JP5008027B2 - Method for designing a protein suitable for protein orientation control immobilization - Google Patents

Description

  The present invention relates to a method for designing an immobilized protein. The present invention further relates to a method for designing an immobilized protein with controlled orientation.

  Conventionally, it has been attempted to use a soluble protein as an immobilized protein by binding it to an insoluble immobilization carrier such as an agarose gel. For example, an immobilized enzyme in which an enzyme protein is bound to an immobilization carrier has been developed, and an enzyme reactor has been produced using the enzyme. As for the quality of such immobilized protein, the properties and functions of the protein are uniform, the properties and functions equivalent to the non-immobilized soluble protein are retained, and the immobilized protein per carrier. The higher the amount, the better, but it depends on the protein immobilization method.

  As a method for protein immobilization, chemical bonding with an immobilization carrier has been mainly performed by utilizing the reactivity of the side chains of amino acids constituting the protein. However, as long as an immobilization reaction using such a side chain functional group is used, in a protein having a plurality of side chains used for the immobilization reaction, it is necessary to control the immobilization site at a plurality of locations. It is difficult to prevent the immobilization of the protein and to maintain the uniformity of the immobilized protein. In addition, these difficult factors also lead to a decrease in the function of the immobilized protein, and improvement has been desired.

  In order to avoid heterogeneity of immobilized proteins due to immobilization via functional groups of multiple side chains, attempts have been made to design and prepare protein sequences that have functional groups only, such as by amino acid substitution of proteins. For example, the protein is modified to a sequence having only one cysteine residue in the protein, and site-specific immobilization is performed via SS bond or the like (Patent Document 1 and Non-Patent Document 1). ~ 3).

  On the other hand, since there is only one carboxyl terminus of the protein, site-specific and orientation-controlled immobilization can be performed by immobilization via a terminal carboxyl group. The present inventors have already made use of an amide bond forming reaction via a cyanocysteine residue to immobilize a carboxyl group at the carboxy terminus of a protein via a peptide having a primary amine and a peptide (amide) bond. (See Patent Documents 2 to 5). As a result, the immobilized protein is bonded via the main chain at one position of the carboxy terminus, so that the obtained immobilized protein is immobilized in a controlled orientation and is completely uniform. It becomes. In addition, by maintaining the uniformity of orientation control, the reversibility of the immobilized protein can be improved, and excellent characteristics in terms of use such as heat sterilization of the immobilized protein can be added. (See Non-Patent Document 4).

  As described above, the immobilization technique using the binding reaction via cyanocysteine developed by the present inventors has excellent characteristics, but depending on the protein used, it may be difficult to produce a protein for immobilization. It is necessary to take individual measures according to the characteristics of the protein, and it is necessary to contain a large amount of primary amine as a functional group in the insoluble immobilization carrier used for immobilization. Development of a technique for removing ion interaction and the like caused by reactivity of unreacted primary amine remaining on the immobilization carrier later has been left as a problem to be solved.

Japanese Patent No. 2578661 Japanese Patent No. 3788828 Japanese Patent No. 2990271 Japanese Patent No. 3047020 JP 2003-344396 A M. Iwakura et al. (1993) J. Biochem. 114, 339-343 S. J. Vigmond et al. (1994) Langumur, 10, 2860-2862 M. Iwakura et al. (1995) J. Biochem. 117, 480-488 M. Iwakura et al. (2001) Protein engineer., 14, 583-589

  The present invention clarifies and defines the conditions for optimizing the amino acid sequence of a protein including the amino acid sequence of a specific protein to be immobilized for use in orientation control immobilization via cyanocysteine. Objective.

  The present inventors diligently studied to solve the above-mentioned problems to be solved in protein immobilization. The present inventors have conducted extensive research to make the amino acid sequence of the protein for immobilization, including the amino acid sequence of the protein to be immobilized, suitable for orientation control immobilization via cyanocysteine. By designing the sequence as a sequence consisting of five parts including the part consisting of the amino acid sequence of the protein to be immobilized, that is, a sequence represented by R1-R2-R3-R4-R5, and giving each part a characteristic And found that the above problems can be solved. In addition, the present inventors have clarified that a gene corresponding to an immobilization protein can be prepared, and the separation and purification operation after expression in a host cell can be made common, and the immobilization reaction conditions can be made common. . Furthermore, the present inventors made R1 a sequence consisting of two parts represented by PQ in the sequence represented by R1-R2-R3-R4-R5, and the sequence of the P part was (Ser or Ala)-( Gly) n sequence (n is an arbitrary integer from 1 to 10), the Q portion sequence is a protein sequence having repeating units, and the sequence unit without lysine residues and cysteine residues is repeated. It has been found that a plurality of functions such as the binding ability exhibited by each of the repeated sequence portions can be provided in one polypeptide chain by using such a sequence, resulting in enhancement of the function. Completed.

  That is, the aspects of the present invention are as follows.

[1] Amino acid sequence represented by general formula R1-R2-R3-R4-R5 [wherein the sequence represents a sequence from the amino terminal side to the carboxy terminal side,
The sequence of the R1 portion is the sequence of the protein to be immobilized, and is a sequence characterized by not containing lysine residues and cysteine residues;
The sequence of the R2 moiety may not be present, and if present is a spacer sequence composed of amino acid residues other than lysine and cysteine residues;
The sequence of the R3 portion is a sequence composed of two amino acids represented by cysteine-X (X is an amino acid residue other than lysine and cysteine);
The R4 portion sequence may not be present, and if present, is a sequence that does not include lysine residues and cysteine residues, and is a protein comprising an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 A sequence characterized in that it contains acidic amino acid residues that can bring the entire isoelectric point to the acidic side; and the sequence of the R5 moiety is an affinity tag sequence for purifying the protein]
A protein used to immobilize a portion represented by R1-R2 on an immobilization carrier.

[2] In the amino acid sequence of the general formula R1-R2-R3-R4-R5, the sequence of the R1 part is the amino acid sequence of a naturally derived protein, or all lysine residues and cysteine residues in the amino acid sequence, A protein comprising an amino acid sequence obtained by substitution with an amino acid residue other than a lysine residue and a cysteine residue, the amino acid sequence modified to an amino acid sequence not containing a lysine residue and a cysteine residue, A protein comprising the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 of [1], wherein the protein has the same function as

[3] The amino acid sequence represented by the general formula R1-R2-R3-R4-R5, wherein the R2 portion is a sequence consisting of 0 to 10 glycines, A protein comprising an amino acid sequence represented by the formula R1-R2-R3-R4-R5.

[4] In the amino acid sequence represented by the general formula R1-R2-R3-R4-R5, the R4 portion sequence has 0 to 10 amino acid residues consisting of two types of amino acid residues, aspartic acid and glutamic acid. A protein comprising the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 of [1], which is a sequence.

[5] The amino acid sequence represented by the general formula R1-R2-R3-R4-R5 is characterized in that the sequence of the R5 portion is an amino acid sequence consisting of 4 or more histidine residues. [1] A protein comprising an amino acid sequence represented by the general formula R1-R2-R3-R4-R5.

[6] In the amino acid sequence represented by the general formula R1-R2-R3-R4-R5, the sequence of the R1 portion has a function of specifically interacting with an antibody molecule, [1] to [1] 5].

[7] The protein of [1] consisting of the following amino acid sequence (SEQ ID NO: 1).
Ala-Asp-Asn-Asn-Phe-Asn-Arg-Glu-Gln-Gln
Asn-Ala-Phe-Tyr-Glu-Ile-Leu-Asn-Met-Pro
Asn-Leu-Asn-Glu-Glu-Gln-Arg-Asn-Gly-Phe
Ile-Gln-Ser-Leu-Arg-Asp-Asp-Pro-Ser-Gln
Ser-Ala-Asn-Leu-Leu-Ser-Glu-Ala-Arg-Arg
Leu-Asn-Glu-Ser-Gln-Ala-Pro-Gly-Gly-Gly
Gly-Gly-Cys-Ala-Asp-Asp-Asp-Asp-Asp-Asp
His-His-His-His-His-His

[8] The protein according to [1], comprising the following sequence (SEQ ID NO: 2).
Ala-Tyr-Arg-Leu-Ile-Leu-Asn-Gly-Arg-Thr
Leu-Arg-Gly-Glu-Thr-Thr-Thr-Glu-Ala-Val
Asp-Ala-Ala-Thr-Ala-Glu-Arg-Val-Phe-Arg
Gln-Tyr-Ala-Asn-Asp-Asn-Gly-Val-Asp-Gly
Glu-Trp-Thr-Tyr-Asp-Asp-Ala-Thr-Arg-Thr
Phe-Thr-Val-Thr-Glu-Arg-Pro-Glu-Val-Ile
Asp-Ala-Ser-Glu-Leu-Thr-Pro-Ala-Val-Thr
Gly-Gly-Gly-Gly-Cys-Ala-Asp-Asp-Asp-Asp
Asp-Asp-His-His-His-His-His-His

[9] The protein of [1] consisting of the following sequence (SEQ ID NO: 3).
Ala-Thr-Ile-Arg-Ala-Asn-Leu-Ile-Tyr-Ala
Asp-Gly-Arg-Thr-Gln-Thr-Ala-Glu-Phe-Arg
Gly-Thr-Phe-Glu-Glu-Ala-Thr-Ala-Glu-Ala
Tyr-Arg-Tyr-Ala-Asp-Leu-Leu-Ala-Arg-Glu
Asn-Gly-Arg-Tyr-Thr-Val-Asp-Val-Ala-Asp
Arg-Gly-Tyr-Thr-Leu-Asn-Ile-Arg-Phe-Ala
Gly-Gly-Gly-Gly-Gly-Cys-Ala-Asp-Asp-Asp
Asp-Asp-Asp-His-His-His-His-His-His

[10] An immobilization carrier on which a protein having an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 of any one of [1] to [9] is adsorbed by electrostatic interaction.
[11] The sulfhydryl group of the only cysteine residue present in the protein of any one of [1] to [9] is converted to a thiocyano group and allowed to act on an immobilized carrier having a primary amine as a functional group. Thus, a method for producing an immobilized protein, wherein an amino acid sequence portion present on the amino terminal side of a cysteine residue in the protein is bound to the immobilization carrier by an amide bond.

[12] The sulfhydryl group of the only cysteine residue present in the protein of any one of [1] to [9] is converted to a thiocyano group, and the carrier is an arbitrary immobilization carrier having a primary amine as a functional group. A protein-immobilized carrier characterized by binding an amino acid sequence portion present on the amino terminal side of a cysteine residue in the protein by an amide bond.

