CN106543274B - A kind of derivative of protein A domain Z with specific binding effect on antibody and application thereof - Google Patents

Abstract

The present invention relates to a protein A domain Z derivative with specific binding effect on antibodies and its application. In addition to the N23T mutation, at least one amino acid residue in the domain Z amino acid sequence is mutated. This derivative was obtained by a strategy of mutating at least one amino acid residue in Helix 1 and 2 in protein A mutation domain Z. On this basis, a method for preparing an affinity chromatography medium using the domain Z derivative as a ligand is provided. Compared with the affinity chromatography medium with domain Z and its oligomers as ligands, the domain Z derivatives provided by the present invention have higher chemical stability, and the protein denaturation temperature in alkaline solution is increased by 4 ℃; the synthesized affinity chromatography medium maintained a comparable antibody adsorption capacity.

Description

A kind of derivative of protein A domain Z with specific binding effect on antibody and its application

technical field

The present invention relates to a derivative of protein A mutant domain Z with improved chemical stability under alkaline conditions and a method for its application, in particular to an affinity chromatography medium using the mutant domain Z derivative as ligand The preparation method belongs to the field of affinity chromatography in biotechnology.

Background technique

Monoclonal antibody drug preparation technology has developed rapidly in the past 30 years. This is mainly due to the construction of high-expressing cell lines, the improvement of the medium and the continuous expansion of the reactor scale. At present, reactors of more than 20,000 liters have been promoted, and the antibody titer has increased by more than 30 times, and the antibody titer of 25g/L has also been reported [New Biotechnol, 2011, 28(5): 458-63; Adv Drug Deliv Rev, 2006, 58(5-6):671-85]. Protein A chromatography is the most widely used and mature technology in the process of antibody capture and purification, and it is regarded as the core unit and "gold standard" of antibody preparation. Common commercial protein A chromatography media mainly include natural protein A as ligand media (such as GE's nProtein ASepharose Fast Flow, etc.) and recombinant protein A as ligand media (such as GE's rProtein A SepharoseFast Flow and MabSelect SuRe). Wait). However, currently commonly used protein A chromatography media not only have limited processing capacity (20-30 g/L), but also have recognized defects such as high cost, short life and harsh operating conditions. As a basic means to reduce the cost of chromatography media, the reuse of protein A chromatography media is necessary. Like ion exchange, gel filtration, hydrophobic interaction and other protein chromatography techniques, the protein A chromatography medium after recovery of antibodies needs to be cleaned by a rigorously validated and standard cleaning-in-place (CIP) process to remove impurities and residual antibodies on the medium. And its polymers, endotoxins and other impurities. A standard CIP procedure for protein chromatography involves treating the chromatography medium with 0.5 mol/L to 1.0 mol/L sodium hydroxide solution. This condition is very harsh for protein A chromatography media, and the direct result is the destruction of protein A's higher-order structure, the decline of the adsorption capacity of the media and the reduction of lifespan. Therefore, protein A chromatography has become the main technical "bottleneck" for the preparation of monoclonal antibodies and a key engineering technology that needs to be broken through.

Protein A is a protein molecule with a molecular weight of 42 kDa isolated from the cell wall of Staphylococcus aureus, which contains highly homologous antibody-binding domains E, D, A, B and C. Among the above-mentioned five antibody domains, domain B is particularly advantageous in binding specificity to antibodies. On this basis, the mutated domain Z obtained by mutating the 29-position glycine of domain B to alanine (G29A) not only eliminated the chemical dissociation of domain B caused by deamidation, but also improved its performance in alkaline conditions. Stability under [China Invention Patent Publication No. CN101522278A]. In addition, the binding effect of the domain to the antibody Fab fragment is also reduced with the mutation, and then the binding specificity to the antibody Fc fragment is enhanced [Chinese invention patent, application number: 201080013514.0]. Domain Z and its oligomers have been widely used in protein A chromatography media due to better alkali resistance. The tolerance of domain Z to lye was further improved by N23T mutation [Proteins-Structure Function and Bioinformatics, 2004, 55(2): 407-416]. Patent Publication No. CN1642976A further discloses a method for an immunoglobulin binding protein with at least one asparagine residue mutated, characterized in that the mutations include N23T and N43E, N28A, N6A, N11S, N11S and N23T and N6A and N23T etc. different combinations. But this strategy is only reflected in the modification of a specific amino acid (asparagine). Minakuchi et al. reported that the G29A mutation of antibody domain C can also improve the alkali resistance of domain C [Protein Science, 2013, 22(9): 1230-1238]. Correspondingly, the alkali resistance of G29Y, G29M or G29W mutation in antibody domain C is more advantageous. Kaneka Corporation has disclosed a mutant of antibody domains E, D, A, B and C that mutate glycine into amino acids other than alanine [Publication No. CN 102365361A], which is characterized by the obtained mutant domains The chemical stability under alkaline conditions is improved while the affinity with antibody Fab fragments is reduced. These approaches to improve the alkali resistance of antibody domains were developed for deamidation and specific amino acids.

