CN106591364A

CN106591364A - Method for obtaining transgenic bovine fetal fibroblast by use of single Cas9 nickase for mediation of fixed point insertion of NRAMP1

Info

Publication number: CN106591364A
Application number: CN201611001075.7A
Authority: CN
Inventors: 张涌; 高元鹏; 陈琳琳; 刘鑫; 吴海波; 袁梦珂
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2016-11-14
Filing date: 2016-11-14
Publication date: 2017-04-26
Anticipated expiration: 2036-11-14
Also published as: CN106591364B

Abstract

The invention discloses a method for obtaining a transgenic bovine fetal fibroblast by use of single Cas9 nickase for mediation of fixed point insertion of NRAMP1, according to the method, an electroporation method is used for co-transfecting a bovine fetal fibroblast with a donor vector and a single CRISPR /Cas9 nickase expression vector aiming at a targeting site, a NRAMP1 gene self promoter in the donor vector enables specific expression of the NRAMP1 in a professional phagocyte, and after puromycin drug screening, a targeting positive clone cell can be obtained by PCR and Southern Blotting identification. A transgenic cloned embryo can be obtained from the transgenic positive clone cell as a nuclear donor, and a survival NRAMP1-fixed-point-inserted transgenic cloned cow can be finally obtained by further transplantation of the transgenic cloned embryo into a uterus of a rutting receptor cow.

Description

Transgenic cow fetus is obtained using the mediation NRAMP1 fixed point insertions of single Cas9 nickases Fibroblastic method

Technical field

The invention belongs to technology of gene conversion and animal clone field, is related to the structure of the nuclear donor cell of transgene clone cattle, It is more particularly to a kind of to mediate the bovine fetal fibroblast that the gene site-directed insertions of NRAMP1 obtain target practice thin using single Cas9 nickases The method of born of the same parents.

Background technology

Tuberculosis be it is a kind of by Mycobacterium tuberculosiss (Mycobacterium tuberculosis, MTB) people and cattle it Between propagate the worldwide zoonosiss for causing, Animal husbandry production safety, livestock product safety or even human health are caused sternly Threaten again.

NRAMP1 (natural resistance-associated macrophage protein-1) also known as SLC11A1 (solute carrier family 11A member 1), is the first related to tubercule bacillus susceptibility of researcher discovery Gene (Vidal S et al, 1995).When tubercule bacillus invade macrophage, NRAMP1 is by participating in innate immunity process (Hedges JF, 2013) so as to suppress tubercule bacillus in the propagation of intracellular, are produced anti-to promote NO to produce with other proinflammatories Sick effect.

2 months 2013, internationally famous periodical《Cell》The research worker for reporting University of California-San Francisco is found A kind of accurate silent gene method, referred to as CRISPR/Cas9 mediation Knockout technology.The Technological expression goes out many superior Property, for example can simultaneously any number of gene of silence, with excellent targeting, build that simple and cost is low.The technology Since invention, in being applied to human cell and mice isotype zooscopy by vast China and foreign countries' research worker rapidly, become The new focus of current Life Sci-Tech research.

Realize that the breed improvement of domestic animal has huge application potential using transgenic technology.Strengthened by transgenic technology Domestic animal for the resistance of tubercule bacillus, for the prevention and treatment of following bovine tuberculosis are significant.However, at present The application that the gene of CRISPR/Cas9 technologies mediation is inserted in breeding transgenic livestock is very limited.Additionally, how to ensure external source While gene insertion efficiency, weaken the changeable effect of missing the target of the system still urgently to be resolved hurrily so far.

The content of the invention

It is an object of the invention to provide a kind of turn base using the mediation NRAMP1 fixed point insertion acquisitions of single Cas9 nickases Because of the method for bovine fetal fibroblast, can be using single Cas9 nickases and the specific expressed target practice of NRAMP1 macrophages Carrier obtains NRAMP1 genes in No. 25 chromosome F-A sites of cattle (i.e. specific sequence in cattle FSCN1 genes and ACTB intergenic regions Column-slice section) site-directed integration bovine fetal fibroblast, be to develop antituberculotic to turn base using the cell as nuclear donor cell Because cattle provides solid foundation.

To reach above-mentioned purpose, technical scheme below is present invention employs：

A kind of specific expressed targeting vector (abbreviation pNRAMP1-eGFP-P2A-Puro) of NRAMP1 macrophages, this dozen Targeting vector includes genes of interest NRAMP1 and for NRAMP1 genes to be inserted into No. 25 chromosomes of cattle by homologous recombination fixed point The intergenic element sequences of FSCN1 and ACTB.

The element sequences include that homology arm is with cow genome group as mould for the homology arm sequence of site homologous recombination of practicing shooting Plate is expanded, and amplified production is respectively the upstream 577-977bp and downstream 616-1016bp in target practice site on No. 25 chromosomes of cattle；Beat Target site is located in the sequence between No. 25 chromosome FSCN1 and ACTB genes of cattle as shown in SEQ.ID.NO.1.

The genes of interest NRAMP1 is that the NRAMP1 genes its own promoter expanded by external source starts transcription.

The element sequences also include selection markers eGFP gene and PURO genes, the two riddled basins all by EF1 α promoteres start transcription, and are expressed by self cleavage peptide P2A sequences fused in tandem.

The element sequences also include being located at two LoxP sequences in the same direction of two riddled basins both sides.

A kind of construction method of the bovine fetal fibroblast of insertion genes of interest NRAMP1, comprises the following steps：With cattle Fetal fibroblast is host cell, by cotransfection targeting vector pNRAMP1-eGFP-P2A-Puro and for target practice position The single CRISPR/Cas9 nickases expression vector of point, by genes of interest NRAMP1 site-directed integrations to bovine fetal fibroblast No. 25 chromosome FSCN1 and ACTB genes between.

The host cell is the holstein cow fetal fibroblast for passing on for 2～3 generations, to take into account cell quantity and work Property.