[13] The protein according to [12], wherein the carboxy terminus of a protein having the following sequence (SEQ ID NO: 4) is bonded to an immobilization carrier having a primary amine as a functional group by an amide bond. Immobilized support for immobilization.
Ala-Asp-Asn-Asn-Phe-Asn-Arg-Glu-Gln-Gln-
Asn-Ala-Phe-Tyr-Glu-Ile-Leu-Asn-Met-Pro-
Asn-Leu-Asn-Glu-Glu-Gln-Arg-Asn-Gly-Phe-
Ile-Gln-Ser-Leu-Arg-Asp-Asp-Pro-Ser-Gln-
Ser-Ala-Asn-Leu-Leu-Ser-Glu-Ala-Arg-Arg-
Leu-Asn-Glu-Ser-Gln-Ala-Pro-Gly-Gly-Gly-
Gly-Gly

[14] The protein according to [12], wherein the carboxy terminus of a protein having the following sequence (SEQ ID NO: 5) is bonded to an immobilization carrier having a primary amine as a functional group by an amide bond. Immobilized support for immobilization.
Ala-Tyr-Arg-Leu-Ile-Leu-Asn-Gly-Arg-Thr-
Leu-Arg-Gly-Glu-Thr-Thr-Thr-Glu-Ala-Val-
Asp-Ala-Ala-Thr-Ala-Glu-Arg-Val-Phe-Arg-
Gln-Tyr-Ala-Asn-Asp-Asn-Gly-Val-Asp-Gly-
Glu-Trp-Thr-Tyr-Asp-Asp-Ala-Thr-Arg-Thr-
Phe-Thr-Val-Thr-Glu-Arg-Pro-Glu-Val-Ile-
Asp-Ala-Ser-Glu-Leu-Thr-Pro-Ala-Val-Thr-
Gly-Gly-Gly-Gly

[15] The protein according to [12], wherein the carboxy terminus of the protein represented by the following sequence (SEQ ID NO: 6) is bonded to an immobilization carrier having a primary amine as a functional group by an amide bond. An immobilization carrier on which is immobilized.
Ala-Thr-Ile-Arg-Ala-Asn-Leu-Ile-Tyr-Ala-
Asp-Gly-Arg-Thr-Gln-Thr-Ala-Glu-Phe-Arg-
Gly-Thr-Phe-Glu-Glu-Ala-Thr-Ala-Glu-Ala-
Tyr-Arg-Tyr-Ala-Asp-Leu-Leu-Ala-Arg-Glu-
Asn-Gly-Arg-Tyr-Thr-Val-Asp-Val-Ala-Asp-
Arg-Gly-Tyr-Thr-Leu-Asn-Ile-Arg-Phe-Ala-
Gly-Gly-Gly-Gly-Gly

[16] A method for designing a protein comprising an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 used for immobilizing a protein comprising an amino acid sequence represented by R1-R2 on an immobilization carrier A method comprising selecting the amino acid sequences of the R1, R2, R3, R4 and R5 moieties to meet the following conditions:
(a) as a sequence of the R1 portion, a sequence of the protein to be immobilized, which is characterized by not containing lysine residues and cysteine residues;
(b) a spacer sequence composed of amino acid residues other than lysine and cysteine residues is selected if the R2 portion sequence is not present or present;
(c) as a sequence of the R3 portion, a sequence composed of two amino acids represented by cysteine-X (X is an amino acid residue other than lysine or cysteine) is selected;
(d) The sequence of the R4 portion is not present, or if present, is a sequence that does not contain lysine residues and cysteine residues, and consists of an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 Selecting a sequence characterized by containing acidic amino acid residues that can bring the isoelectric point of the whole protein to the acidic side; and
(e) An affinity tag sequence for purifying the protein is selected as the sequence of the R5 portion.

[17] The sequence of R1 is represented by PQ,
The sequence of the P moiety may or may not be present, and if present, is a sequence composed of (Ser or Ala)-(Gly) n (n is an arbitrary integer from 1 to 10), and Q The partial sequence is a sequence of a protein having a repeating unit, and is a sequence obtained by repeating a sequence unit that does not contain a lysine residue and a cysteine residue. The general formula R1 of [1] -A protein consisting of an amino acid sequence represented by R2-R3-R4-R5, which is used to immobilize the moiety represented by R1-R2 on an immobilization carrier.

[18] In the amino acid sequence represented by PQ, the repeat unit of the Q moiety is the amino acid sequence of a protein derived from nature, or all lysine residues and cysteine residues in the amino acid sequence, and lysine residues and cysteine residues. A protein comprising an amino acid sequence modified to an amino acid sequence not containing a lysine residue and a cysteine residue, obtained by substitution with an amino acid residue other than a group, and having a function equivalent to that of the naturally derived protein A protein comprising the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 of [17], wherein the protein is an amino acid sequence of the protein.

[19] The general formula [17], wherein in the amino acid sequence represented by the general formula R1-R2-R3-R4-R5, the sequence of the R2 portion is a sequence consisting of 0 to 10 glycines. A protein comprising an amino acid sequence represented by the formula R1-R2-R3-R4-R5.

[20] In the amino acid sequence represented by the general formula R1-R2-R3-R4-R5, the sequence of the R4 portion has 0 to 10 amino acid residues consisting of two types of amino acid residues, aspartic acid and glutamic acid. A protein comprising the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 of [17], characterized by being a sequence.

[21] The amino acid sequence represented by the general formula R1-R2-R3-R4-R5 is characterized in that the sequence of the R5 portion is an amino acid sequence consisting of 4 or more histidine residues, [17] A protein comprising an amino acid sequence represented by the general formula R1-R2-R3-R4-R5.

[22] The protein according to any one of [17] to [21], wherein in the amino acid sequence represented by P-Q, the repeating unit sequence of the Q portion has a function of specifically interacting with an antibody molecule.

[23] In the amino acid sequence represented by the general formula R1-R2-R3-R4-R5, the sequence of the R1 portion is represented by PQ,
P = Ser-Gly-Gly-Gly-Gly
Q = (Ala-Asp-Asn-Asn-Phe-Asn-Arg-Glu-Gln-Gln-
Asn-Ala-Phe-Tyr-Glu-Ile-Leu-Asn-Met-Pro-
Asn-Leu-Asn-Glu-Glu-Gln-Arg-Asn-Gly-Phe-
Ile-Gln-Ser-Leu-Arg-Asp-Asp-Pro-Ser-Gln-
Ser-Ala-Asn-Leu-Leu-Ser-Glu-Ala-Arg-Arg-
Leu-Asn-Glu-Ser-Gln-Ala-Pro-Gly) n (n is any integer from 2 to 5)
R2 = Gly-Gly-Gly-Gly
R3 = Cys-Ala
R4 = Asp-Asp-Asp-Asp-Asp-Asp
R5 = His-His-His-His-His-His
The protein according to any one of [17] to [22], wherein

[24] In the amino acid sequence represented by the general formula R1-R2-R3-R4-R5, the sequence of the R1 portion is represented by PQ,
P = does not exist
Q = (Ala-Tyr-Arg-Leu-Ile-Leu-Asn-Gly-Arg-Thr-
Leu-Arg-Gly-Glu-Thr-Thr-Thr-Glu-Ala-Val-
Asp-Ala-Ala-Thr-Ala-Glu-Arg-Val-Phe-Arg-
Gln-Tyr-Ala-Asn-Asp-Asn-Gly-Val-Asp-Gly-
Glu-Trp-Thr-Tyr-Asp-Asp-Ala-Thr-Arg-Thr-
Phe-Thr-Val-Thr-Glu-Arg-Pro-Glu-Val-Ile-
Asp-Ala-Ser-Glu-Leu-Thr-Pro-Ala-Val-Thr-Pro-Gly) n (n is any integer from 2 to 5)
R2 = Gly-Gly-Gly-Gly
R3 = Cys-Ala
R4 = Asp-Asp-Asp-Asp-Asp-Asp
R5 = His-His-His-His-His-His
The protein according to any one of [17] to [22], wherein

[25] In the amino acid sequence represented by the general formula R1-R2-R3-R4-R5, the sequence of the R1 moiety is represented by PQ,
P = does not exist
Q = (Ala-Thr-Ile-Arg-Ala-Asn-Leu-Ile-Tyr-Ala
Asp-Gly-Arg-Thr-Gln-Thr-Ala-Glu-Phe-Arg
Gly-Thr-Phe-Glu-Glu-Ala-Thr-Ala-Glu-Ala
Tyr-Arg-Tyr-Ala-Asp-Leu-Leu-Ala-Arg-Glu
Asn-Gly-Arg-Tyr-Thr-Val-Asp-Val-Ala-Asp
Arg-Gly-Tyr-Thr-Leu-Asn-Ile-Arg-Phe-Ala
Pro-Gly-) n (n is any integer from 2 to 5)
R2 = Gly-Gly-Gly-Gly
R3 = Cys-Ala
R4 = Asp-Asp-Asp-Asp-Asp-Asp
R5 = His-His-His-His-His-His
The protein according to any one of [17] to [22], wherein

[26] An immobilization carrier on which a protein having an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 of any one of [17] to [22] is adsorbed by electrostatic interaction.

[27] The sulfhydryl group of the only cysteine residue present in the protein of any one of [17] to [22] is converted to a thiocyano group and allowed to act on an immobilized carrier having a primary amine as a functional group. Thus, a method for producing an immobilized protein, wherein an amino acid sequence portion present on the amino terminal side of a cysteine residue in the protein is bound to the immobilization carrier by an amide bond.

[28] The sulfhydryl group of the only cysteine residue present in the protein of any one of [17] to [22] is converted to a thiocyano group, and an arbitrary immobilization carrier having a primary amine as a functional group An immobilization carrier on which a protein is immobilized, wherein an amino acid sequence portion present on the amino terminal side of a cysteine residue in the protein is bound by an amide bond by acting.

  Since naturally derived proteins are composed of 20 types of amino acid residues including cysteine and lysine, sequences that do not contain cysteine and lysine at all as biological amino acid residues, such as protein- Whether or not to retain protein-specific recognition / binding function, protein-nucleic acid-specific recognition / binding function, catalytic function, etc. was unclear. The present invention has revealed that a protein modified so as not to contain cysteine and lysine can have a function equivalent to that of the original natural protein.

  According to the present invention, an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 is designed, a protein comprising the amino acid sequence is prepared and used for immobilization. Can be produced quickly and efficiently. By selecting R1, R2, R3, R4 and R5 so as to satisfy the conditions of each part, it is possible to immobilize all proteins by controlling their orientation. In addition, by using a common sequence as R5 used for purification of the designed and produced protein, the protein for immobilization can be purified by a common method regardless of the sequence of R1 that is the target protein for immobilization. Also, the reaction conditions for immobilization can be made common.

  Further, in the sequence represented by R1-R2-R3-R4-R5, R1 is a sequence composed of two parts represented by PQ, and the P part may or may not be present. The sequence is a sequence of (Ser or Ala)-(Gly) n (n is an arbitrary integer from 1 to 10), and the sequence of the Q portion is a protein sequence having a repeating unit. By making a sequence in which sequence units not containing lysine residues and cysteine residues are repeated, a plurality of functions exhibited by the sequence can be exerted on a single polypeptide chain, and an effect of enhancing the function can be obtained. .