At present, protein A chromatography ligands represented by domain Z and its oligomers have been widely used in the purification process of antibodies. The above chromatographic process includes a CIP step of removing residual proteins and impurities on the chromatographic medium by using 0.1 mol/L sodium hydroxide solution. This is still far from the 0.5–1.0 mol/L sodium hydroxide solution required by the aforementioned standard CIP [Publication No.: CN 101522278A]. The strategy of standard CIP is to expose the chromatographic medium to a pH above 13. This is still very harsh for the current commercial protein A chromatography medium, which will lead to the destruction or even loss of the steric structure of the protein A chromatography ligand and the reduction of antibody binding ability [Protein Science, 2013, 22(9):1230] -1238]. Therefore, further improving the alkali resistance of domain Z is the key to solving the safety and cost of the current protein A chromatography technology application.

In addition to eliminating deamidation of antibody domains, attempts to address binding specificity and chemical stability of protein ligands are also underway from other perspectives. Deisenhofer determined 11 key amino acid residues involved in binding in antibody domain B by analyzing the complex crystal structure of the antibody Fc segment and protein A antibody domain B [Biochemistry, 1981, 20: 2361-70]. Palmer et al. reported that a Y3F/T16I/T18I mutant of an antibody-binding protein G molecule isolated from Streptococcus cell wall had better alkali resistance than wild protein G [Journal of Biotechnology, 2008, 134 (3- 4): 222-230]. Li Rongxiu and Li Lingshu disclosed a new method for obtaining protein A with low antibody affinity, which is characterized by the F13G/Y14G double mutation on domain Z [Publication No.: CN 105198973A]. The antibody affinity of the mutant decreased by more than 90% compared with the domain Z. In order to systematically improve either the binding specificity and chemical stability of domain Z, or both, we propose a stable structure based on an in-depth understanding of domain Z stability and the molecular mechanism of its interaction with antibodies. The overall strategy of domain Z to obtain domain Z derivatives with better chemical stability by stabilizing the overall structure of domain Z.

SUMMARY OF THE INVENTION

The purpose of the present invention is to improve the chemical stability of domain Z in lye, so as to provide a derivative of domain Z with specific binding to antibodies, which has good chemical stability under alkaline conditions; On this basis, a method for preparing an affinity chromatography medium using the domain Z derivative as a ligand is provided. Compared with the affinity chromatography medium using domain Z and its oligomers as ligands, the antibody binding ability of the affinity chromatography medium prepared by the present invention is comparable.

The purpose of the present invention is achieved through the following technical solutions.

A protein A domain Z derivative with specific binding effect on antibodies, characterized in that the domain Z derivative is derived from the domain Z amino acid sequence of SEQ ID No.: 1 except for the N23T mutation At least one amino acid residue was also mutated, and the derivatives of this domain Z obtained higher chemical stability under alkaline conditions compared to the parent molecule.

The said derivative with specific binding effect on antibody is characterized in that the domain Z derivative can specifically bind to the Fc fragment of the antibody.

The said domain Z derivative is characterized in that, the parent molecule contains the sequence of SEQ ID No.: 1 and the amino acid mutation is selected from 23 asparagine residues, 11 asparagine residues, 12 alanine residues At least one amino acid residue among acid residues, glutamine residues at position 32 and lysine residues at position 35.

The said domain Z derivative is characterized in that, it is characterized in that the 11-position asparagine, the 12-position alanine, the 32-position glutamine and the 35-position lysine have been mutated, more preferably the 11-position day The paraparagine residue was mutated to threonine, the alanine residue at position 12 was mutated to tryptophan, the glutamine residue at position 32 was mutated to threonine, and the lysine residue at position 35 was mutated to arginine. .