The cotransfection operation adopts electroporation.

The single CRISPR/Cas9 nickases expression vector includes the go-ahead sequence corresponding with target practice site, beats Target site is located in the sequence between No. 25 chromosome FSCN1 and ACTB genes of cattle as shown in SEQ.ID.NO.1.

The bovine fetal fibroblast of the insertion genes of interest NRAMP1 can be moved as the core of production transgene clone cattle Plant operation donorcellses to use.

Compared with prior art, the present invention has following beneficial technique effect：

1. the present invention constructs a kind of specific expressed targeting vector pNRAMP1-eGFP-P2A- of NRAMP1 macrophages Puro, and NRAMP1 Gene targetings are made to No. 25 chromosome F-A sites of cattle by gene targeting.The location proximate base Because cluster is housekeeping gene, it is in enlivening expression status in different tissues.NRAMP1 is inserted into the region, can avoid its because Heterochromatinization is modified and loss of activity.

2. the present invention constructs a kind of specific expressed targeting vector pNRAMP1-eGFP-P2A- of NRAMP1 macrophages Puro, can mediate it to be incorporated into F-A sites by single CRISPR/Cas9 nickases.Single CRISPR/Cas9 nickases can Nonhomologous end recombination repair (NHEJ) introduces extra mutation (indels) in genome range during to reduce target practice, So as to reduce cytotoxicity, the safety of transgenic animal is improved.

3. the present invention constructs a kind of specific expressed targeting vector pNRAMP1-eGFP-P2A- of NRAMP1 macrophages Puro, its genes of interest NRAMP1 start transcription by the gene its own promoter that external source is expanded.So that genes of interest NRAMP1 and normal transcription and expression only in technical phagocyte, improve transgenic animal production safety.

4. the present invention constructs a kind of specific expressed targeting vector pNRAMP1-eGFP-P2A- of NRAMP1 macrophages Puro, includes riddled basins PURO in the targeting vector, facilitate drug screening to obtain positive colony cell；Include sieve Select marker gene eGFP, the convenient insertion that exogenous gene is directly determined under fluorescence microscope.Simultaneously selection markers both sides is same The selection markers in positive colony cell can be removed to LoxP with cre enzyme collective effects.

5. the present invention obtain insertion genes of interest NRAMP1 bovine fetal fibroblast, Jing PCR and Southern Blotting is identified, it was demonstrated that genes of interest is site-directed integration to bovine fetal fibroblast genome F-A sites.

6., to insert the bovine fetal fibroblast of genes of interest NRAMP1 as nuclear transfer donor cell, can pass through SCNT obtains transgene clone cattle, is to obtain the new varieties transgenic cow for having tuberculosis higher resistance to lay solid base Plinth.

Description of the drawings

Fig. 1 is the schematic diagram that the corresponding go-ahead sequence in site of practicing shooting is cloned into Cas9 expression vectors.

Fig. 2 is the collection of illustrative plates of Cas9 carrier for expression of eukaryon.

Fig. 3 is using detection figures of the Surveyor nuclease assay to Cas9 cleavage activities.

Fig. 4 is the collection of illustrative plates of targeting vector pNRAMP1-eGFP-P2A-Puro.

Fig. 5 is original cuiture (A) and the bovine fetal fibroblast for gene targeting in Secondary Culture (B).

Fig. 6 is to transfect the monoclonal cell figure that the bovine fetal fibroblast Jing puromycins of targeting vector are screened.

Fig. 7 is positive monoclonal cellular identification schematic diagram.

Fig. 8 is the junction PCR qualification result figures for choosing some representative monoclonal cells.

Fig. 9 is to be verified as there occurs that 14 monoclonal cells of NRAMP1 Gene targetings are carried out to Jing PCR The result figure of Southern blotting checkings.

Figure 10 is the transgenic cloned embryos prepared using the positive colony cell of gene targeting.

Figure 11 is the transgene clone cattle prepared using the positive colony cell of gene targeting.

Specific embodiment

The present invention is described in further details with reference to the accompanying drawings and examples.Described is explanation of the invention, and It is not to limit.

The present invention constructs first the specific expressed targeting vector pNRAMP1- of the macrophage containing NRAMP1 genes EGFP-P2A-Puro, then by the method for electroporation by targeting vector pNRAMP1-eGFP-P2A-Puro and for target practice position The single CRISPR/Cas9 nickases expression vector cotransfection bovine fetal fibroblast of point, after puromycin drug screening, Jing Cross PCR and Southern Blotting identifications and obtain the positive colony cell practiced shooting.Positive colony cell with the target practice is as core Donor is moved in cattle enucleation oocyte, obtains transgenic cloned embryos.Send out finally by transgenic cloned embryos are transplanted to The recipient cattle intrauterine of feelings, obtains transgene clone cattle.

Concrete involved reagent and material are as follows：Hyclone, puromycin, DMEM, DMEM/F12, Opti-MEM training Foster base is purchased from Invitrogen companies of the U.S., and EDTA and Trypsin is purchased from Sigma Co., USA, Tissue Culture Plate and culture dish Purchased from Corning companies of the U.S., plasmid extraction kit and cellular genome extracts kit are purchased from Omega companies of the U.S.,Mutation Detection test kits be purchased from Transgenomic companies, PrimeSTAR archaeal dna polymerases and Solution I DNA ligases are purchased from Takara companies, and transfection reagent HD DNA Transfection Reagent are purchased from FuGENE companies, electrotransfection instrument (ECM2001) is purchased from BTX companies of the U.S., and restricted enzyme is purchased from NEB companies, and competence is thin Born of the same parents DH5 α and JM110 are purchased from Shanghai TIANGEN companies.