Hereinafter, the present invention will be described in detail.
The protein for immobilization comprising an amino acid sequence including the amino acid sequence of the protein to be immobilized, which is suitable for the orientation control immobilization of the protein of the present invention, is represented by the general formula R1-R2-R3-R4-R5. It is a protein expressed by a protein consisting of the represented amino acid sequence. In the formula, the sequence represents an amino acid sequence from the amino terminal side to the carboxy terminal side, the sequence of the R1 portion is an amino acid sequence of an arbitrary protein to be immobilized, and in this sequence, lysine It is a sequence characterized by not containing any residues and cysteine residues. The sequence of the R2 portion is an arbitrary spacer sequence composed of amino acid residues other than lysine and cysteine residues. The R2 moiety may not be present. The sequence of the R3 portion is a sequence composed of two amino acids represented by cysteine-X (X is an amino acid residue other than lysine and cysteine). The sequence of the R4 part is an arbitrary sequence that does not contain any lysine residue and cysteine residue, and includes an acidic amino acid residue that can make the isoelectric point of the entire sequence of R1-R2-R3-R4-R5 acidic. It is the arrangement | sequence characterized by. The R4 portion may not be present. The sequence of the R5 portion is an arbitrary affinity tag sequence that can bind to a specific compound, and is a sequence characterized by containing, for example, 4 or more histidine residues.

  In the protein comprising the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 of the present invention, the sequence of the R1 portion is the amino acid sequence of the protein to be immobilized to be immobilized, and this sequence Among them, the sequence is characterized by not containing lysine residues and cysteine residues at all. The number of amino acids in the R1 portion is not limited, and an amino acid sequence consisting of any number of amino acids can be selected according to the purpose. The sequence of the R1 portion may be a partial amino acid sequence of the amino acid sequence of the protein to be immobilized, and a protein fragment comprising the amino acid sequence may be a partial amino acid sequence having a function / activity equivalent to that of the protein. In this case, R1 is, for example, an amino acid sequence of a functional domain having a function of the protein to be immobilized.

  In the case of the present invention, the R1 portion has the intended function. In addition, lysine residues having a cysteine residue and a primary amine group in the side chain because a cysteine residue is required only for the R3 portion for the immobilization reaction, and a primary amine is used as a functional group for the carrier. Is inappropriate as an amino acid residue constituting the R1 moiety.

  Further, in the sequence represented by R1-R2-R3-R4-R5, R1 can be a sequence composed of two parts represented by PQ. In this case, the sequence of the P portion is a sequence represented by (Ser or Ala)-(Gly) n (n is an arbitrary integer from 1 to 10), and the sequence of the Q portion is a protein having a repeating unit. This is a sequence in which sequence units not containing lysine residues and cysteine residues are repeated. The number of repetitions is not limited, but is preferably 2-5.

  Naturally derived proteins are usually composed of 20 amino acid residues including lysine residues and cysteine residues. When the R1 moiety responsible for the target function contains a lysine residue or a cysteine residue, the lysine residue and the cysteine residue are 18 amino acids other than lysine and cysteine while retaining the function of the original natural protein. It is necessary to replace one of them.

  The present inventors have already established a method for producing a protein containing no cysteine and methionine (Patent Republication 01/000797, M. Iwakura et al. J. Biol. Chem. 281, 13234). -13246 (2006), JP 2005-058059 A). A protein comprising an amino acid sequence composed of 18 types of amino acids that does not contain cysteine and lysine residues by converting the amino acid sequence based on the amino acid sequence of a naturally derived protein by the same method as these methods. A protein that exhibits the same function as a natural protein can be produced. The outline of this method is as follows.

1. For each cysteine residue part and lysine residue part in the natural sequence, one amino acid substitution is performed comprehensively, and the function is examined.
2. Using the top 3 mutations in the order of the function of the single amino acid substitution mutant in each residue part, except for the mutation substituted with cysteine or lysine, the combination mutation is performed, and the top 3 A combination mutation is selected and the top three mutations in one amino acid substitution mutation at another site, except for a mutation substituted with cysteine or lysine, are excluded.
3. This operation is repeated until all cysteine residue parts and lysine residue parts are replaced with other amino acids.

  More specifically, it is performed as follows.

  It is assumed that there are n lysine and cysteine residues in a natural protein consisting of m amino acids in total length. The position on each amino acid sequence is Ai (i = 1 to n).

  The resulting mutation is denoted A1 / MA1.

  Regarding lysine and cysteine residues of Ai (i = 2 to n) at other sites, codons encoding lysine and cysteine residues are codons encoding the above-mentioned “other amino acids other than lysine and cysteine” (maximum 18 types). A mutant gene substituted with is prepared, and the enzyme activity of the double mutant enzyme protein obtained by expressing it is examined.

  When the activity of the double mutant is examined, a mutant exhibiting an activity equal to or higher than that of the natural protein is found. Select a maximum of 3 double mutants from those with high activity among double mutations.

  Next, triple mutants were prepared by substituting the lysine and cysteine residues of A3 of each of the obtained double mutants with amino acids other than lysine and cysteine residues (maximum 18 types) (maximum, 3 × 18 = 54 species), and the enzyme activity is examined.

  When the activity of the triple mutant is examined, a mutant showing an activity equal to or higher than that of the natural protein is found.

  Similarly, quadruple,..., N-fold mutants are prepared. The last n-fold mutant is a protein that does not contain the desired lysine and cysteine residues.

  By this operation, a protein having at least a function equivalent to that of the original natural protein can be obtained. “Function equivalent to the function of the original natural protein” means that the activity of the protein whose sequence has been modified is not qualitatively changed from that of the original natural protein and is not significantly reduced in quantity. . For example, if the original natural protein is an enzyme that catalyzes a specific reaction, the sequence-modified protein also has an enzymatic activity that catalyzes the same reaction, or the original natural protein binds to a specific antigen. In the case of an antibody, it means that a protein having a modified sequence also has activity as an antibody that can bind to the same antigen. The activity of the protein whose amino acid sequence has been altered is 10% or more, preferably 50% or more, more preferably 75% or more, still more preferably 90% or more, particularly preferably 100% or more of the activity of the original natural protein. For example, in the case of an enzyme, the activity is represented by a specific activity, and in the case of a protein having the ability to bind to another substance such as an antibody, the activity is represented by a binding ability. These activity measuring methods can be appropriately selected depending on the protein.

  As shown in the examples below, when converted to a sequence containing no cysteine and lysine residues based on the partial sequences of separate natural proteins having a binding function to the antibody molecule, the converted partial sequence is: It was shown to have a function equivalent to the function of the partial sequence derived from the natural protein. This is a protein consisting of an amino acid sequence modified to be composed of 18 amino acids that do not contain cysteine and lysine residues based on the amino acid sequence of a natural protein having a specific function, and exists naturally This indicates that there is a protein having a function equivalent to the function exhibited by the protein, and shows the generality of the present invention that the present invention can be applied to any protein. In addition, it is predicted that a protein having a target function can be produced by de novo design, which is a technique for artificially designing and synthesizing a protein from an amino acid sequence. It has been shown that functional proteins can be produced by limiting the de novo design method to use only 18 amino acids that do not contain cysteine and lysine residues. Furthermore, not only the amino acid sequence of a naturally derived protein is modified, but also the possibility of newly designing and producing a functional protein having a specific function that can be used as the R1 portion of the present invention is suggested.

  Examples of R1 portion proteins include proteins having enzyme activity and proteins capable of binding to antibody molecules. Proteins having binding ability to antibody molecules include protein A derived from Staphylococcus aureus (described in A. Forsgren and J. Sjoquist, J. Immunol. (1966) 97, 822-827.), Streptococus sp. Group C / G Protein G derived from European Patent Application Publication No. 1173316148515_0 (1983), Protein L derived from Peptostreptococcus magnus (described in US Pat. No. 5,965,390 (1992)), Protein H derived from group A Streptococcus ( US Patent No. 5808810 (described in 1993), Protein D derived from Haemophilus influenzae (described in US Patent No. 6025484 (1990)), Protein Arp derived from Streptococcus AP4 (Protein Arp 4) (US Patent No. No. 5210183 (1987), Streptococcal FcRc derived from group C Streptococcus (described in US Pat. No. 4900660 (1985)), protein derived from group A streptococcus, Type II strain (US Pat. No. 5,555,944) (1991) Described), a protein derived from Human Colonic Mucosal Epithelial Cell (described in US Pat. No. 6,271,362 (1994)), a protein derived from Staphylococcus aureu, strain 8325-4 (described in US Pat. No. 6,486,839 (1997)) And proteins derived from Pseudomonas maltophilia (described in US Pat. No. 5,245,016 (1991)) are known.

The sequence shown in Example 1 described later is the following sequence derived from the A domain of protein A derived from Staphylococcus (SEQ ID NO: 7),
Ala-Asp-Asn-Asn-Phe-Asn-Lys-Glu-Gln-Gln-
Asn-Ala-Phe-Tyr-Glu-Ile-Leu-Asn-Met-Pro-
Asn-Leu-Asn-Glu-Glu-Gln-Arg-Asn-Gly-Phe-
Ile-Gln-Ser-Leu-Lys-Asp-Asp-Pro-Ser-Gln-
Ser-Ala-Asn-Leu-Leu-Ser-Glu-Ala-lys-lys-
Leu-Asn-Glu-Ser-Gln-Ala-Pro-Lys
(Originally does not contain cysteine residues). By modifying this, a protein that does not contain a cysteine residue and a lysine residue and has an IgG binding activity equivalent to the immunoglobulin G (IgG) binding activity of a protein consisting of the above amino acid sequence derived from nature can be obtained. It was shown that

The sequence shown in Example 2 described below is the following sequence derived from the G1 domain of Streptococcus protein G (SEQ ID NO: 8),
Thr-Tyr-Lys-Leu-Ile-Leu-Asn-Gly-Lys-Thr-
Leu-Lys-Gly-Glu-Thr-Thr-Thr-Glu-Ala-Val-
Asp-Ala-Ala-Thr-Ala-Glu-Lys-Val-Phe-Lys-
Gln-Tyr-Ala-Asn-Asp-Asn-Gly-Val-Asp-Gly-
Glu-Trp-Thr-Tyr-Asp-Asp-Ala-Thr-Lys-Thr-
Phe-Thr-Val-Thr-Glu-Arg-Pro-Glu-Val-Ile-
Asp-Ala-Ser-Glu-Leu-Thr-Pro-Ala-Val-Thr
(Originally does not contain cysteine residues). By modifying this, it is shown that a protein that does not contain cysteine residues and lysine residues and has an IgG binding activity equivalent to the IgG binding activity of a protein comprising the above-mentioned amino acid sequence derived from nature can be obtained. It was.