A multi-domain protein comprising two or more domain Z derivatives linked together, wherein the number of domain Z derivatives is 2-6.

The multi-domain protein is characterized in that each domain is formed by connecting several glycine residues.

The method for preparing an affinity chromatography medium using the mutant domain Z derivative of the present invention as a ligand is characterized in that the domain of any one of the above-mentioned domains is coupled in the pores of agarose gel particles with an average particle size of 30-300 μm. Z derivative or derivative multimer.

The affinity chromatography medium is characterized in that the domain Z derivative or derivative multimer ligand density of the affinity chromatography medium is 2.0-15 mg/mL.

The affinity chromatography medium is characterized in that the affinity chromatography medium can bind to the protein containing the Fc fragment of the antibody.

The method for the affinity chromatography medium for antibody separation is characterized in that the domain Z derivative or derivative multimer is coupled to the Sepharose particles through amino groups or carboxyl groups.

Compared with the parent molecule, a derivative of domain Z provided by the present invention has better chemical stability under alkaline conditions, and the binding specificity of the antibody of the derivative is comparable to that of domain Z. The affinity chromatography medium prepared on this basis with domain Z derivatives as ligands can withstand CIP washing with higher concentrations of lye and maintain equivalent antibodies compared to the affinity chromatography medium with parent molecules as ligands binding ability.

Compared with the prior art, the domain Z derivative provided by the present invention and the affinity chromatography medium using the domain Z derivative as a ligand have the following advantages:

(1) The domain Z derivative provided by the present invention is an overall stabilization strategy based on protein structure. The implementation of this strategy is based on a deep knowledge of the structure of the domain Z protein. The improvement of chemical stability of domain Z derivatives is not limited to the mutation of a single or only a certain amino acid residue in the sequence (such as the mutation of G29A or asparagine residues, etc.), but originates from the Helix 1 and The mutation of at least one amino acid residue in 2 represents an overall strategy to stabilize the molecular structure of the protein.

(2) The domain Z derivatives provided by the present invention have higher chemical stability. Compared with the structural domain Z of SEQ ID No.: 1, the protein denaturation temperature of the derivative of SEQ ID No.: 2 in 0.1mol/L sodium hydroxide solution increased by 4°C, and the sequence number is SEQ ID The denaturation temperature of the derivative of No.:3 increased by 3.2℃. This result shows that the domain Z derivatives provided by the present invention have higher stability.

(3) The affinity chromatography medium with domain Z derivatives as ligands maintained comparable antibody binding ability. The domain Z derivatives provided by the present invention are obtained based on the overall stabilization strategy of the protein molecular structure, and the mutation of amino acid residues does not involve the key amino acid residues that bind to the Fc fragment of the antibody or does not change the key amino acid residues that have a binding effect with the Fc fragment of the antibody. Properties of key amino acid residues for binding. Thus, the obtained Domain Z derivatives substantially maintained comparable antibody binding capacity and adsorption capacity.

Description of drawings

In order to make the content of the present invention easier to be understood clearly, the present invention will be described in further detail below in conjunction with the accompanying drawings, wherein:

Fig. 1 shows the differential expression of protein A domain Z of SEQ ID No. 1-4 and its derivatives in 20 mmol/L phosphate buffer containing 100 mmol/L sodium chloride and 0.1 mol/L sodium hydroxide solution Scan calorimetry results.

Figure 2 shows the recovery of Q Sepharose FF by ion exchange chromatography of the expression products of the domain Z derivatives of SEQ ID No.: 5(a) and SEQ ID No.: 7(b).

Fig. 3 The results of antibody adsorption in 20 mmol/L phosphate buffer containing 100 mmol/L sodium chloride in affinity chromatography medium using domain Z derivatives as ligands.

Detailed ways

The embodiments of the present invention are provided for illustrative purposes only and should not be construed as limiting the invention as defined by the appended claims.