1st, the structure of CRISPR/Cas9 carrier for expression of eukaryon

Design and vector construction in 1.1 target practice sites

Select FSCN1 (fascin actin-bundling protein 1, FSCN1) on cow genome No. 25 chromosomes of group Gene and ACTB (beta-actin, ACTB) intergenic region design target practice site (below or also referred to as F-A target practices site), entirely A length of 560bp, sequence is following (referring to SEQ.ID.NO.1, be from left to right 5` ends)：

Bos Taurus chromosome 25Btau_4.6.1Chr25.position 40,631,870-40,632, 429

By the online screening implement ZiFiT (http in above-mentioned sequence inputting target practice site://zifit.partners.org/ ZiFiT/), will subsequently amount to 80 potential target practice sites and fully enter target practice site online evaluation instrument Cas-OFFinder (http://www.rgenome.net/cas-offinder/) in, export preliminary the selection result.The present invention is from whole 80 Optimal 14 sites are picked out in individual potential target practice site carries out follow-up CRISPR/Cas9 construction of eukaryotic expression vector works Make and further cutting efficiency detection.

As shown in figure 1, the unitary expression vector selected by the present invention is both comprising the complete unit needed for hspCas9 protein expressions Part sequence, also comprising the hU6 promoteres needed for stable transcription sgRNA.The carrier is at restricted enzyme Bbs I enzyme action After reason, the joint design being cloned into the corresponding go-ahead sequence in site of practicing shooting needed for the carrier can be formed.Synthesize using described in table 1 Oligonucleotide sequences, CRISPR/Cas9 construction of eukaryotic expression vector is capable of achieving with coupled reaction by simple annealing.

SgRNA cloning primer sequences (5'-3') of table 1.

The sequence of underscore portion identification is each target practice site correspondence go-ahead sequence in table 1

Above-mentioned nucleotide sequence is delivered to into the synthesis of Shanghai Sheng Gong biotech firms, following reaction system is built：2μL Top Guide oligo(100μM)；2μL Bottom Guide oligo(100μM)；Plus 16 μ L ddH₂The μ L cumulative volumes of O to 20.Mix and short Temporarily after centrifugation, the following program that carries out is placed in PCR instrument：37 DEG C 5 minutes；95 DEG C 10 minutes；Afterwards 5 DEG C of gradient cooling per minute is straight To 4 DEG C.After completing annealing, taking-up sample is placed in stand-by on ice.

Build Cas9 expression vector plasmid enzyme restriction reaction systems as follows：10 μ L pSpCas9 (BB) -2A-GFP (2 μ g, Addgene, referring to Fig. 2)；2μL 10×NEBuffer 2.1；1μL Bbs I；Plus 7 μ L ddH₂The μ L cumulative volumes of O to 20.Mix And after of short duration centrifugation, 37 DEG C of water-baths are overnight.Reclaim carrier after enzyme action, and with above-mentioned annealing after sample build following linked system：1 Double-strand oligo after μ L annealing；2μL pSpCas9(BB)-2A-GFP；5μL 2×Solution I；Plus 2 μ L ddH₂The μ L of O to 10 Cumulative volume.Mix and 16 DEG C of water-baths connect 1h after of short duration centrifugation.Connection product (target site on position be located at hU6 promoteres with Between sgRNA joint sequence scaffold) it is transformed in competent cell DH5 α by standardization program, coat solid LB media (100mg/mL ampicillin) upper 37 DEG C of overnight incubations.Hua Da science and technology sequencing is sent to after the several monoclonal amplification culture of picking, Choose positive colony preservation strain standby.

1.2 cleavage activities are detected

When bovine fetal fibroblast cell (BFFs) is cultivated to degree of converging about 60% in 60mm culture dishs, take respectively each The μ g of group Cas9 expression vectors plasmid 10；The μ L of FuGENE HD transfection reagents 20；Opti-MEM is added to the μ L of cumulative volume 250.It is fully mixed Even rear room temperature stationary incubation 15min, transfection mixture is added in each correspondence culture dish, is put back in incubator after soft mixing Continue to cultivate.After transfection 72h, collect cell and extract genome and carry out using Omega companies full-length genome extracts kit Follow-up Surveyor mismatch DNAs enzyme detection.To specifications acceptance of the bid quasi-ordering is carried out for operation, wherein PCR amplification target practices region (1037bp) the primer sequence is as follows, 60 DEG C of annealing temperature：

Surveyor-detect-F 5′-GACTCCTGTAACCTCTGTCCCTG-3′(SEQ.ID.NO.30)

Surveyor-detect-R 5′-TCAGCAGTTGCGGTTCG-3′(SEQ.ID.NO.31)

Nucleic acid electrophoresis result is through software image-J (http://imagej.net) gray scale assessment, calculate cutting effect Rate f_cutTwo band gray scale sums/band gray scale summation of swimming lane three after=enzyme action.In order to preferably reflect Cas9 albumen at this The actual target practice effect in site, it is actual mutation rate further to be converted cutting efficiency by following algorithm Testing result is shown in Fig. 3.

As a result show, in No. 45 target practice site Cas9 nucleic acid enzyme cleavage activity highests.For identical target practice site, Cas9 nickases have partial loss compared to Cas9 nucleic acid enzyme cleavage activities, but the former is being repaired outside approach mediation by HDR The probability for introducing mutation (indels) in the gene targeting insertion process of source in the range of full-length genome is much smaller.Therefore 45 are selected Number target practice site and single Cas9 nickases carry out follow-up NRAMP1 loading tests, to take into account the high efficiency and essence of gene targeting Parasexuality, improves the probability of success of transgenic animal production.

Below as do not done explanation in addition, single Cas9 otch nuclease expression vectors are with sequence corresponding to numbering 45 in table 1 The leukorrhagia dashed part of row is used as go-ahead sequence.