The sequence shown in Example 3 below is the sequence derived from the B1 domain of protein L derived from Peptostreptococcus (SEQ ID NO: 9) shown below.
Val-Thr-Ile-Lys-Ala-Asn-Leu-Ile-Tyr-Ala-
Asp-Gly-Lys-Thr-Gln-Thr-Ala-Glu-Phe-Lys-
Gly-Thr-Phe-Glu-Glu-Ala-Thr-Ala-Glu-Ala-
Tyr-Arg-Tyr-Ala-Asp-Leu-Leu-Ala-Lys-Glu-
Asn-Gly-Lys-Tyr-Thr-Val-Asp-Val-Ala-Asp-
Lys-Gly-Tyr-Thr-Leu-Asn-Ile-Lys-Phe-Ala-
(Originally does not contain cysteine residues). By modifying this, it is shown that a protein that does not contain cysteine residues and lysine residues and has an IgG binding activity equivalent to the IgG binding activity of a protein comprising the above-mentioned amino acid sequence derived from nature can be obtained. It was.

  As a method for mutating the amino acid sequence of a natural protein, a random mutation method is usually used in many cases, and a phage display method is often used as a function selection. However, as long as such a method is used, the possibility of obtaining a modified protein having an amino acid sequence that does not contain cysteine and lysine residues and having the function of a natural protein is extremely low. A sequence corresponding to the R1 portion cannot be obtained. The sequence corresponding to the R1 portion of the present invention is made possible by the above method developed by the present inventors.

  Furthermore, when the sequence of the R1 part is a two-part sequence represented by PQ, the sequence of the P part is a sequence represented by (Ser or Ala)-(Gly) n (n is an arbitrary number from 1 to 10) For example, Ser-Gly-Gly-Gly-Gly (SEQ ID NO: 23). The sequence of the Q portion is a protein sequence having a repeating unit, which is a sequence in which sequence units not containing lysine residues and cysteine residues are repeated. Examples thereof include the sequences described below.

In Example 5 described later, the sequence derived from the A domain of protein A derived from Staphylococcus as shown below was modified so as not to contain lysine residues and cysteine residues. A protein having a partial sequence.
(Ala-Asp-Asn-Asn-Phe-Asn-Arg-Glu-Gln-Gln-
Asn-Ala-Phe-Tyr-Glu-Ile-Leu-Asn-Met-Pro-
Asn-Leu-Asn-Glu-Glu-Gln-Arg-Asn-Gly-Phe-
Ile-Gln-Ser-Leu-Arg-Asp-Asp-Pro-Ser-Gln-
Ser-Ala-Asn-Leu-Leu-Ser-Glu-Ala-Arg-Arg-
Leu-Asn-Glu-Ser-Gln-Ala-Pro-Gly) n (n is an arbitrary integer from 2 to 5, and the sequence in parentheses is SEQ ID NO: 24)
By using a repetitive sequence, an IgG binding activity far superior to the IgG binding activity exhibited by a protein having no repeats was shown.

In Example 6 described later, the sequence derived from the G1 domain of protein G derived from Streptococcus as shown below was modified so that it did not contain lysine residues and cysteine residues. It is a protein possessed as a sequence.
(Ala-Tyr-Arg-Leu-Ile-Leu-Asn-Gly-Arg-Thr-
Leu-Arg-Gly-Glu-Thr-Thr-Thr-Glu-Ala-Val-
Asp-Ala-Ala-Thr-Ala-Glu-Arg-Val-Phe-Arg-
Gln-Tyr-Ala-Asn-Asp-Asn-Gly-Val-Asp-Gly-
Glu-Trp-Thr-Tyr-Asp-Asp-Ala-Thr-Arg-Thr-
Phe-Thr-Val-Thr-Glu-Arg-Pro-Glu-Val-Ile-
Asp-Ala-Ser-Glu-Leu-Thr-Pro-Ala-Val-Thr-Pro-Gly) n (n is an arbitrary integer from 2 to 5, and the sequence in parentheses is SEQ ID NO: 25)
By using a repetitive sequence, an IgG binding activity far superior to the IgG binding activity exhibited by a protein having no repeats was shown.

In Example 7 described below, the sequence derived from the B1 domain of protein L derived from Peptostreptococcus, shown below, was modified so that it does not contain lysine residues and cysteine residues. It is a protein possessed as a sequence.
(Ala-Thr-Ile-Arg-Ala-Asn-Leu-Ile-Tyr-Ala
Asp-Gly-Arg-Thr-Gln-Thr-Ala-Glu-Phe-Arg
Gly-Thr-Phe-Glu-Glu-Ala-Thr-Ala-Glu-Ala
Tyr-Arg-Tyr-Ala-Asp-Leu-Leu-Ala-Arg-Glu
Asn-Gly-Arg-Tyr-Thr-Val-Asp-Val-Ala-Asp
Arg-Gly-Tyr-Thr-Leu-Asn-Ile-Arg-Phe-Ala
Pro-Gly-) n (n is an arbitrary integer from 2 to 5, and the sequence in parentheses is SEQ ID NO: 26)
By using a repetitive sequence, an IgG binding activity far superior to the IgG binding activity exhibited by a protein having no repeats was shown.

  The R2 portion is an arbitrary spacer sequence composed of amino acid residues other than lysine and cysteine residues, and the sequence is immobilized together with the R1 portion on an immobilization carrier. The R2 moiety is characterized by not containing any lysine and cysteine residues. In general, when a protein is immobilized, a protein to be immobilized having a specific function is immobilized. When only the protein is immobilized, the function of the immobilized protein may be inhibited due to steric hindrance with the immobilization carrier. In the case of the present invention, the R2 portion plays a role as an appropriate linker that prevents the function of the R1 portion from being inhibited by the binding to the immobilization carrier during immobilization. The role as a linker is to maintain an appropriate distance between the protein having a specific function of the R1 portion and the immobilization support. Therefore, the R2 portion is required to be an arbitrary amino acid sequence having a certain length and inert.

  In the present invention, only the R3 portion requires a unique cysteine residue for the immobilization reaction. Further, a primary amine is used as a functional group for binding the immobilization carrier and the immobilization protein. Therefore, a lysine residue having a primary amine group in the side chain is inappropriate as an amino acid residue constituting the linker. Therefore, the amino acid residues constituting the R2 moiety must be composed of 18 amino acid residues other than cysteine and lysine residues. In addition, even if the R1 portion is directly bound to the immobilization support, the R2 portion may not be present if the function of the protein of the R1 portion is not inhibited. In this case, the above general formula is R1-R3-R4- It can also be represented by R5. The number of amino acids in the R2 moiety is not limited, but is 0, ie not present, or 1-10 amino acids, preferably 2-5 amino acids. Examples of the sequence of the R2 portion include polyglycine composed of 0 to 10 or 2 to 5 glycines. In the examples described later, an example using the glycine linkage as the simplest amino acid, R2 = Gly-Gly-Gly-Gly (SEQ ID NO: 16), is shown, but the present invention is not limited to this.

  The protein consisting of the amino acid sequence represented by the above general formula R1-R2-R3-R4-R5 has the characteristic that it has a unique cysteine residue only in the R3 sequence portion. Therefore, the SH group, which is a functional group on the side chain of this cysteine residue, is cyanated to change to a cyanocysteine residue, and the reaction between the cyanocysteine residue and the primary amine on the immobilization support is performed. Only the portion represented by R1-R2 of the amino acid sequence represented by the above general formula R1-R2-R3-R4-R5 can be immobilized on the immobilization support by controlling the orientation. In the immobilization reaction via cyanocysteine, by including the sequence of the R4 portion, that is, a sequence rich in acidic amino acids in which the isoelectric point of the protein consisting of the entire sequence is acidic, the general formula R1-R2-R3- The entire protein consisting of the amino acid sequence represented by R4-R5 can be negatively charged. As a result, the protein can be rapidly adsorbed and bonded to the immobilized carrier having a positively charged primary amine by electrostatic interaction. Then, the subsequent cyanocysteine-mediated binding reaction can be efficiently performed. As a result of the binding of the protein to the immobilization support in this way, high-density immobilization becomes possible. When the isoelectric point of the protein consisting of the amino acid sequence represented by R1-R2-R3-R5 or R1-R3-R5 excluding the R4 portion is acidic, R4 may not be present.

  Examples of the sequence of the R3 portion include an amino acid sequence consisting of two amino acids represented by cysteine-X (X is an amino acid other than lysine and cysteine). X is not limited. However, when a protein consisting of the amino acid sequence represented by R1-R2 is immobilized using a polypeptide consisting of the amino acid sequence of the general formula R1-R2-R3-R4-R5 of the present invention, the cysteine in the R3 portion is cyano. Cysteinylated. In this case, X is preferably alanine because an amino acid next to cyanocysteine is changed to alanine so that an amide bond forming reaction via a cyanocysteine residue is likely to occur. For the discovery of the binding reaction via cyanocysteineation and the analysis of the reaction, see, for example, T. Takenawa, et al. (1998) J. Biochem. 123, 1137-1144 and Y. Ishihama et al. (1999) Tetrahedron Lett. 40,3415-3418.

  The R4 portion is preferably a sequence containing an acidic amino acid residue that can bring the isoelectric point of the entire protein consisting of the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 to the acidic side. Here, “a sequence containing an acidic amino acid residue capable of bringing the isoelectric point of the entire protein to the acidic side” means a sequence in which the types and number of acidic amino acids are included only to make the isoelectric point of the entire protein acidic. Say. As the R4 moiety, a sequence containing a large amount of aspartic acid and glutamic acid is preferable. The isoelectric point of a protein depends on the type and number of amino acids constituting it. For example, when many basic amino acids such as lysine and arginine are contained, aspartic acid and glutamic acid exceeding the total number of basic amino acids are required. Calculation of the isoelectric point of a protein can be easily estimated by those skilled in the art. Preferably, if a sequence containing a large amount of aspartic acid or glutamic acid is designed so that the isoelectric point of the protein comprising the amino acid sequence of the general formula R1-R2-R3-R4-R5 is a value between 4 and 5. Good. The number of amino acids in the sequence of the R4 portion is not limited, but is 0, ie, not present, or 1 to 20, preferably 1 to 10, alternatively 0 to 20, preferably 0 to 10. For example, polyaspartic acid composed of 2 to 10 aspartic acids can be mentioned.

