out into subpackage by 1mL/ pipes, and loads valve bag according to test kit specification, labelled；

According to trimmed size, by the interior bag of certain number, 1 valve bag containing Sample dilution, 1 part of description, 1 conjunction Case marker label load in packing box, and label is posted outside packing box.

3rd, Human C-reactiveprotein colloidal-gold detecting-card using method

1) outer package is opened, detection card is taken out from sealing aluminium foil bag, is placed on flat table.

2) 2 μ l serum/plasma samples are drawn, in adding Sample dilution, is sufficiently mixed.

3) draw in the well of sample addition detection cards of the 50ul Jing after processing, under room temperature, stand 10min.

4) detection card is put in immunochromatography quantitative analysis instrument, presses " quick detection " key and start detection, instrument will be automatic To detecting that card is scanned.

5) read from the display screen of immunochromatography quantitative analysis instrument/print testing result.

4th, Human C-reactiveprotein colloidal-gold detecting-card Detection results assessment

1) elaboration：By P20 (coating)-P02 (labelling) detections card by the using method detection 1,10,50ug/ml of detection card Each 10 replications of CRP reference materials, reject outlier after calculate detection card precision.Experimental result shows three concentration inspections Survey result coefficient of variation CV<15%.

2) detection range：By P20 (coating)-P02 (labelling) detect card detection variable concentrations CRP recombiant proteins 0.5, 1.56th, 3.125,6.25,12.5,25,50,100ug/mL, matched curve and detection range are 0.5-100ug/ml (such as accompanying drawing 6)。

3) range of linearity：High level sample and Sample dilution are configured to into 5 series concentration samples according to a certain percentage 0.5th, 25,50,75,100ug/mL, with P20 (coating)-P02 (labelling) detection card detections, each pattern detection 3 times, by result Regression calculation is carried out with theoretical concentration, judges whether linear in the concentration range.The range of linearity be 0.5-100ug/ml (such as Accompanying drawing is 7).Sensitivity 0.5ug/mL.

4) accuracy：By P20 (coating)-P02 (labelling) detections card by the using method detection 1,10,50ug/ml of detection card Each 3 repetitions of CRP reference materials, calculate the relative deviation of meansigma methodss and theoretical value, experimental result shows that three Concentration Testings are tied Fruit relative deviation B<15%.

5th, accuracy-methodology is compared：

The Guangzhou Wondfo Biotech. Co., Ltd. for obtaining good prestige in selecting like product in the market is complete Journey C reactive protein (hsCRP+ routine CRP) quantitative detecting reagent (immunochromatographic method) compares product comparison checking.Select 20 Part clinical patient specimen, by 1 to 20 serial number, with reference product and the glue of P20 (coating)-P02 (labelling) to be evaluated Body gold detection card is tested simultaneously, according to 1,2,3......18,19,20,20,19,18......3,2,1 sample order It is measured.Control and the testing result coefficient R of product to be evaluated²=0.980, illustrate two methods testing result have compared with Good dependency (such as accompanying drawing 8).

6th, recipe determination

In addition to above-mentioned optimum preparation example 1, applicant also attempts various preparation schemes, such as several groups of detection blockings below it is standby and Using result such as following table：

SEQUENCE LISTING

<110>Jiangsu Zhonghong Biopharma Institute Inc.