2nd, the structure of NRAMP1 macrophages specificity targeting vector pNRAMP1-eGFP-P2A-Puro

The clone of 2.1 genes of interest NRAMP1

According to cattle NRAMP1 sequences (the Gene ID that NCBI is announced:282470) primer amplifying target genes ORF is designed, and Each element is connected by the restriction enzyme site in the primer in follow-up carrier.Primer sequence is：

NRAMP1-19T-F：5'-ATTTGCGGCCGCGAATTCGTCGACGTGGGGTACC CATGTCAGGTGACACGGGC-3'(SEQ.ID.NO.32)

NRAMP1-19T-R：5'–AAGCTTCCATGGATCGATGGGACTAGTACGCGTC GCGGATCCTCATCCCGAGGTCCTCCCCTT-3'(SEQ.ID.NO.33)

Reaction system is as follows：10μL 5×PS Buffer；4μL dNTPs(2.5mmol/L)；1μL NRAMP1-19T-F (10μM)；1μL NRAMP1-19T-R(10μM)；3 μ L milch cow cDNA (100ng/ μ L)；0.5 μ L PrimerStar DNA are polymerized Enzyme (2.5U/ μ L)；Plus distilled water is to 50 μ L cumulative volumes.Response procedures are set according to product description standard three-step approach, wherein moving back Fiery temperature is 60 DEG C, extension of time 90s.Reclaim PCR purpose fragments and after its end adds A to process, the standard T-A clone of structure connects Junctor system is recombinated to pMD19T simple cloning vehicles (Takara), in being transformed into commercialization DH5 α escherichia coli, and is chosen Extra large Hua Da gene sequencing is served after peek monoclonal amplification culture.Correct carrier is sequenced and is temporarily named as pNRAMP1-19T.

The clone of 2.2 NRAMP1 promoteres

According to the cattle NRAMP1 promoter sequence (GenBank that NCBI is announced:AY438096.1 primer sequence) is designed as follows：

Promoter-19T-F：5'-CGCGTCGACCATCACAGCCTCCTACC-3'(SEQ.ID.NO.34)

Promoter-19T-R：5'-TTAAGGTACCGGGTGCTTCCTCTCTAGGC-3'(SEQ.ID.NO.35)

Reaction system is as follows：10μL 5×PS Buffer；4μL dNTPs(2.5mmol/L)；1μL Promoter-19T- F(10μM)；1μL Promoter-19T-R(10μM)；1 μ L milch cow genomes (200ng/ μ L)；0.5μL PrimerStar DNA Polymerase (2.5U/ μ L)；Plus distilled water is to 50 μ L cumulative volumes.According to product description standard three-step approach, response procedures are set, its Middle annealing temperature is 55 DEG C, extension of time 90s.Reclaim PCR purpose fragments and after its end adds A to process, build standard T-A gram Grand linked system is recombinated to pMD19T cloning vehicles (Takara), in being transformed into commercialization DH5 α escherichia coli, and picking Extra large Hua Da gene sequencing is served after several monoclonal amplification culture.

Correct positive recombinant will be sequenced carries out respectively the process of SalI and KpnI double digestions with pNRAMP1-19T carriers, Above-mentioned promoter sequence is connected on pNRAMP1-19T carriers by Solution I.Positive recombinant vector is temporarily named as pPromoter-NRAMP1-19T。

The clone of 2.3 homology arm sequences

It is homologous as left side that design primer expands respectively F-A target practices site upstream sequence (777bp) on No. 25 chromosomes of cattle Arm (Left arm, LA) and downstream sequence (816bp) are used as right side homology arm (Right arm, RA), and primer sequence is as follows：

LA-19T-F：5'-GCGGCCGCGTCTGACCCGTGAGTGTT-3'(SEQ.ID.NO.36)

LA-19T-R：5'-GTCGACGCGGCTAGTTTGGGAGTG-3'(SEQ.ID.NO.37)

RA-19T-F：5'-ATCGATACACCCTTTCTAGTGGTCC-3'(SEQ.ID.NO.38)

RA-19T-R：5'-AAGCTTTCCCGCTGATTGTTCTTC-3'(SEQ.ID.NO.39)

Reaction system is as follows：10μL 5×PS Buffer；4μL dNTPs(2.5mmol/L)；1μL primer F(10μ M)；1μL primer R(10μM)；1 μ L milch cow genomes (200ng/ μ L)；0.5 μ L PrimerStar archaeal dna polymerases (2.5U/μL)；Plus distilled water is to 50 μ L cumulative volumes.Response procedures are set according to product description standard three-step approach, wherein annealing Temperature is 58 DEG C, extension of time 50s.Reclaim PCR purpose fragments and after its end adds A to process, build the clone's connection of standard T-A System is recombinated to pMD19T cloning vehicles, and in being transformed into commercialization JM110 escherichia coli, and the several monoclonals of picking expand Extra large Hua Da gene sequencing is served after culture, sequencing is correctly LA positive recombinants and RA positive recombinants.

LA positive recombinants and pPromoter-NRAMP1-19T carriers are carried out respectively into NotI and SalI double digestions to process, Left side homology arm is connected on the latter's skeleton carrier by Solution I.Connection product is transformed into into JM110 competence thin In born of the same parents.NotI and SalI double digestions are identified after positive recombinant, extract plasmid, then respectively enter it with RA positive recombinants The process of row ClaI and HindIII double digestion, is connected to right side homology arm on the former skeleton carrier by Solution I.By sun Property recombinant vector is temporarily named as pLA-Promoter-NRAMP1-RA-19T.