  The R5 portion is a sequence portion used for purifying a synthesized protein having an amino acid sequence represented by the general formula R1-R2-R3-R4-R5. Examples of the sequence of the R5 portion include a sequence that can bind to a specific compound, that is, an affinity tag sequence. When a protein containing the tag is purified using an antibody specific to the tag, it may be referred to as an epitope tag. Examples of the affinity tag sequence include a polyhistidine sequence comprising 2 to 12, preferably 4 or more, more preferably 4 to 7, more preferably 5 or 6 histidines. In this case, the polypeptide can be purified by using nickel chelate column chromatography using nickel as a ligand. It can also be purified by affinity chromatography using a column in which an antibody against polyhistidine is immobilized as a ligand. In addition, HAT tags and HN tags composed of sequences containing histidine can also be used. Examples of the tag of the R5 portion and a ligand used for affinity chromatography are shown below, but are not limited thereto, and any known affinity tag (epitope tag) can be used. Other affinity tags include V5 tag, Xpress tag, AU1 tag, T7 tag, VSV-G tag, DDDDK tag, S tag, CruzTag09, CruzTag22, CruzTag41, Glu-Glu tag, Ha.11 tag, KT3 tag, etc. .

R5 part tag Ligand Glutathione-S-transferase (GST) Glutathione Maltose binding protein (MBP) Amylose
HQ tag (HQHQHQ; SEQ ID NO: 17) Nickel
Myc tag (EQKLISEEDL; SEQ ID NO: 18) Anti-Myc antibody
HA tag (YPYDVPDYA; SEQ ID NO: 19) Anti-HA antibody
FLAG tag (DYKDDDDK; SEQ ID NO: 20) Anti-FLAG antibody

  The R3-R4-R5 sequence part is cut out and remains in the reaction solution due to the immobilization reaction using the protein consisting of the amino acid sequence represented by the general formula R1-R2-R3-R4-R5. It can be removed by an appropriate washing operation after the chemical reaction. At this time, it can be removed using an affinity tag of the R5 portion. Therefore, the characteristics of the sequence portion of R3-R4-R5 do not affect the function of the immobilized protein at all, and any sequence can satisfy the above conditions.

For example, as an example of a combination of R3, R4 and R5,
R3 ＝ Cys-Ala,
R4 = Asp-Asp-Asp-Asp-Asp-Asp (SEQ ID NO: 21),
R5 = His-His-His-His-His-His (SEQ ID NO: 22)
However, the present invention is not limited to this.

  The present invention has a general formula R1-R2-R3-R4 for immobilizing an arbitrary protein to be immobilized on an immobilization carrier according to the conditions to be satisfied by each of R1, R2, R3, R4, and R5. It also includes a method for designing and producing a protein comprising the amino acid sequence represented by -R5.

For example, the design or production method includes the following steps (a) to (e).
(a) as a sequence of the R1 portion, a sequence of the protein to be immobilized, which is characterized by not containing lysine residues and cysteine residues;
(b) a spacer sequence composed of amino acid residues other than lysine and cysteine residues is selected if the R2 portion sequence is not present or present;
(c) as a sequence of the R3 portion, a sequence composed of two amino acids represented by cysteine-X (X is an amino acid residue other than lysine or cysteine) is selected;
(d) The sequence of the R4 portion is not present, or if present, is a sequence that does not contain lysine residues and cysteine residues, and consists of an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 Selecting a sequence characterized by containing acidic amino acid residues that can bring the isoelectric point of the whole protein to the acidic side; and
(e) An affinity tag sequence for purifying the protein is selected as the sequence of the R5 portion.

  Further, when the R1 portion is represented by PQ, the sequence of the P portion is not present or, if it is present, a sequence composed of (Ser or Ala)-(Gly) n (n is any number from 1 to 10) Integer) is selected, and the sequence of the Q portion may be a protein sequence having repeating units, and a sequence in which sequence units not containing lysine residues and cysteine residues are repeated.

  A protein having an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 can be chemically synthesized based on the amino acid sequence. In addition, a DNA sequence encoding a protein consisting of an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 can be prepared by chemical synthesis or the like. In addition, a part of the gene can be produced by amplifying and separating from a naturally occurring gene using PCR and recombining it. A sequence necessary for initiation of transcription and a sequence necessary for initiation of translation are linked upstream of the DNA sequence encoding the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 thus prepared, A DNA sequence having a stop codon linked downstream is prepared, incorporated into an appropriate vector DNA, transduced into the host, and expressed in the host, and expressed by the general formula R1-R2-R3-R4-R5. The target protein consisting of the amino acid sequence can be prepared.

  The protein comprising the amino acid sequence represented by the above general formula R1-R2-R3-R4-R5 prepared in this way is used for cell-free extraction of the expression host by utilizing the sequence of the R5 portion as described above. It can be separated and purified from the liquid. At this time, by using the same sequence, for example, a polyhistidine sequence, regardless of the sequence of the R1 portion as the sequence of the R5 portion, the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 is used. A common purification and separation method can be applied to any given protein.

  The present invention relates to a protein comprising an amino acid sequence represented by the general formula R2-R3-R4-R5, which comprises linking the amino acid sequence R1 of the protein to be immobilized to be immobilized on the N-terminal side of the R2 portion. Thus, a protein capable of producing a protein having an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 is also included. Furthermore, the present invention relates to a DNA encoding an amino acid sequence represented by the general formula R2-R3-R4-R5, the protein to be immobilized (amino acid sequence R1) to be immobilized on the 5 ′ end side of the DNA. And a DNA comprising a nucleotide sequence capable of producing a DNA encoding an amino acid sequence represented by the general formula R1-R2-R3-R4-R5. The protein consisting of the amino acid sequence represented by these general formulas R2-R3-R4-R5 and the DNA encoding the amino acid sequence represented by the general formula R2-R3-R4-R5 may be any It is used as an amino acid sequence or base sequence for the production of a general-purpose immobilization protein for producing a protein consisting of the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 linked to the protein to be immobilized. be able to. In this case, since the R5 portion is common, the immobilization protein can be purified by the same method regardless of the sequence of the R1 portion.

Immobilization of a protein to be immobilized on a carrier using a protein for immobilization comprising an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 of the present invention is disclosed in Japanese Patent No. 3788828, Patent No. 2990271. No. 3047020 and Japanese Patent Laid-Open No. 2003-344396 and the like. Specifically, the cysteine residue in the R3 part of the protein consisting of the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 of the present invention is converted to cyanocysteine by cyanation, and proteins having cyanocysteine are generally used. R1 is reacted with an immobilization carrier having a primary amino group represented by the formula “NH ₂ -Y” (Y represents an arbitrary immobilization carrier) as a functional group under weakly alkaline conditions (pH 8 to 10). -R2 part is immobilized on the immobilization carrier. An R1-R2 moiety bound to an immobilization carrier is represented by R1-R2-CO-NH-Y (wherein Y has the above-mentioned meaning) and is immobilized at one carboxy terminal end of the R2 moiety. It is bound to the carrier. When the above-mentioned protein for immobilization does not contain the R2 portion, it is represented by R1-CO-NH-Y (wherein Y has the above meaning). The cyanation reaction can be performed using a cyanation reagent. As a cyanating reagent, 2-nitro-5-thiocyanobennzoic acid (NTCB) (see Y. Degani, A. Ptchornik, Biochemistry, 13, 1-11 (1974)) or 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) or the like can be used. In the method described in JP-A-2003-344396, a protein having an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 is adsorbed to an immobilization carrier, and then a cysteine residue is removed. Cyanation is performed, and the above reaction is performed, and a protein having an amino acid sequence represented by R1-R2 is immobilized on the immobilization carrier. In order to adsorb the protein to the immobilization carrier, the protein and the immobilization carrier may be reacted under neutral to weakly alkaline conditions (pH 7 to 10). In weak alkaline reaction conditions, proteins are negatively charged, while immobilized carriers are positively charged and adsorb and bind to each other by electrostatic interactions.

  The present invention also includes an immobilization carrier on which a protein having an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 is adsorbed. Protein immobilization with the R1-R2 moiety immobilized, produced by an immobilization reaction via cyanocysteine, using a protein consisting of the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 of the present invention In the immobilized carrier, there are many unreacted primary amines in the immobilized carrier portion. If lysine residues or cysteine residues are present in the immobilized protein, the remaining active amine may limit the use of the immobilized protein of the present invention. However, since the protein portion immobilized by the method of the present invention does not contain any lysine residue or cysteine residue, the surface of the carrier on which the protein is immobilized without being affected by the remaining active amine. Can be treated with a primary amine masking agent. As the masking agent, acetic anhydride, maleic anhydride and the like are suitable, but any masking agent can be used. Therefore, the present invention is not limited by the type of mask agent.

  The present invention further provides a protein comprising an amino acid sequence not containing cysteine residues and lysine residues obtained by the above-described method via an appropriate linker sequence and an immobilized carrier having a primary amino group and an amide (peptide ) Provided is an immobilized protein firmly bound by binding and a carrier on which the immobilized protein is immobilized.

  As the immobilization carrier having a primary amino group used in the present invention, any immobilization carrier having a primary amino group can be used. In the present invention, the “carrier” includes any particulate carrier, plate-like or sheet-like substrate, etc., as long as they are insoluble and capable of immobilizing proteins. “Immobilization carrier” includes “immobilization substrate”. Further, the “immobilized carrier” is sometimes referred to as “insolubilized carrier”. Commercially available carriers having primary amino groups include amino-cellulofine (sold by Seikagaku), AF-aminotoyopearl (sold by TOSOH), EAH-sepharose 4B and lysine-sepharose 4B (sold by Amersham Biosciences). ), Porus 20NH (sold by Boehringer Mannheim). Moreover, it is also possible to introduce a primary amino group into a glass bead or a glass plate using a silane compound having a primary amino group (for example, 3-aminopropylmethoxysilane) and use it.

  Furthermore, it is possible to increase the content of primary amino groups per unit volume of the carrier by introducing a polymer compound having a primary amino group as a repeating unit into the immobilization carrier (Japanese Patent Laid-Open No. 2004-345956). reference).

  For example, a cellulofine grafted with polyallylamine is known as a carrier in which a polymer compound having a primary amino group as a repeating unit is introduced into an immobilized carrier (reference paper: Ung-Jin Kim, Shigenori Kuga, Journal of Chromatography A, 946, 283-289 (2002)). In addition, CNBr-activated Sepharose FF, NHS-activated Sepharose FF, and chemically reactive carriers having primary amino groups are known, and polymer compounds having primary amino groups such as polyallylamine as repeating units. By acting, it is possible to produce a carrier in which the polymer compound is covalently bonded to the carrier. At that time, the content of the primary amino group that can be used for the immobilization reaction in the prepared carrier is changed by appropriately adjusting the mixing ratio of the polymer compound having the primary amino group in the repeating unit and the activated carrier. Can be made.

  On the other hand, the polymer compound can be used as long as it has a primary amino group and the other portion is substantially inactive to the protein to be immobilized. As the commercially available polymer compound, polyallylamine, poly L-lysine and the like can be used. Therefore, the present invention is not limited by the type of immobilization carrier.

  EXAMPLES Hereinafter, although an Example demonstrates this invention, this invention is not limited by these Examples.

  In the following examples, the following experimental methods are commonly used.