Example 1 Preparation and stability of domain Z derivatives with SEQ ID No.: 2

The domain Z with the sequence number of SEQ ID No.: 1 and the protein with the sequence number of SEQ ID No.: 2 were synthesized by solid-phase chemical synthesis of peptides. The above proteins were dissolved in 20 mmol/L PBS buffer (pH 6.0) containing 100 mmol/L NaCl to prepare a protein solution with a protein concentration of 1 mg/mL. The denaturation temperature of proteins in the above two solutions was carried out in a VP-DSC type differential scanning calorimeter. First, after the sample cell and reference cell of VP-DSC were washed with 100 mL of ultrapure water, the buffer solution (20 mmol/L PBS buffer containing 100 mmol/L NaCl, 20 mmol/L PBS buffer containing 100 mmol/L NaCl, pH 6.0) and about 0.75 mL each of the protein solution were added to the reference and sample cells (the volume of the reference and sample cells was 0.5282 mL). After the excess solution was removed by the Hamilton injector, the sample and reference cells were capped and sealed. The temperature scanning range of differential scanning calorimetry was 25-120 °C, and the heating rate was 1 °C/min. Before heating begins, the test temperature equilibration time is 8 min. Data processing was done with MicroCal-enabled Origin 7.0 software. The results are shown in Figure 1. The results showed that the denaturation temperature of the domain Z with the sequence number of SEQ ID No.: 1 was 75.3°C, and the denaturation temperature of the domain Z derivative of the sequence number of SEQ ID No.: 2 was 79.3°C. This indicates that the domain Z derivative of SEQ ID No.: 2 is more stable under neutral conditions.

Example 2 The stability of the domain Z derivative of SEQ ID No.: 2 in lye

The structural domain Z of SEQ ID No.: 1 and the protein of SEQ ID No. 2 were synthesized by the preparation method described in Example 1. The above protein was dissolved in a 0.1 mol/L sodium hydroxide solution to prepare a protein solution with a protein concentration of 1 mg/mL. The denaturation temperature of proteins in the above two solutions was analyzed by differential scanning calorimetry as in Example 1. The solution system is 0.1 mol/L sodium hydroxide solution. The reference cell was injected with 0.1 mol/L sodium hydroxide solution that had been degassed by vacuum for more than 15 min. The temperature scanning range of differential scanning calorimetry was 25-120 °C, and the heating rate was 1 °C/min. Before heating begins, the test temperature equilibration time is 8 min. Data processing was done with MicroCal-enabled Origin 7.0 software. The results are shown in Figure 1. The results showed that the denaturation temperature of domain Z with SEQ ID No. 1 in 0.1 mol/L sodium hydroxide solution was 61.6°C, and the denaturation temperature of domain Z with SEQ ID No.: 2 was 0.1 The denaturation temperature in mol/L sodium hydroxide solution was 64.8°C. This shows that the chemical stability of the domain Z derivative with the sequence number of SEQ ID No.: 2 is higher in 0.1 mol/L sodium hydroxide solution.

Example 3 Preparation and stability of domain Z derivatives with SEQ ID No.: 3

The protein with the sequence number of SEQ ID No.: 3 was synthesized by the preparation method described in Example 1. The denaturation temperature of the above proteins under neutral conditions was analyzed by differential scanning calorimetry as in Example 1. The results are shown in Figure 1. The results showed that the denaturation temperature of the domain Z derivative of SEQ ID No.: 3 was 76.9°C. This indicates that the domain Z derivative of SEQ ID No.: 3 is more stable than domain Z under neutral conditions.

Example 4 The stability of the domain Z derivative of SEQ ID No.: 3 in lye

The stability of the domain Z derivative of SEQ ID No.: 3 in alkaline solution was measured by the method described in Example 2. The results are shown in Figure 1. The results showed that the denaturation temperature of the domain Z derivative of SEQ ID No.: 3 in 0.1 mol/L sodium hydroxide solution was 62.8°C. This shows that the chemical stability of the domain Z derivative with the sequence number of SEQ ID No.: 3 is higher in 0.1 mol/L sodium hydroxide solution.

Example 5 Preparation of Domain Z Derivatives with SEQ ID No.: 4 and Measurement of Stability under Various Conditions

The protein with the sequence number of SEQ ID No.: 4 was synthesized by the preparation method described in Example 1. Denaturation temperatures of the above proteins under neutral and basic conditions were analyzed using differential scanning calorimetry as in Examples 1 and 2. The results are shown in Figure 1. The results showed that the denaturation temperature of the domain Z derivative of SEQ ID No.: 4 was 77.5°C under neutral conditions and 62.4°C in 0.1 mol/L sodium hydroxide solution. This shows that the chemical stability of the domain Z derivative with the sequence number of SEQ ID No.: 4 is better than that of the domain Z under neutral conditions and in 0.1 mol/L sodium hydroxide solution.