The structure of the specific expressed targeting vector pNRAMP1-eGFP-P2A-Puro of 2.4 macrophages

PLA-Promoter-NRAMP1-RA-19T carriers and pEGFP-C1 carriers (Clontech) are carried out into respectively BamHI With the process of MluI double digestions, the former linearisation skeleton carrier is separately recovered with purpose piece of the latter comprising SV40polyA sequences Section, is attached by Solution I.Positive recombinant vector is temporarily named as pLA-Promoter-NRAMP1-polyA-RA- 19T。

(the DOI with the existing carrier of this laboratory as template:10.13345/j.cjb.130529), expand selection markers LoxP- EF1α-EGFP-P2A-Puro-LoxP.Primer sequence is as follows：

EEPP-19T-F：5'-GAGCACTAGTATAACTTCGTATAGCATACATTATACGAAG TTATTGCGTTATCCCCTGATTCTGT-3'(SEQ.ID.NO.40)

EEPP-19T-R：5'-TACCATCGATGGAACTTCGTATAATGTATGCTATACGAAG TTATCGCTTACAATTTACGCCTTAAG-3'(SEQ.ID.NO.41)

Reaction system is as follows：10μL 5×PS Buffer；4μL dNTPs(2.5mmol/L)；1μL EEPP-19T-F(10 μM)；EEPP-19T-R(10μM)；1 μ L plasmid templates (200ng/ μ L)；0.5 μ L PrimerStar archaeal dna polymerases (2.5U/ μ L)；Plus distilled water is to 50 μ L cumulative volumes.Response procedures are set according to product description standard three-step approach, wherein annealing temperature is 62 DEG C, extension of time 3min.

PCR primer and pLA-Promoter-NRAMP1-polyA-RA-19T carriers are carried out into respectively the double enzymes of SpeI and ClaI Process is cut, after Solution I connect, positive recombinant vector is preserved after sequencing, that is, complete that macrophage is specific expressed to be beaten The structure of targeting vector pNRAMP1-eGFP-P2A-Puro, as shown in Figure 4 (i.e. donor vehicle Cas9Donor Vector).In Fig. 4 Shown carrier includes the following element being sequentially arranged：LA, NRAMP1 promoter, NRAMP1 open reading frame, SV40polyA, on Trip LoxP sites, EF1 α promoteres, fluorescent reporter gene EGFP open reading frame, P2A sequences, resistant gene PURO (anti-purine Mycin) open reading frame, SV40polyA, downstream LoxP sites and RA.3rd, the specific expressed targeting vector of macrophage PNRAMP1-eGFP-P2A-Puro and the single Cas9 otch nuclease expression vectors cotransfection bovine fetal fibroblast of specificity Build nuclear donor cell.

3.1 bovine fetal fibroblast cultures

Bovine fetal fibroblast used is tissue block adherent method gained in the present invention.By the cattle fetus (Yang Ling of collection Clone limited company of unit of section, 06 month 2013) clean more than three times with the PBS containing mycillin to avoid carefully Bacterium pollutes.Cattle fetal skin tissue is peeled off with eye scissorss and tweezers on aseptic working platform, and is shredded for about 1mm³Group Knit block.Careful uniformly attaches piece of tissue in diameter 60mm culture dishs, and a small amount of DMEM culture fluid moistening of soft Deca.Will training Foster ware is inverted CO²37 DEG C in incubator, 5%CO²After incubation 4h, the DMEM cultures for adding 5mL to contain mycillin and 10%FBS Liquid is just putting culture.There is fibroblast to move out around visible tissue block after about 3-4 days, continue culture to cell confluency degree and be more than Remnant tissue's block is discarded after 90%, freeze-stored cell or Secondary Culture now may be selected, as shown in Figure 5A.

Secondary Culture with it is frozen：Cell culture fluid is discarded, adds 3mL PBS to abandon liquid after softly washing, add 1mL to contain The PBS peptic cells of 0.25% pancreatin, add DMEM culture fluid to terminate digestion after 37 DEG C of incubation 3min.Soft piping and druming is peeled off adherent Cell forms cell suspension, selects to add DMEM culture fluid re-suspended cells after centrifugation supernatant discarded, according to 1:3～1:5 ratio Secondary Culture, as shown in Figure 5 B；Or select to add the cells frozen storing liquid containing 10%DMSO, thorough re-suspended cell simultaneously to proceed to cryopreservation tube And it is in program freezing storing box and frozen in final transposition liquid nitrogen.Cell recovery：Cryopreservation tube is taken out from liquid nitrogen, 37 DEG C of water-baths are fast Speed is thawed.Frozen stock solution is discarded after low-speed centrifugal, DMEM culture fluid thorough re-suspended cells of the 1mL containing 10%FBS is added.It is right to be forwarded to In answering specification culture dish, 37 DEG C are placed in, 5%CO₂Cultivate in incubator.

The screening of 3.2 positive cell clones

The present invention uses electroporation by targeting vector pNRAMP1-eGFP-P2A-Puro and the single Cas9 otch of specificity Nuclease expression vectors cotransfection enters bovine fetal fibroblast.Electricity turns formula of liquid for KCl：120mM；CaCl₂：0.15mM； K₂HPO₄:10mM；MgCl₂:2.50mM.PH value is adjusted to after 7.6, with Opti-MEM culture fluid according to volume ratio 3:1 mixes.To The each 20 μ g of above two vector plasmid are added in 500 μ L mixed liquors, in being transferred to the cell mass that centrifugation discards culture fluid, gently Piping and druming re-suspended cell is simultaneously mixed.Above-mentioned cell suspension is transferred in new BTX electricity revolving cups and stands 5min, adjust electroporation voltage For 510V, pulse 1ms to shock by electricity and stand 10min after 3 times.Cell suspension is transferred in 90mm culture dishs, in 37 °, 5% CO₂ Continue to cultivate in incubator.

After transfection 24h, the puromycin of final concentration of 2 μ g/mL is added in cell culture fluid carries out drug screening.Screening After 8d, the complete cell death of targeting vector is not integrated in genome, and the cell of stable integration targeting vector gradually forms list Clone cell group, and the visible green luciferase expression under fluorescence microscope.Monoclonal cell is shown in Fig. 6.Picking monoclonal cell is extremely 48 orifice plates continue to cultivate and proceed follow-up positive clone identification.