<120>Human C-reactiveprotein gold colloidal quantitative test card

<130>Human C-reactiveprotein gold colloidal quantitative test card

<160> 24

<170> PatentIn version 3.3

<210> 1

<211> 8

<212> PRT

<213>Artificial sequence

<400> 1

Gly Phe Thr Phe Ser Ser Tyr Ala

1 5

<210> 2

<211> 8

<212> PRT

<213>Artificial sequence

<400> 2

Ile Ser Thr Ser Gly Ser Asp Arg

1 5

<210> 3

<211> 7

<212> PRT

<213>Artificial sequence

<400> 3

Ala Arg Arg Gly Trp Asp Tyr

1 5

<210> 4

<211> 11

<212> PRT

<213>Artificial sequence

<400> 4

Gln Ser Leu Val His Ser Asn Gly Asn Thr Tyr

1 5 10

<210> 5

<211> 3

<212> PRT

<213>Artificial sequence

<400> 5

Lys Val Ser

1

<210> 6

<211> 9

<212> PRT

<213>Artificial sequence

<400> 6

Ser Gln Asn Thr His Val Pro Pro Thr

1 5

<210> 7

<211> 114

<212> PRT

<213>Artificial sequence

<400> 7

Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Thr Pro Glu Arg Arg Leu Glu Trp Val

35 40 45

Ala Thr Ile Ser Thr Ser Gly Ser Asp Arg Tyr Tyr Pro Asp Ser Val

50 55 60

Lys Trp Arg Phe Thr Ile Ser Arg Asp Ser Ala Lys Asn Ile Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys

85 90 95

Ala Arg Arg Gly Trp Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val

100 105 110

Ser Ala

<210> 8

<211> 112

<212> PRT

<213>Artificial sequence

<400> 8

Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly

1 5 10 15

Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser

20 25 30

Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Ser Gly Gln Ser

35 40 45

Pro Lys Leu Leu Leu Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Ser

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Asn

85 90 95

Thr His Val Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 9

<211> 8

<212> PRT

<213>Artificial sequence

<400> 9

Gly Phe Thr Phe Ser Ser Tyr Ala

1 5

<210> 10

<211> 8

<212> PRT

<213>Artificial sequence

<400> 10

Ile Ser Thr Ser Gly Ser Asp Arg

1 5

<210> 11

<211> 7

<212> PRT

<213>Artificial sequence

<400> 11

Ala Arg Arg Gly Trp Asp Tyr

1 5

<210> 12

<211> 11

<212> PRT

<213>Artificial sequence

<400> 12

Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

1 5 10

<210> 13

<211> 3

<212> PRT

<213>Artificial sequence

<400> 13

Lys Val Phe

1

<210> 14

<211> 9

<212> PRT

<213>Artificial sequence

<400> 14

Phe Gln Gly Ser Arg Asp Pro Pro Thr

1 5

<210> 15

<211> 114

<212> PRT

<213>Artificial sequence

<400> 15

Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Thr Pro Glu Arg Arg Leu Glu Trp Val

35 40 45

Ala Thr Ile Ser Thr Ser Gly Ser Asp Arg Tyr Tyr Pro Asp Ser Val

50 55 60

Lys Trp Arg Phe Thr Ile Ser Arg Asp Ser Ala Lys Asn Ile Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys

85 90 95

Ala Arg Arg Gly Trp Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val

100 105 110

Ser Ser

<210> 16

<211> 112

<212> PRT

<213>Artificial sequence

<400> 16

Asp Val Leu Met Thr Gln Arg Pro Leu Ser Leu Pro Val Ser His Gly

1 5 10 15

Asp Gln Ala Ser Thr Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser

20 25 30

Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro Lys Leu Leu Ile Tyr Lys Val Phe Asn Arg Phe Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Gln Gly Val Tyr Tyr Cys Phe Gln Gly

85 90 95

Ser Arg Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 17

<211> 242

<212> PRT

<213>Artificial sequence

<400> 17

Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Thr Pro Glu Arg Arg Leu Glu Trp Val

35 40 45

Ala Thr Ile Ser Thr Ser Gly Ser Asp Arg Tyr Tyr Pro Asp Ser Val

50 55 60

Lys Trp Arg Phe Thr Ile Ser Arg Asp Ser Ala Lys Asn Ile Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys

85 90 95

Ala Arg Arg Gly Trp Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val

100 105 110

Ser Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu

130 135 140

Gly Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His

145 150 155 160

Ser Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Ser Gly Gln

165 170 175

Ser Pro Lys Leu Leu Leu Tyr Lys Val Ser Asn Arg Phe Ser Gly Val

180 185 190

Ser Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys

195 200 205

Ile Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln

210 215 220

Asn Thr His Val Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile

225 230 235 240

Lys Arg

<210> 18

<211> 242

<212> PRT

<213>Artificial sequence

<400> 18

Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Thr Pro Glu Arg Arg Leu Glu Trp Val