Example 6 Preparation of Domain Z Derivatives with SEQ ID No.: 5

The domain Z derivative gene sequence of SEQ ID No.: 5 was designed and synthesized by chemical synthesis method, and the length of its sequence SEQ ID No.: 6 was 375 bp. The above sequence includes the stop codon TAA and added 5'Ndel and 3'Xhol. 5'Ndel and 3'Xhol were used for cloning into vector pet-30a (Kan). The vector was digested with restriction enzymes Ndel and Xhol, and then ligated with the gene of SEQ ID No.: 5 to obtain the pet-30a (Kan) plasmid containing the gene of SEQ ID No.: 6. The plasmids were transformed into BL21DE3 cells using the calcium chloride method. Pick a single colony of transformed BL21DE3 Escherichia coli, inoculate it in a liquid LB medium containing 30 μg/mL kanamycin and cultivate overnight, then inoculate it into the fermentation broth under sterile conditions, and the inoculation concentration is not less than 1:200 ( v/v), the inoculated fermentation broth was fermented at 37°C until the OD ₆₀₀ value reached 0.6-0.8, adding IPTG with a concentration of 500 mmol/L to the final concentration of IPTG in the fermentation broth of 0.5 mmol/L and continuing to ferment for more than 6 h . The collected fermentation broth was centrifuged at 4800 rpm for 30 min to remove the supernatant, and the cells were resuspended with 20 mmol/L Tris-HCl buffer (pH 7.5). After repeating the above operations, the resuspended cells were sonicated and the fragmented liquid was collected. The cell fragmentation solution was filtered with a 0.45 μm filter membrane, and purified by Q-Sepharose HP ion exchange chromatography. The adsorption buffer was 20 mmol/L Tris-HCl buffer (pH 7.5), and the elution buffer was 1.0 mol/L. NaCl in 20 mmol/L Tris-HCl buffer (pH 7.5). The target protein was recovered by gradient elution, and the gradient condition was that the elution buffer linearly increased to 15% within 30 min. Chromatographic peaks eluting at conductivities of 8-11 mS/cm were collected. The chromatographic peak results are shown in Figure 2(a). The purity of the target protein was 96%.

Example 7 Preparation of Domain Z Derivatives with SEQ ID No.: 7

Using the method described in Example 6, a domain Z derivative gene sequence with the sequence number of SEQ ID No.: 7 was designed and synthesized by chemical synthesis, and the length of the sequence SEQ ID No.: 8 was 747 bp. The vector was digested with restriction enzymes Ndel and Xhol, and then the gene of SEQ ID No.: 8 was ligated to obtain the pet-30a (Kan) plasmid containing the gene of SEQ ID No.: 8. The plasmids were transformed into BL21DE3 cells using the calcium chloride method. After microbial fermentation and separation and purification, the chromatographic peak results are shown in Figure 2(b). The purity of the obtained target protein was 95.2%.

Example 8 Preparation of the domain Z derivative of SEQ ID No.: 2 as a ligand affinity chromatography medium