3.3 PCR identify the positive cell clone of gene targeting

Take the monoclonal cell of partial enlargement culture, centrifugation abandon after supernatant add 20 μ L lysates (10mM Tris-HCl, pH 8.5；50mM KCl；1.5mM MgCl₂；0.5%NP-40；0.5%Tween-20；400g/mL proteinase K), fill Resuspended rear 65 DEG C of water-bath 30min, 95 DEG C of water-bath 15min are divided to complete cell lysis.5 μ L cell lysates are taken as template, difference Positive clone identification is carried out using following junctionPCR primers.

5'-junction：Lj F(5'-AGTTGTGCCCTCCGTGTA-3'),SEQ.ID.NO.42；

Lj R(5'-CTGCCATGCCCACTCAT-3'),SEQ.ID.NO.43；

3'-junction,Rj F(5'-GCGCATGGCCGAGTTGA-3'),SEQ.ID.NO.44；

Rj R(5'-CCCGCATTGCTCCCTCT-3'),SEQ.ID.NO.45。

Wherein, 5'-junction forward primer matching sequence be 5' ends homology arm upstream gene group sequence, downstream primer It is NRAMP1 gene promoter sequences on targeting vector, primer size 1578bp with sequence；3'-junction forward primer is matched Sequence be targeting vector on puro gene orders, downstream primer matching sequence be 3' ends homology arm downstream genomic sequence, product Size should be 1978bp, as shown in Figure 7.The positive colony identified by 5'-junction PCR reactions further passes through 3'- Junction PCR are identified.Only follow-up reality just can be carried out after amplification culture by the clone of two-wheeled PCR identifications Test.Typically see Fig. 8 using junction PCR qualification processes.

3.4 Southern blotting identify the cell clone of gene targeting

Part cell extraction genomic DNA will be taken after the above-mentioned positive colony cell expansion culture for identifying, used HindIII is carried out after sufficient endonuclease reaction, respectively with the targeting 5' ends homology arm upstream gene group sequence of digoxigenin labeled The probe (probe 2) of puro gene orders is hybridized on probe (probe 1) and targeting targeting vector.Probe sequence is distinguished Enter performing PCR amplification by following primer to obtain, digoxigenin labeled process passes through DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche) test kits are completed.

Probe 1,p1F(5'-CCAGTTCTTTGATGGGTGT-3'),SEQ.ID.NO.46；

p1R(5'-GGCTTGACAGAAGGGTATG-3'),SEQ.ID.NO.47；

Probe 2,p2F(5'-AGCAAGCAGGAGACGTGGAA-3'),SEQ.ID.NO.48；

p2R(5'-CGCTCGTAGAAGGGGAGGTT-3'),SEQ.ID.NO.49。

As shown in figure 9, F-A target practices site occurs the positive colony of accurate gene insertion can hybridize the band of 1.58kb (probe1) and 9.05kb band (probe2).And when using probe 1, it is miscellaneous that the band of 3.84kb indicates the clone Close, still remain the normal chromosomal of a wild type.Statistics shows, carries out NRAMP1 using said method and practice shooting what is inserted Positive rate is 18.11%, and the ratio is sufficiently high for transgenic animal production.

4th, with above-mentioned genome site-directed integration the bovine fetal fibroblast of genes of interest NRAMP1 as nuclear donor cell, Build transgene clone cattle

The maturation culture of 4.1 oocytes

Ovary used of the invention is under aseptic condition and picks up from Xi'an slaughterhouse (in October, 2014-January), in 37 DEG C of nothings Transport to laboratory in bacterium normal saline.Extract the follicle of 3～8mm diameters and collect cumulus oocyte complex, stereoscopic Suitable oocyte is selected under microscope for maturation culture.Maturation culture solution is the epidermis for adding 10%FBS and 10ng/mL The TCM199 (Gibico) of somatomedin.At 38.5 degrees Celsius, 5%CO₂Under the conditions of cultivate 20h after, with 0.2% hyaluronic acid Enzyme removes cumulus cell, and selects the oocyte of maturation for nuclear transfer experiments.

The structure of 4.2 transgene clone embryos

The present invention takes and donorcellses is transferred to into the nuclear maturation of removal using body-cell neucleus transplanting (SCNT) technology In oocyte.Internal diameter is used as micrurgy liquid with the PBS containing 10%FBS, 5 μ g/mL cytochalasin Bs during nuclear transplantation 20 μm of enucleation pipe suctions out first polar body and part kytoplasm on micrurgy instrument.Dyeed with 10 μ g/mL Hoechst 33342 After 10min, complete non-nucleus egg mother cell is chosen under fluorescence microscope；The ovum for removing first polar body and chromosome completely is female thin Born of the same parents are used for nuclear transplantation.

The positive transgenic Holstein cow fetus that NRAMP1 after to grow to contact inhibition state 3d is precisely inserted is into fibre Dimension cell is donor cell.With enucleation pipe by under the successful oocyte zona pellucida of donorcellses injection enucleation.Using electro' asion Liquid by caryoplasm complex balance 3min, be connected with micrurgy instrument microelectrode tip arrangement recombinant, make film contact surface and The line of two electrodes is vertical, and gives 28V, 10 μm of electric pulses and carry out electro' asion.Recombinant after fusion is placed in containing 10% In the M199 of FBS, 38.5 DEG C, 5%CO2 culture 2h after observe fusion situation.

The activation of 4.3 transgene clone embryos and In vitro culture

After the reconstituted embryo of fusion balances 2h in the M199 containing 10%FBS, (SIGMA is purchased from containing 5 μm of ol/L ionomycins Company) mSOFaa culture fluid (be purchased from SIGMA companies) process 5min, then in the (6- of dimethylaminopurine containing 2mmol/L DMAP culture 4h in mSOFaa culture fluid), proceeds to mineral oil and covers and in advance in CO after cleaning 3 times₂Balance in incubator to Cultivate in the mSOFaa of few 2h, culture density is 5 μ L each reconstituted embryo, in 38.5 DEG C, 5%CO₂, cultivate under saturated humidity, Check blastaea developmental state within 7th day.The transgene clone embryo of normal development to blastaea is as shown in Figure 10.