[Gene synthesis]
The synthesis of the genes described in the Examples was performed by a contracted synthetic gene manufacturer unless otherwise specified. Based on the indicated nucleotide sequence, dsDNA was synthesized and inserted into the BamHI-EcoRI site of pUC18vector, the sequence of the obtained clone was confirmed by single-strand analysis, the nucleotide sequence information was verified, and the site where mismatch was confirmed was Site directed Mutation correction was performed by a method such as mutagenesis, and the obtained plasmid DNA (about 1 microgram) was delivered. Regarding the target portion in the delivered plasmid, the sequence was confirmed again by sequencing.

[Preparation of 1 amino acid substitution mutant]
Amino acid substitution is performed by converting the DNA sequence encoding the amino acid at the substitution site into the target codon sequence, using a DNA primer having the original sequence of 24 bases on both sides and its complementary DNA primer, and using the quick change method (Stratagene The method described in QuickChang Site-directed Mutagenesis kit).

[Protein purification]
E. coli strain JM109 transformed with the recombinant plasmid was cultured overnight at 35 ° C. in 2 liters of medium (containing 20 g sodium chloride, 20 g yeast extract, 32 g tryptone, 100 mg ampicillin sodium). Thereafter, the culture broth was centrifuged at a low speed for 20 minutes (5,000 revolutions per minute) to obtain cells having a wet weight of 3 to 5 g. This was suspended in 20 ml of 10 mM phosphate buffer (pH 7.0), the cells were crushed with a French press, and then centrifuged at a high speed for 20 minutes (20,000 rotations per minute) to separate the supernatant. . Streptomycin sulfate was added to the resulting supernatant to a final concentration of 2%, stirred for 20 minutes, and then centrifuged at high speed for 20 minutes (20,000 rotations per minute) to separate the supernatant. After this, ammonium sulfate treatment was performed, and the resulting supernatant was applied to a nickel chelate column (purchased from GE Healthcare Bioscience), and a washing buffer solution (5 mM imidazole, 20 mM sodium phosphate, 0.5 M sodium chloride, pH 7 .4) using 200 ml or more, thoroughly wash the column, and after washing, apply 20 ml of elution buffer (0.5 M imidazole, 20 mM sodium phosphate, 0.5 M sodium chloride, pH 7.4) Protein was eluted. Thereafter, in order to remove imidazole from this protein solution, dialysis was performed against 5 liters of 10 mM phosphate buffer (pH 7.0). MWCO3500 (purchased from Spectrum Laboratories) was used as the dialysis membrane. After dialysis, the target protein was dried using a centrifugal vacuum dryer.

[Binding property analysis with human antibody IgG molecule]
For analysis of the binding properties of the target protein, analysis was performed using Biacore (Biacore), a surface plasmon resonance biosensor, according to the protocol provided by Biacore.

  The running buffer was composed of 10 mM HEPES (pH 7.4), 150 mM sodium chloride, 5 μM EDTA, 0.005% Surfactant P20 (Biacore) and degassed in advance.

  SensorChip NTA (Biacore) was used as the sensor chip. After sufficiently equilibrating the sensor chip with a running buffer, 5 mM nickel chloride solution was injected to complete the coordination of nickel ions. Thereafter, the recombinant protein was immobilized by injecting a recombinant protein solution (concentration of 100 μg / mL in running buffer) into the sensor chip.

For the binding reaction between the immobilized recombinant protein and human IgG, a human IgG (Sigma-Aldrich) solution diluted and prepared to 7 concentrations in the range of 0.25 to 20 μg / mL using a running buffer is used. The antibody binding / dissociation phenomenon was quantitatively observed by sequentially injecting and subsequently switching to a running buffer and holding the solution. The liquid flow rate was 20 μL / min, the binding observation time (antibody solution injection time) was 4 minutes, and the dissociation observation time was 4 minutes. After injecting each concentration of antibody solution and observing the binding / dissociation phenomenon, inject 6M guanidine hydrochloride solution for 3 minutes to dissociate all human IgG bound to the immobilized recombinant protein, Regenerated with running buffer and used for subsequent measurements.
The change over time of the mass change of the sensor surface due to the observed surface plasmon resonance is measured by the unit RU defined by Biacore, and the association rate constant (kass), dissociation rate constant (kdis) and dissociation constant (Kd = kass / kdis) )

[Immobilization of recombinant protein]
Each protein was dialyzed 3 times or more against a pH 8.0 10 mM phosphate buffer containing 1000 volumes of 5 mM ethylenediaminetetraacetic acid (EDTA) in advance, and the dialyzed protein sample was used for dialysis. Protein samples at various concentrations were prepared by diluting with the same buffer.

The immobilization protein thus prepared was mixed with aminocellulose (amine content 20 μmoles NH ₂ / ml) and gently stirred at room temperature for 2 hours or more.

  Cyanoylation of the cysteine SH group of the adsorbed protein is carried out by suspending the adsorbed and immobilized carrier in a pH 7.0 10 mM phosphate buffer containing 5 mM EDTA, so that the final concentration is 2 mM. 5-Thiocyanobenzoic acid (NTCB) was added and reacted at room temperature for 4 hours. Thereafter, the NTCB and the like were removed by repeating the operation of centrifuging at 1000 rpm for several seconds to remove the supernatant by removing the supernatant and suspending in a 10 mM phosphate buffer having a pH of 7.0.

  Cyanated adsorption-immobilized protein is centrifuged at 1000 rpm for several seconds, the carrier is submerged, the supernatant is removed, suspended in 10 mM borate buffer with pH 9.5 containing 5 mM EDTA, and gently kept at room temperature for at least 24 hours. The immobilization reaction was carried out by stirring. After that, the side reaction of the immobilization reaction is repeated by repeating the operation of centrifuging at 1000 rpm for several seconds, removing the supernatant, removing the supernatant, and suspending in 10 mM phosphate buffer with pH 8.0 containing 1 M KCl. The product was removed.

  The unreacted primary amine on the immobilization carrier was subjected to acetylation treatment with acetic anhydride. Since the immobilized protein does not contain a lysine residue, the acetylation treatment does not cause any modification other than the amino terminal acetylation. In general, since the amino terminus hardly contributes to the binding activity, it is considered that the decrease in the function of the immobilized ligand protein by this operation can be ignored.

[Measurement of IgG binding capacity of immobilized carrier]
10 μl of immobilization carrier and 990 μl of human IgG (2 mg) were mixed in 10 mM phosphate buffer at pH 7.0, gently stirred at room temperature for 12 hours, and then 10 mM phosphorus at pH 7.0 containing 2 ml of 1 M KCl. Washed 5 times with acid buffer. By measuring the absorbance at 280 nm, it was confirmed that the final washing solution contained no protein.

The release of immunoglobulin G from the carrier was performed by adding 1 ml of 0.1 M acetic acid solution to the immobilized carrier collected by centrifugation after washing. The amount of human IgG released in the solution was measured for the absorbance at 280 nm, and the absorbance coefficient (E ₂₈₀ ^1% = 14.0) was used to measure the amount of released human IgG. IgG binding capacity (mg / ml carrier) was determined by dividing by quantity.

[Example 1] Conversion of Staphylococcus-derived Protein A to a sequence containing no cysteine and lysine residues based on the sequence derived from Domain A and conversion to an immobilization sequence of Staphylococcus-derived Protein A The sequence derived from domain A is the sequence shown in SEQ ID NO: 7.

Based on the amino acid sequence shown in SEQ ID NO: 7,
Met-Ala-Asp-Asn-Asn-Phe-Asn-Lys-Glu-Gln-Gln-
Asn-Ala-Phe-Tyr-Glu-Ile-Leu-Asn-Met-Pro-
Asn-Leu-Asn-Glu-Glu-Gln-Arg-Asn-Gly-Phe-
Ile-Gln-Ser-Leu-Lys-Asp-Asp-Pro-Ser-Gln-
Ser-Ala-Asn-Leu-Leu-Ser-Glu-Ala-lys-lys-
Leu-Asn-Glu-Ser-Gln-Ala-Pro-Gly-Gly-Gly-
Gly-Gly-Cys-Ala-Asp-Asp-Asp-Asp-Asp-His-
His-His-His-His-His
The following DNA sequence (SEQ ID NO: 11) is designed in a form including a transcription initiation function and a translation initiation function appropriate for the sequence encoding the amino acid sequence represented by (SEQ ID NO: 10) and a restriction enzyme sequence for incorporation into a vector, Synthesized.
GGATCCTTGA CAATATCTTA ACTATCTGTT ATAATATATT GACCAGGTTA ACTAACTAAG CAGCAAAAGG AGGAACGACT ATGGCTGATA ACAATTTCAA CAAAGAACAA CAAAATGCTT TCTATGAAAT CTTGAATATG CCTAACTTAA ACGAAGAACA ACGCAATGGT TTCATCCAAA GCTTAAAAGA TGACCCAAGC CAAAGTGCTA ACCTATTGTC AGAAGCTAAA AAGTTAAATG AATCTCAAGC ACCGAAAGGT GGCGGTGGCT GCGCTGATGA CGATGACGAT GACCATCATC ACCACCATCA TTAAGAATTC C
pPAA is obtained by inserting the sequence shown in SEQ ID NO: 11 into the BamHI-EcoRI site of pUC18vector.

Proteins were separated and purified from E. coli strain JM109 transformed with pPAA according to the method described above. As a result, the target protein was obtained with a yield of about 150 mg / 2 L culture. As a result of amino terminal sequence and mass number analysis of the obtained protein, the amino terminus was alanine, and the mass number measured using a mass analyzer of the obtained purified protein was 8,540 daltons. When a recombinant protein having a sequence of methionine-alanine as an amino-terminal sequence was expressed in E. coli, it was confirmed that the amino-terminal methionine residue corresponding to the usual start codon was processed. .
Next, regarding each lysine residue in SEQ ID NO: 7, seventh, 35th, 49th, 50th, and 58th from the amino terminus, first, mutants were prepared in which 58th was substituted with glycine. Amino acid substitution is performed by converting the AAA, which is the DNA sequence encoding the 58th lysine, to GTT and using a DNA primer having the original sequence of 24 bases on both sides and its complementary DNA primer (Stratagene) According to the method described in QuickChang Site-directed Mutagenesis kit), mutation was performed using pPAA as a template to isolate a plasmid having the desired mutation (named pPAA-K58G).

  Furthermore, for the amino acid substitution corresponding to the seventh position using pPAA-K58G as a template, a DNA primer obtained by converting a DNA encoding a lysine residue into a CGT codon and a complementary DNA thereof were synthesized and used as primers, respectively. A mutant was prepared by the quick change method to prepare a plasmid having the target mutation (named pPAA-RKKKG). Using this as a template, the 35th (named pPAA-RRKKG), then the 49th (named pPAA-RRRKG), and the 50th (named pPAA-RRRRG), lysine residues A plasmid expressing a mutant converted to a residue was prepared. The finally obtained recombinant plasmid pPAA-RRRRG consists of a sequence in which all lysine residues in the wild-type protein fragment sequence are converted to arginine or glycine (ie, the sequence shown in SEQ ID NO: 1). An expression plasmid for a protein A fragment mutant.