Affinity chromatography medium was prepared by using the domain Z derivative of SEQ ID No.: 2 synthesized in Example 1 as a ligand. The preparation process includes two steps of media activation and ligand coupling. The medium activation method is as follows: after the Sepharose FF stored in 20% ethanol is rinsed with a large amount of deionized water and dried with a G3 funnel, weigh 15.0 g of the drained medium into a 100 mL conical flask, add 75% (w/w ) glycidyl trimethyl ammonium chloride (GTMAC) 7.5mL, 7.5mL double distilled water and 0.387g 50% (w/w) sodium hydroxide solution, mixed well, placed at 25°C, and reacted overnight at 170rpm; After the end, after the medium was washed with a large amount of deionized water and drained, 13.0 g of the drained medium was weighed and transferred to a 100 mL conical flask, and 8.0 mL of 4.6 mol/L NaOH solution was added to fully suspend; then, 1,4-butane was added. Diglycidyl diglycidyl ether (BDDE) 11.0 mL was reacted at 37° C. and 170 rpm for 2 h; after the reaction, washed with a large amount of deionized water to obtain an activated chromatographic medium with an epoxy group density of 38 μmol/g. The ligand coupling method is as follows: Weigh 4.0 g of the activation medium and place it in a 50 mL conical flask, add 20 mL of 10 mmol/L sodium bicarbonate solution to balance for 1 h, drain the solution, transfer the medium to a 25 mL conical flask, add containing 40 mg of 10 mmol/L sodium bicarbonate solution 8.5 mL of the domain Z derivative of SEQ ID No. 2, fully suspended and reacted at 37 ° C and 170 rpm for 2 h; Drying treatment; the obtained chromatographic medium was placed in a 25mL conical flask, 8mL blocking buffer was added, and the reaction was carried out at 25°C and 170rpm overnight; the reaction products were sequentially mixed with 0.1mol/L Tris-HCl containing 0.15mol/L NaCl Buffer (pH 8.0) and 50 mmol/L acetic acid buffer (pH 4.5) were washed three times each, and the washed medium was finally washed with deionized water and 20% ethanol, respectively, to obtain a ligand density of 6.3 mg/g. and the chromatographic medium Z2Sepahrose FF.

Using the above synthesis method, 8.5 mL of 10 mmol/L sodium bicarbonate solution containing 40 mg of domain Z with the sequence number of SEQ ID No.: 1 was added, fully suspended and reacted at 37° C. and 170 rpm for 2 h; the obtained ligand density was 5.7 mg/g of the affinity chromatography medium Z1Sepharose FF.

In 20mmol/L phosphate buffer (pH 7.4) containing 100mmol/L sodium chloride, the antibody adsorption equilibrium curves of the above affinity chromatography media Z2Sepharose FF and Z1Sepharose FF are shown in Figure 3, and the corresponding saturated adsorption capacities of antibodies 69.0 mg/g medium and 60.9 mg/g medium, respectively.

Example 9 Preparation of the domain Z derivative of SEQ ID No.: 3 as ligand affinity chromatography medium

The method shown in Example 8 was used to prepare the domain Z derivative of SEQ ID No.: 3 as the ligand affinity chromatography medium, wherein 4 g of the activation medium was added to contain 40 mg of the domain Z of SEQ ID No.: 3. 8.0 mL of a 10 mmol/L sodium bicarbonate solution of the derivative was fully suspended and reacted at 37° C. and 170 rpm to obtain an affinity chromatography medium Z3Sepharose FF with a ligand density of 7.1 mg/g. In 20mmol/L phosphate buffer (pH 7.4) containing 100mmol/L sodium chloride, the antibody adsorption equilibrium curve of the above affinity chromatography medium is shown in Figure 3, and the saturated adsorption capacity of the antibody is 52.3mg/g medium.

Example 10 Preparation of the domain Z derivative of SEQ ID No.: 4 as ligand affinity chromatography medium

The method described in Example 8 was used to prepare the domain Z derivative of SEQ ID No.: 4 as the ligand affinity chromatography medium, wherein 4 g of the activation medium was added with 100 mg of the domain Z derivative of SEQ ID No.: 4. 8.0 mL of a 10 mmol/L sodium bicarbonate solution of the compound was fully suspended and reacted at 37 °C and 170 rpm to obtain an affinity chromatography medium Z4Sepharose FF with a ligand density of 14.8 mg/g. In 20mmol/L phosphate buffer (pH 7.4) containing 100mmol/L sodium chloride, the antibody adsorption equilibrium curve of the above affinity chromatography medium is shown in Figure 3, and the saturated adsorption capacity of the antibody is 45.8mg/g medium.