The preparation of 4.4 transgene clone cattle

Well-developed blastaea is transplanted to cornua uteri (every 2-3 piece of recipient cattle transplanting of the He Sitan recipient cattles of heat Blastaea).After 60 days, pregnant inspection is done to the recipient cattle that feelings are not returned after transplanting with B ultrasonic.Hereafter monthly check once, observation gestation Maintenance situation.After 10 months, the transgene clone cattle (Figure 11) of the gene targeting for surviving successfully is given birth to.F-A target practices site pinpoints Being successfully prepared for the transgene clone cattle of integration NRAMP1 genes, is that prevention prapess lay a solid foundation.

Nucleotides sequence list

<110>Xibei Univ. of Agricultural ＆ Forest Science ＆ Technology

<120>NRAMP1 fixed point insertions are mediated to obtain the side of transgenic cow fetal fibroblast using single Cas9 nickases Method

<160> 49

<210> 1

<211> 560

<212> DNA

<213> Bos taurus

<400> 1

aagaaccttg cccttgtcca ggaatccagg ggggcttcct ggaagaggtg atatgtacac 60

caaaccctaa aggagaagca gaacttaaag aagcagaaag gatgcgtgtg gggagcagag 120

tccattacag accgagagaa caggaagggc agaggccctg aggcagattt ggtgttctaa 180

ggattagaag gcagagtgtc tgggaacaca gagtaaggct ggaggggcaa gggggtgagg 240

ttagccacac tcccaaacta gccgcggtct ccacaactat gtgcagtgtc gacgtgcagc 300

tccttgaatt gccactcaca ggttcccagc acccagatcg acgtacaggc ctagggttcc 360

agaagcttcc atcacaccct ttctagtggt cctccacata gggcaccttt gtcctgtctt 420

ctgcacatag attggctccc tgtctttaaa ctccacgaaa acaggatcag agagaatccg 480

ttcttgtgtg tgaagtggga gctcactgtg gtttgcattt gcatttcacg gatgacccgt 540

gatgtcgagt ctcttcttat 560

<210> 2

<211> 25

<212> DNA

<213>Synthetic

<400> 2

caccgaacct gtgagtggca attca 25

<210> 3

<211> 25

<212> DNA

<213>Synthetic

<400> 3

aaactgaatt gccactcaca ggttc 25

<210> 4

<211> 25

<212> DNA

<213>Synthetic

<400> 4

caccgatgtg gaggaccact agaaa 25

<210> 5

<211> 25

<212> DNA

<213>Synthetic

<400> 5

aaactttcta gtggtcctcc acatc 25

<210> 6

<211> 25

<212> DNA

<213>Synthetic

<400> 6

caccgcagat cgacgtacag gccta 25

<210> 7

<211> 25

<212> DNA

<213>Synthetic

<400> 7

aaactaggcc tgtacgtcga tctgc 25

<210> 8

<211> 25

<212> DNA

<213>Synthetic

<400> 8

caccgcagca cccagatcga cgtac 25

<210> 9

<211> 25

<212> DNA

<213>Synthetic

<400> 9

aaacgtacgt cgatctgggt gctgc 25

<210> 10

<211> 25

<212> DNA

<213>Synthetic

<400> 10

caccgcagga caaaggtgcc ctatg 25

<210> 11

<211> 25

<212> DNA

<213>Synthetic

<400> 11

aaaccatagg gcacctttgt cctgc 25

<210> 12

<211> 25

<212> DNA

<213>Synthetic

<400> 12

caccgccaca ctcccaaact agccg 25

<210> 13

<211> 25

<212> DNA

<213>Synthetic

<400> 13

aaaccggcta gtttgggagt gtggc 25

<210> 14

<211> 25

<212> DNA

<213>Synthetic

<400> 14

caccgcctag gcctgtacgt cgatc 25

<210> 15

<211> 25

<212> DNA

<213>Synthetic

<400> 15

aaacgatcga cgtacaggcc taggc 25

<210> 16

<211> 25

<212> DNA

<213>Synthetic

<400> 16

caccgcctgt cttctgcaca tagat 25

<210> 17

<211> 25

<212> DNA

<213>Synthetic

<400> 17

aaacatctat gtgcagaaga caggc 25

<210> 18

<211> 25

<212> DNA

<213>Synthetic

<400> 18

caccgctagg cctgtacgtc gatct 25

<210> 19

<211> 25

<212> DNA

<213>Synthetic

<400> 19

aaacagatcg acgtacaggc ctagc 25

<210> 20

<211> 25

<212> DNA

<213>Synthetic

<400> 20

caccgctgta cgtcgatctg ggtgc 25

<210> 21

<211> 25

<212> DNA

<213>Synthetic

<400> 21

aaacgcaccc agatcgacgt acagc 25

<210> 22

<211> 25

<212> DNA

<213>Synthetic

<400> 22

caccggacaa aggtgcccta tgtgg 25

<210> 23

<211> 25

<212> DNA

<213>Synthetic

<400> 23

aaacccacat agggcacctt tgtcc 25

<210> 24

<211> 25

<212> DNA

<213>Synthetic

<400> 24

caccggtgga gaccgcggct agttt 25

<210> 25

<211> 25

<212> DNA

<213>Synthetic

<400> 25

aaacaaacta gccgcggtct ccacc 25

<210> 26

<211> 25

<212> DNA

<213>Synthetic

<400> 26

caccgtgtac gtcgatctgg gtgct 25

<210> 27

<211> 25

<212> DNA

<213>Synthetic

<400> 27

aaacagcacc cagatcgacg tacac 25

<210> 28

<211> 25

<212> DNA

<213>Synthetic

<400> 28

caccgtgtgg agaccgcggc tagtt 25

<210> 29

<211> 25

<212> DNA

<213>Synthetic

<400> 29

aaacaactag ccgcggtctc cacac 25

<210> 30

<211> 23

<212> DNA

<213>Synthetic

<400> 30

gactcctgta acctctgtcc ctg 23

<210> 31

<211> 17

<212> DNA

<213>Synthetic

<400> 31

tcagcagttg cggttcg 17

<210> 32

<211> 53

<212> DNA

<213>Synthetic

<400> 32

atttgcggcc gcgaattcgt cgacgtgggg tacccatgtc aggtgacacg ggc 53

<210> 33

<211> 63

<212> DNA

<213>Synthetic

<400> 33

aagcttccat ggatcgatgg gactagtacg cgtcgcggat cctcatcccg aggtcctccc 60