  E. coli transformed with the recombinant plasmid pPAA-RRRRG expresses a protein consisting of the sequence represented by SEQ ID NO: 1. The recombinant protein was uniformly purified by the operations of E. coli culture, cell disruption, pretreatment and nickel chelate column chromatography in the same manner as described above.

  Furthermore, using the recombinant plasmid pPAA-RRRRG as a template, 1 amino acid substitution was performed at the 7th, 35th, 49th, and 58th positions to produce various mutants, and the proteins were produced.

  About each obtained protein, the binding activity with human IgG was investigated using Biacore.

  The results are shown in Table 1.

All except the wild type are sequences that do not contain cysteine and lysine in the sequence derived from the A domain of protein A. As described above, it was revealed that even when the type of amino acid residue to be used is limited, it has binding activity with human IgG.
It was also found that when most of the lysine residues were changed to arginine, no significant change in binding properties was observed.

  The obtained protein was immobilized using aminocellulose (purchased from Seikagaku Corporation) as a primary amine carrier. The measurement of human IgG binding capacity exhibited by the obtained immobilized carrier is shown in Example 4.

[Example 2] Conversion of Streptococcus protein G derived from the G1 domain into a sequence not containing cysteine and lysine residues and conversion to an immobilization sequence derived from the G1 domain of Streptococcus protein G The sequence is the sequence shown in SEQ ID NO: 8.

In the above examples, it was shown that the original function was retained even when all lysine residues were replaced with arginine residues. Therefore, based on the amino acid sequence shown in SEQ ID NO: 8, a lysine residue is substituted with an arginine residue, and an initiation codon, a spacer sequence, a cysteine-alanine sequence for immobilization reaction, and a polyaspartic acid sequence And the following sequence with polyhistidine sequence added
Met-Ala-Tyr-Arg-Leu-Ile-Leu-Asn-Gly-Arg-Thr
Leu-Arg-Gly-Glu-Thr-Thr-Thr-Glu-Ala-Val
Asp-Ala-Ala-Thr-Ala-Glu-Arg-Val-Phe-Arg
Gln-Tyr-Ala-Asn-Asp-Asn-Gly-Val-Asp-Gly
Glu-Trp-Thr-Tyr-Asp-Asp-Ala-Thr-Arg-Thr
Phe-Thr-Val-Thr-Glu-Arg-Pro-Glu-Val-Ile
Asp-Ala-Ser-Glu-Leu-Thr-Pro-Ala-Val-Thr
Gly-Gly-Gly-Gly-Cys-Ala-Asp-Asp-Asp-Asp
Asp-Asp-His-His-His-His-His-His
The amino acid sequence shown by (SEQ ID NO: 12) was designed. The following DNA sequence (SEQ ID NO: 13) was designed and synthesized in a form including a transcription initiation function appropriate to the sequence encoding the amino acid sequence of SEQ ID NO: 12 and a restriction enzyme sequence for incorporation into a vector.
GGATCCTTGACAATATCTTAACTATCTGTTATAATATATTGACCAGGTTAACTACTAAGCAGCAAAAGGAGGAACGACTATGGCTTACCGTTTAATCCTTAATGGTCGTACATTGCGTGGCGAAACAACTACTGAAGCTGTTGATGCTGCTACTGCAGAACGTGTCTTCCGTCAATACGCTAACGACAACGGTGTTGACGGTGAATGGACTTACGACGATGCGACTCGTACCTTTACGGTAACTGAACGTCCTGAGGTTATTGATGCTTCGGAGCTGACTCCTGCTGTTACTGGTGGCGGTGGCTGCGCTGATGACGATGACGATGACCATCATCACCACCATCATTAAGAATTC
pPG is obtained by inserting the sequence shown in SEQ ID NO: 13 into the BamHI-EcoRI site of pUC18vector.

  Proteins were separated and purified from E. coli strain JM109 transformed with pPG according to the method described above. As a result, the target protein was obtained with a yield of about 120 mg / 2 L culture. As a result of performing amino terminal sequence and mass number analysis of the obtained protein, the amino terminal is alanine, and the mass number measured using a mass analyzer of the obtained purified protein was 9,698 daltons. When a recombinant protein having a sequence of methionine-alanine as an amino-terminal sequence was expressed in E. coli, it was confirmed that the amino-terminal methionine residue corresponding to the usual start codon was processed. .

About the obtained protein, the binding activity with human IgG was investigated using Biacore.
The results are shown in Table 2. In this table, for reference, the values of protein A mutant protein are shown for comparison.

  As shown in Table 2, strong human IgG binding activity was shown.

  The obtained protein was immobilized using aminocellulose (purchased from Seikagaku Corporation) as a primary amine carrier. The measurement of human IgG binding capacity exhibited by the obtained immobilized carrier is shown in Example 4.

[Example 3] Conversion to a sequence not containing cysteine and lysine residues based on the sequence derived from the B1 domain of protein L derived from Peptostreptococcus and to a sequence for immobilization
The sequence derived from the B1 domain of protein L derived from Peptostreptococcus is the sequence shown in SEQ ID NO: 9.

In the above examples, it was shown that the original function was retained even when all lysine residues were replaced with arginine residues. Therefore, based on the amino acid sequence shown in SEQ ID NO: 9, the lysine residue is substituted with an arginine residue, and the initiation codon, spacer sequence, cysteine-alanine sequence for immobilization reaction, and polyaspartic acid sequence And the following sequence with polyhistidine sequence added
Met-Ala-Thr-Ile-Arg-Ala-Asn-Leu-Ile-Tyr-Ala
Asp-Gly-Arg-Thr-Gln-Thr-Ala-Glu-Phe-Arg
Gly-Thr-Phe-Glu-Glu-Ala-Thr-Ala-Glu-Ala
Tyr-Arg-Tyr-Ala-Asp-Leu-Leu-Ala-Arg-Glu
Asn-Gly-Arg-Tyr-Thr-Val-Asp-Val-Ala-Asp
Arg-Gly-Tyr-Thr-Leu-Asn-Ile-Arg-Phe-Ala
Gly-Gly-Gly-Gly-Gly-Cys-Ala-Asp-Asp-Asp
Asp-Asp-Asp-His-His-His-His-His-His
Was designed (SEQ ID NO: 14). The following DNA sequence (SEQ ID NO: 15) was designed and synthesized in a form including a transcription initiation function and a translation initiation function appropriate for the sequence encoding the amino acid sequence of SEQ ID NO: 12 and a restriction enzyme sequence for incorporation into a vector.
GGATCCTTGACAATATCTTAACTATCTGTTATAATATATTGACCAGGTTAACTAACTAAGCAGCAAAAGGAGGAACGACTATGGCTACTATTCGTGCTAATCTGATTTATGCTGATGGTCGTACTCAGACTGCTGAGTTTCGTGGTACTTTTGAGGAGGCTACTGCTGAGGCTTATCGTTATGCTGATCTGCTGGCTCGTGAGAATGGTCGTTATACTGTTGATGTTGCTGATCGTGGTTATACTCTGAATATTCGTTTTGCTGGTGGTGGCGGTGGCTGCGCTGATGACGATGACGATGACCATCATCACCACCATCATTAAGAATTC
pPL is obtained by inserting the sequence shown in SEQ ID NO: 15 into the BamHI-EcoRI site of pUC18vector.

Proteins were separated and purified from E. coli strain JM109 transformed with pPL according to the method described above. As a result, the target protein was obtained with a yield of about 100 mg / 2 L culture. As a result of amino terminal sequence and mass number analysis of the obtained protein, the amino terminus was alanine, and the mass number measured using a mass analyzer of the obtained purified protein was 8,782 daltons. When a recombinant protein having a sequence of methionine-alanine as an amino-terminal sequence was expressed in E. coli, it was confirmed that the amino-terminal methionine residue corresponding to the usual start codon was processed. .
About the obtained protein, the binding activity with human IgG was investigated using Biacore.
The results are shown in Table 3. In this table, for reference, the values of protein A mutant protein are shown for comparison.

  As shown in Table 3, strong human IgG binding activity was shown.

  The obtained protein was immobilized using aminocellulose (purchased from Seikagaku Corporation) as a primary amine carrier. The measurement of human IgG binding capacity exhibited by the obtained immobilized carrier is shown in Example 4.

Example 4
Using the proteins of the amino acid sequences shown in SEQ ID NOs: 1, 2 and 3 (each about 6 mg) obtained in the above examples, they were immobilized on 1 ml of aminocellulose by a coupling reaction via cyanocysteine. . By this reaction, an immobilization support in which the sequences shown in SEQ ID NOs: 4, 5, and 6 were respectively orientation-controlled and immobilized by amide bonds and primary amino groups on aminocellulose at the carboxy terminus was prepared. When the binding capacity to human IgG was measured using the prepared immobilized carrier (10 μl), the results shown in Table 4 were obtained. Thus, it was confirmed that even when the orientation control was immobilized, the binding ability to human IgG was exhibited.

[Example 5] Production of a protein having a sequence that does not contain cysteine and lysine residues based on a sequence derived from domain A of protein A derived from Staphylococcus and measurement of its IgG binding activity To introduce a repeated sequence In addition, a gene encoding a sequence part that does not contain cysteine and lysine residues based on the sequence derived from domain A of protein A is duplicated, and newly includes a Cfr9I cleavage sequence (CCCGGG) as a restriction enzyme cleavage sequence, The DNA sequence shown below (SEQ ID NO: 27) that can be inserted into a vector by cutting with BamHI and EcoRI was designed and synthesized.
GGATCCTTGACAATATCTTAACTATCTGTTATAATATATTGACCAGGTTAACTAACTAAGCAGCAAAAGGAGGAACGACTATGTCGGGCGGTGGTGGTGCTGATAACAATTTCAACCGTGAACAACAAAATGCTTTCTATGAAATCTTGAATATGCCTAACTTAAACGAAGAACAACGCAATGGTTTCATCCAAAGCTTACGTGATGACCCAAGCCAAAGTGCTAACCTATTGTCAGAAGCTCGTCGTTTAAATGAATCTCAAGCCCCGGGTGCTGATAACAATTTCAACCGTGAACAACAAAATGCTTTCTATGAAATCTTGAATATGCCTAACTTAAACGAAGAACAACGCAATGGTTTCATCCAAAGCTTACGTGATGACCCAAGCCAAAGTGCTAACCTATTGTCAGAAGCTCGTCGTTTAAATGAATCTCAAGCACCGGGTGGTGGCGGTGGCTGCGCTGATGACGATGACGATGACCATCATCACCACCATCATTAAGAATTC (SEQ ID NO: 27)