Example 11 Preparation of Affinity Chromatography Medium Using Domain Z Derivative of SEQ ID No.: 5 as Ligand

The method described in Example 8 was used to prepare the domain Z derivative of SEQ ID No.: 5 as the ligand affinity chromatography medium, wherein 75% (w/w) glycidyl trimethyl chloride was added during the medium activation process. Ammonium (GTMAC) 20.0 mL, 1,4-butanediol diglycidyl ether (BDDE) was added in an amount of 20.0 mL, and the reaction obtained an activated chromatography medium with an epoxy group density of 77.1 μmol/g. During the ligand coupling process, 8.5 mL of 10 mmol/L sodium bicarbonate solution containing 20 mg of the domain Z derivative with the sequence number of SEQ ID No.: 5 prepared according to Example 5 was added to 4.0 g of the activation medium, and the reaction obtained the ligand. The affinity chromatography medium Z5 Sepahrose FF with a base density of 2.3 mg/g. In 20mmol/L phosphate buffer (pH7.4) containing 100mmol/L sodium chloride, the antibody adsorption equilibrium curve of the above affinity chromatography medium is shown in Figure 3, and the saturated adsorption capacity of the antibody is 31.1mg/g medium .

Example 12 Preparation of the domain Z derivative of SEQ ID No.: 7 as ligand affinity chromatography medium

The method described in Example 9 was used to prepare the domain Z derivative of SEQ ID No.: 7 as the ligand affinity chromatography medium. During the ligand coupling process, 4.0 g of the activation medium was added with 30 mg of 8.5 mL of a 10 mmol/L sodium bicarbonate solution of the prepared domain Z derivative of SEQ ID No.: 7 was prepared and reacted to obtain an affinity chromatography medium Z7 Sepahrose FF with a ligand density of 6.6 mg/g. In 20mmol/L phosphate buffer (pH7.4) containing 100mmol/L sodium chloride, the antibody adsorption equilibrium curve of the above affinity chromatography medium is shown in Figure 3, and the saturated adsorption capacity of the antibody is 72.7mg/g medium .

A staphylococcal protein A domain Z derivative with improved stability disclosed and proposed in the present invention and its application can be realized by those skilled in the art by referring to the content of this article and appropriately changing the conditional route and other links, although the method and preparation of the present invention The technology has been described by preferred embodiments, and those skilled in the art can obviously modify or recombine the methods and technical routes described herein without departing from the content, spirit and scope of the present invention to achieve the final preparation technology. It should be particularly pointed out that all similar substitutions and modifications apparent to those skilled in the art are deemed to be included in the spirit, scope and content of the present invention.

SEQ ID No.: 1

SEQ ID No.: 2

SEQ ID No.: 3

SEQ ID No.: 4

SEQ ID No.: 5

SEQ ID No.: 6

CATATG GTGGATAACAAGTTCAATAAAGAGCAGCAGACCATTTTTTATGAAATTCTGCATCTGCCGAATCTGACCGAAGAACAGCGCAACGCCTTCATCACCAGTCTGCGTGATGATCCGAGCCAGAGCGCCAATCTGCTGGCCGAAGCCAAAAAGCTGAACGATGCCCAGGCACCGAAGG GCGGTGGCGGTG TGGACAATAAGTTTAACAAAGAGCAACAAACCATCTTCTACGAAATCCTGCACCTGCCGAACCTGACCGAGGAACAACGCAATGCCTTCATTACCAGCCTGCGTGATGACCCGAGCCAAAGTGCCAACCTGCTGGCCGAAGCCAAGAAGCTGAATGATGCCCAAGCCCCGAAATAA CTC GAG

SEQ ID No.: 7

SEQ ID No.: 8

CATATG CTCGAG

Claims (6)

1. A protein A structural domain Z derivative with specific binding effect on an antibody is characterized in that the structural domain Z derivative is SEQ ID No. 2.

2. A multidomain protein comprising a derivative of protein A Domain Z having a specific binding activity for an antibody, wherein said multidomain protein comprises 2 or more domain Z derivatives linked together, the number of domain Z derivatives being from 2 to 6, and said domain Z derivative being SEQ ID NO. 2.

3. Multidomain protein of a derivative of protein a domain Z according to claim 2, characterised in that said multidomain protein is formed by several glycine residues connecting the individual domains.

4. An affinity chromatography medium comprising as ligand a derivative of domain Z of protein a of claim 1 wherein the affinity chromatography medium has a domain Z derivative or derivative multimer ligand density of 2.0-15 mg/mL.

5. The affinity chromatography media of claim 4, wherein the affinity chromatography media binds to a protein comprising an Fc fragment of an antibody.

6. The affinity chromatography media according to claim 4, wherein the domain Z derivative or derivative multimer is coupled to the sepharose particles via an amino or carboxyl group.

Images