ctt 63

<210> 34

<211> 26

<212> DNA

<213>Synthetic

<400> 34

cgcgtcgacc atcacagcct cctacc 26

<210> 35

<211> 29

<212> DNA

<213>Synthetic

<400> 35

ttaaggtacc gggtgcttcc tctctaggc 29

<210> 36

<211> 26

<212> DNA

<213>Synthetic

<400> 36

gcggccgcgt ctgacccgtg agtgtt 26

<210> 37

<211> 24

<212> DNA

<213>Synthetic

<400> 37

gtcgacgcgg ctagtttggg agtg 24

<210> 38

<211> 25

<212> DNA

<213>Synthetic

<400> 38

atcgatacac cctttctagt ggtcc 25

<210> 39

<211> 24

<212> DNA

<213>Synthetic

<400> 39

aagctttccc gctgattgtt cttc 24

<210> 40

<211> 65

<212> DNA

<213>Synthetic

<400> 40

gagcactagt ataacttcgt atagcataca ttatacgaag ttattgcgtt atcccctgat 60

tctgt 65

<210> 41

<211> 66

<212> DNA

<213>Synthetic

<400> 41

taccatcgat ggaacttcgt ataatgtatg ctatacgaag ttatcgctta caatttacgc 60

cttaag 66

<210> 42

<211> 18

<212> DNA

<213>Synthetic

<400> 42

agttgtgccc tccgtgta 18

<210> 43

<211> 17

<212> DNA

<213>Synthetic

<400> 43

ctgccatgcc cactcat 17

<210> 44

<211> 17

<212> DNA

<213>Synthetic

<400> 44

gcgcatggcc gagttga 17

<210> 45

<211> 17

<212> DNA

<213>Synthetic

<400> 45

cccgcattgc tccctct 17

<210> 46

<211> 19

<212> DNA

<213>Synthetic

<400> 46

ccagttcttt gatgggtgt 19

<210> 47

<211> 19

<212> DNA

<213>Synthetic

<400> 47

ggcttgacag aagggtatg 19

<210> 48

<211> 20

<212> DNA

<213>Synthetic

<400> 48

agcaagcagg agacgtggaa 20

<210> 49

<211> 20

<212> DNA

<213>Synthetic

<400> 49

cgctcgtaga aggggaggtt 20

Claims

1. the specific expressed targeting vector of a kind of NRAMP1 macrophages, it is characterised in that：The targeting vector includes genes of interest NRAMP1 and for by NRAMP1 genes by homologous recombination fixed point insertion cattle No. 25 chromosomes FSCN1 and ACTB it is intergenic Element sequences.

2. the specific expressed targeting vector of a kind of NRAMP1 macrophages according to claim 1, it is characterised in that：The unit Part sequence includes that for the homology arm sequence of site homologous recombination of practicing shooting homology arm with cow genome group as template amplification, produce by amplification Thing is respectively the upstream 577-977bp and downstream 616-1016bp in target practice site on No. 25 chromosomes of cattle；Target practice site is located at cattle In sequence between No. 25 chromosome FSCN1 and ACTB genes as shown in SEQ.ID.NO.1.

3. the specific expressed targeting vector of a kind of NRAMP1 macrophages according to claim 1, it is characterised in that：The mesh Gene NRAMP1 be by external source expand NRAMP1 genes its own promoter start transcription.

4. the specific expressed targeting vector of a kind of NRAMP1 macrophages according to claim 1, it is characterised in that：The unit Part sequence also includes selection markers eGFP gene and PURO genes, and the two riddled basins are all started by EF1 α promoteres and turned Record, and expressed by self cleavage peptide P2A sequences fused in tandem.

5. the specific expressed targeting vector of a kind of NRAMP1 macrophages according to claim 4, it is characterised in that：The unit Part sequence also includes being located at two LoxP sequences in the same direction of two riddled basins both sides.

6. a kind of construction method of the bovine fetal fibroblast of insertion genes of interest NRAMP1, it is characterised in that：Including following Step：With bovine fetal fibroblast as host cell, by cotransfection targeting vector pNRAMP1-eGFP-P2A-Puro and pin Air exercise target site single CRISPR/Cas9 nickases expression vector, by genes of interest NRAMP1 site-directed integrations to cattle fetus into Between fibrocellular No. 25 chromosomes FSCN1 and ACTB gene.

7. method according to claim 6, it is characterised in that：The host cell is the holstein cow for passing on for 2～3 generations Fetal fibroblast.

8. method according to claim 6, it is characterised in that：The cotransfection operation adopts electroporation.

9. method according to claim 6, it is characterised in that：The single CRISPR/Cas9 nickases expression vector bag Containing the go-ahead sequence corresponding with target practice site, target practice site is located between No. 25 chromosome FSCN1 and ACTB genes of cattle such as In sequence shown in SEQ.ID.NO.1.

10. method according to claim 6, it is characterised in that：The cattle fetus of the insertion genes of interest NRAMP1 is into fibre Dimension cell can be used as the nuclear transplantation operation donorcellses of production transgene clone cattle.