35 40 45

Ala Thr Ile Ser Thr Ser Gly Ser Asp Arg Tyr Tyr Pro Asp Ser Val

50 55 60

Lys Trp Arg Phe Thr Ile Ser Arg Asp Ser Ala Lys Asn Ile Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys

85 90 95

Ala Arg Arg Gly Trp Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val

100 105 110

Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Asp Val Leu Met Thr Gln Arg Pro Leu Ser Leu Pro Val Ser His

130 135 140

Gly Asp Gln Ala Ser Thr Ser Cys Arg Ser Ser Gln Ser Ile Val His

145 150 155 160

Ser Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln

165 170 175

Ser Pro Lys Leu Leu Ile Tyr Lys Val Phe Asn Arg Phe Ser Gly Val

180 185 190

Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys

195 200 205

Ile Ser Arg Val Glu Ala Glu Asp Gln Gly Val Tyr Tyr Cys Phe Gln

210 215 220

Gly Ser Arg Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile

225 230 235 240

Lys Arg

<210> 19

<211> 726

<212> DNA

<213>Artificial sequence

<400> 19

gaagttatgt tggttgaatc tggtggtggt ttggttaagc caggtggttc tttgaaattg 60

tcttgtgctg cttctggttt tactttctct tcttacgcta tgtcttgggt tagacaaact 120

ccagagagaa gattggaatg ggttgctact atttctactt ctggttctga tagatactat 180

cctgattctg ttaagtggag attcactatt tccagagatt ctgctaaaaa catcttgtac 240

ttgcaaatgt cttctttgag atctgaggat actgctatgt actattgtgc tagaagaggt 300

tgggattatt ggggtcaagg tacttctgtt actgtttctg ctggtggtgg tggttccgga 360

ggtggtggtt ctggtggtgg tggttctgat gttgttatga cccaaactcc attgtctttg 420

cctgtttctt tgggagatca agcttctatt tcttgtagat cttctcaatc tttggttcat 480

tctaacggta atacttactt gcactggtat ttgcaaaagt ctggtcaatc tcctaagttg 540

ttgttgtaca aagtttctaa cagattttct ggtgtttctg atagattctc tggttctggt 600

tctggtactg atttcacttt gaagatttcc agagttgagg ctgaagattt gggtgtttac 660

ttctgttctc aaaacactca tgttccacct actttcggtg gtggtactaa gttggaaatt 720

aaaaga 726

<210> 20

<211> 726

<212> DNA

<213>Artificial sequence

<400> 20

gaagttatgt tggttgaatc tggtggtggt ttggttaagc caggtggttc tttgaaattg 60

tcttgtgctg cttctggttt tactttctct tcttacgcta tgtcttgggt tagacaaact 120

ccagagagaa gattggaatg ggttgctact atttctactt ctggttctga tagatactat 180

cctgattctg ttaagtggag attcactatt tccagagatt ctgctaaaaa catcttgtac 240

ttgcaaatgt cttctttgag atctgaggat actgctatgt actattgtgc tagaagaggt 300

tgggattatt ggggtcaagg tacttctgtt actgtttctt ctggtggtgg tggatccgga 360

ggtggtggtt ctggtggtgg tggttctgat gttttgatga cccaaagacc attgtctttg 420

cctgtttctc atggagatca agcttctact tcttgtagat cttctcaatc tattgttcac 480

tctaacggta atacttactt ggagtggtat ttgcaaaagc caggtcaatc tcctaagttg 540

ttgatctaca aggtttttaa tagattctct ggtgttcctg atagattttc tggttctggt 600

tctggtactg atttcacttt gaagatttcc agagttgagg ctgaagatca aggtgtttac 660

tattgttttc aaggttccag agatccacct actttcggtg gtggtactaa gttggaaatt 720

aaaaga 726

<210> 21

<211> 29

<212> DNA

<213>Artificial primer

<400> 21

ctagccatgg aagttatgtt ggttgaatc 29

<210> 22

<211> 28

<212> DNA

<213>Artificial primer

<400> 22

ccgctcgagt tactagtgat ggtgatgg 28

Claims

1. Human C-reactiveprotein gold colloidal quantitative test card, including sample absorption pad, gold standard pad, reaction film and adsorptive pads；It is described Gold standard pad is coated with the antibody P02 or P20 of colloid gold particle labelling, has detection band and quality control band, detection band on the reaction film Position is coated with antibody P20 or P02；

The antibody P20, its weight chain variable district contain following complementary determining region：Aminoacid sequence such as sequence SEQ ID NO：1 Shown HCDR1, such as sequence SEQ ID NO：HCDR2 and/or such as sequence SEQ ID NO shown in 2：HCDR3 shown in 3；Its Light-chain variable sequence contains following complementary determining region：Aminoacid sequence such as sequence SEQ ID NO：LCDR1 shown in 4, such as Sequence SEQ ID NO：LCDR2 and/or such as sequence SEQ ID NO shown in 5：LCDR3 shown in 6；

The antibody P02, its weight chain variable district contain following complementary determining region：Aminoacid sequence such as sequence SEQ ID NO：9 Shown HCDR1, such as sequence SEQ ID NO：HCDR2 and/or such as sequence SEQ ID NO shown in 10：HCDR3 shown in 11； Its light-chain variable sequence contains following complementary determining region：Aminoacid sequence such as sequence SEQ ID NO：LCDR1 shown in 12, Such as sequence SEQ ID NO：LCDR2 and/or such as sequence SEQ ID NO shown in 13：LCDR3 shown in 14.

2. the Human C-reactiveprotein gold colloidal quantitative test card described in claim 1, is characterized in that the weight chain variable district of antibody P20 Aminoacid sequence such as SEQ ID NO:Shown in 7, the aminoacid sequence such as SEQ ID NO of light chain variable district:Shown in 8.

3. the Human C-reactiveprotein gold colloidal quantitative test card described in claim 1, is characterized in that the weight chain variable district of antibody P02 Aminoacid sequence such as SEQ ID NO:Shown in 15, the aminoacid sequence such as SEQ ID NO of light chain variable district:Shown in 16.

4. the Human C-reactiveprotein gold colloidal quantitative test card described in claim 1, is characterized in that antibody P20 is single-chain antibody, Its aminoacid sequence such as SEQ ID NO:Shown in 17.

5. the Human C-reactiveprotein gold colloidal quantitative test card described in claim 1, is characterized in that antibody P02 is single-chain antibody, Its aminoacid sequence such as SEQ ID NO:Shown in 18.

6. the Human C-reactiveprotein gold colloidal quantitative testing test paper card according to any one of claim 1-5, it is characterised in that： Prepare the borate buffer that confining liquid used is that 1～10%BSA is dissolved in 0.01M, pH7.4 ± 0.1.

7. the Human C-reactiveprotein gold colloidal quantitative testing test paper card according to any one of claim 1-5, it is characterised in that： It is that 1%BSA, 10% trehalose and 0.025% tween 20 are dissolved in the borate buffer of 0.01M that antibody redissolves liquid, pH7.4 ± 0.1。

8. the Human C-reactiveprotein gold colloidal quantitative testing test paper card according to any one of claim 1-5, it is characterised in that： Antibody coating buffer is the borate buffer that 1～3% methanol or isopropanol are dissolved in 0.01M, pH7.4 ± 0.1.

9. the Human C-reactiveprotein gold colloidal quantitative testing test paper card according to any one of claim 1-5, it is characterised in that： Sample dilution is that 0～2.5% BSA, 0.1～0.3% Proclin300 are dissolved in the borate buffer of 0.01M, pH7.4 ± 0.1。