pAAD is obtained by inserting the sequence shown in SEQ ID NO: 27 into the BamHI-EcoRI site of pUC18vector. By expressing pAAD in E. coli, in the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 having the sequence of SEQ ID NO: 24 repeated twice, the sequence of the R1 portion is represented by PQ. I was
P = Ser-Gly-Gly-Gly-Gly (SEQ ID NO: 23)
Q = (Ala-Asp-Asn-Asn-Phe-Asn-Arg-Glu-Gln-Gln-
Asn-Ala-Phe-Tyr-Glu-Ile-Leu-Asn-Met-Pro-
Asn-Leu-Asn-Glu-Glu-Gln-Arg-Asn-Gly-Phe-
Ile-Gln-Ser-Leu-Arg-Asp-Asp-Pro-Ser-Gln-
Ser-Ala-Asn-Leu-Leu-Ser-Glu-Ala-Arg-Arg-
Leu-Asn-Glu-Ser-Gln-Ala-Pro-Gly) n (n is an arbitrary integer from 2 to 5, and the sequence in parentheses is SEQ ID NO: 24)
R2 = Gly-Gly-Gly-Gly (SEQ ID NO: 16)
R3 = Cys-Ala
R4 = Asp-Asp-Asp-Asp-Asp-Asp (SEQ ID NO: 21)
R5 = His-His-His-His-His-His (SEQ ID NO: 22)
Thus, a protein represented by n = 2 was expressed. Subsequently, the protein was separated and purified according to the above-described method. As a result of performing amino terminal sequence and mass number analysis of the obtained protein, the amino terminal is serine, and the mass number measured using a mass analyzer of the purified protein is 15,545 daltons. When a recombinant protein having a sequence of methionine-serine as a terminal sequence was expressed in E. coli, it was confirmed that the amino-terminal methionine residue corresponding to the initiation codon usually found was processed.

Furthermore, in order to introduce a repetitive sequence in which n is 3 or more, the following DNA sequence having a Cfr9I cleavage sequence (CCCGGG) at both ends was synthesized (SEQ ID NO: 28).
CCCGGGTGCTGATAACAATTTCAACCGTGAACAACAAAATGCTTTCTATGAAATCTTGAATATGCCTAACTTAAACGAAGAACAACGCAATGGTTTCATCCAAAGCTTACGTGATGACCCAAGCCAAAGTGCTAACCTATTGTCAGAAGCTCGTCGTTTAAATGAATCTCAAGCCCCGGG (SEQ ID NO: 28)

  This is cleaved with Cfr9I, mixed with pAAD cleaved with Cfr9I, and ligated with T4 DNA ligase to prepare a recombinant plasmid in which one or more DNA sequences of SEQ ID NO: 28 cleaved with Cfr9I are linked. This was cut with BamHI and EcoRI and separated by agarose electrophoresis to obtain several sizes of about 0.68 kilobase pairs, about 0.86 kilobase pairs, about 1.05 kilobase pairs and larger. Each DNA fragment from which the DNA fragment could be obtained was separated from the gel and introduced into the BamHI-EcoRI site of the pUC18 vector to separate the recombinant plasmid. Plasmids introduced with DNA fragments of about 0.68 kilobase pair, about 0.86 kilobase pair, and about 1.05 kilobase pair (referred to as pAA3T, pAA4Q, and pAA5P, respectively) have portions corresponding to SEQ ID NO: 28, As a result, it was revealed that the amino acid sequence corresponding to n = 3, 4 and 5 was encoded in the Q sequence. E. coli JM109 strains transformed with recombinant plasmids pAA3T, pAA4Q, and pAA5P were shown to express and accumulate large amounts of proteins of about 22 kilodaltons, about 29 kilodaltons, and about 36 kilodaltons, respectively. .

When the base sequence of the BamHI-EcoRI site of pAA3T was examined, the following DNA sequence was revealed.
GGATCCTTGACAATATCTTAACTATCTGTTATAATATATTGACCAGGTTAACTAACTAAGCAGCAAAAGGAGGAACGACT
(SEQ ID NO: 29)

  Using E. coli strain JM109 transformed with pAA3T, the protein was separated and purified according to the method described above. As a result of performing amino terminal sequence and mass number analysis of the obtained protein, the amino terminal is serine, and the mass number measured using the mass analyzer of the obtained purified protein is 22,193 daltons. When a recombinant protein having a sequence of methionine-serine as a terminal sequence was expressed in E. coli, it was confirmed that the amino-terminal methionine residue corresponding to the initiation codon usually found was processed.

  About the obtained protein, the binding activity with human IgG was investigated using Biacore.

  The results are shown in Table 5. In this table, for reference, the value of the mutant protein represented by n = 1 is shown for comparison. It was clarified that by taking a repeated sequence, the value of the binding strength Kd with IgG was decreased and the binding strength was increased (Table 5).

[Example 6] Preparation of a protein having a sequence not containing cysteine and lysine residues based on the sequence derived from the G1 domain of protein G derived from Streptococcus and measurement of its IgG binding activity To introduce a repeated sequence, Based on the sequence derived from the G1 domain of protein G, the gene that encodes the sequence part that does not contain cysteine and lysine residues is duplicated, and a new Cfr9I cleavage sequence (CCCGGG) is included as a restriction enzyme cleavage sequence. A DNA sequence (SEQ ID NO: 30) shown below that can be inserted into a vector by cutting BamHI and EcoRI was designed and synthesized.
GGATCCTTGACAATATCTTAACTATCTGTTATAATATATTGACCAGGTTAACTAACTAAGCAGCAAAAGGAGGAACGACTATGGCTTACCGTTTAATCCTTAATGGTCGTACATTGCGTGGCGAAACAACTACTGAAGCTGTTGATGCTGCTACTGCAGAACGTGTCTTCCGTCAATACGCTAACGACAACGGTGTTGACGGTGAATGGACTTACGACGATGCGACTCGTACCTTTACGGTAACTGAACGTCCTGAGGTTATTGATGCTTCGGAGCTGACTCCTGCTGTTACTCCCGGGGCTTACCGTTTAATCCTTAATGGTCGTACATTGCGTGGCGAAACAACTACTGAAGCTGTTGATGCTGCTACTGCAGAACGTGTCTTCCGTCAATACGCTAACGACAACGGTGTTGACGGTGAATGGACTTACGACGATGCGACTCGTACCTTTACGGTAACTGAACGTCCTGAGGTTATTGATGCTTCGGAGCTGACTCCTGCTGTTACTGGTGGCGGTGGCTGCGCTGATGACGATGACGATGACCATCATCACCACCATCATTAAGAATTC (SEQ ID NO: 30)

pGGD is obtained by inserting the sequence shown in SEQ ID NO: 30 into the BamHI-EcoRI site of pUC18vector. By expressing pGGD in Escherichia coli, in the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 having the sequence represented by SEQ ID NO: 25 repeated twice, the sequence of the R1 portion is represented by PQ. I was
P = does not exist
Q = (Ala-Tyr-Arg-Leu-Ile-Leu-Asn-Gly-Arg-Thr-
Leu-Arg-Gly-Glu-Thr-Thr-Thr-Glu-Ala-Val-
Asp-Ala-Ala-Thr-Ala-Glu-Arg-Val-Phe-Arg-
Gln-Tyr-Ala-Asn-Asp-Asn-Gly-Val-Asp-Gly-
Glu-Trp-Thr-Tyr-Asp-Asp-Ala-Thr-Arg-Thr-
Phe-Thr-Val-Thr-Glu-Arg-Pro-Glu-Val-Ile-
Asp-Ala-Ser-Glu-Leu-Thr-Pro-Ala-Val-Thr-Pro-Gly) n (n is an arbitrary integer from 2 to 5, and the sequence in parentheses is SEQ ID NO: 25)
R2 = Gly-Gly-Gly-Gly (SEQ ID NO: 16)
R3 = Cys-Ala
R4 = Asp-Asp-Asp-Asp-Asp-Asp (SEQ ID NO: 21)
R5 = His-His-His-His-His-His (SEQ ID NO: 22)
Thus, a protein represented by n = 2 was expressed. Subsequently, the protein was separated and purified according to the above-described method. As a result of amino terminal sequence and mass number analysis of the obtained protein, the amino terminus is alanine, and the mass number measured using a mass analyzer of the obtained purified protein is 17,616 dalton. When a recombinant protein having a sequence of methionine-alanine as a terminal sequence was expressed in Escherichia coli, it was confirmed that the amino terminal methionine residue corresponding to the initiation codon usually found was processed.

Furthermore, in order to introduce a repetitive sequence in which n is 3 or more, the following DNA sequence having a Cfr9I cleavage sequence (CCCGGG) at both ends was synthesized (SEQ ID NO: 31).
CCCGGGGCTTACCGTTTAATCCTTAATGGTCGTACATTGCGTGGCGAAACAACTACTGAAGCTGTTGATGCTGCTACTGCAGAACGTGTCTTCCGTCAATACGCTAACGACAACGGTGTTGACGGTGAATGGACTTACGACGATGCGACTCGTACCTTTACGGTAACTGAACGTCCTGAGGTTATTGACCCTTGCGCTGACT

  This is cleaved with Cfr9I, mixed with pAAD cleaved with Cfr9I, and ligated with T4 DNA ligase to produce a recombinant plasmid in which one or more DNA sequences of SEQ ID NO: 28 cleaved with Cfr9I are linked. This was cut with BamHI and EcoRI, and separated by agarose electrophoresis to obtain several sizes of about 0.79 kilobase pairs, about 1.0 kilobase pairs, about 1.2 kilobase pairs and larger. Each DNA fragment from which the DNA fragment could be obtained was separated from the gel and introduced into the BamHI-EcoRI site of the pUC18 vector to separate the recombinant plasmid. Plasmids introduced with DNA fragments of about 0.79 kilobase pairs, about 1.0 kilobase pairs, and about 1.2 kilobase pairs (referred to as pGG3T, pGG4Q, and pGG5P, respectively) have portions corresponding to SEQ ID NO: 31, As a result, it was revealed that the amino acid sequence corresponding to n = 3, 4 and 5 was encoded in the Q sequence. E. coli JM109 strains transformed with recombinant plasmids pGG3T, pGG4Q, and pGG5P were shown to express and accumulate large amounts of proteins of about 25 kilodalton, about 33 kilodalton, and about 41 kilodalton, respectively. .

Examination of the base sequence of the BamHI-EcoRI site of pGG3T revealed the following DNA sequence.
GGATCCTTGACAATATCTTAACTATCTGTTATAATATATTGACCAGGTTAACTAACTAAGCAGCAAAAGGAGGAACGACT
(SEQ ID NO: 32)

  Using E. coli strain JM109 transformed with pGG3T, the protein was separated and purified according to the method described above. As a result of performing amino terminal sequence and mass number analysis of the obtained protein, the amino terminal is alanine, and the mass number measured using a mass analyzer of the obtained purified protein is 25,534 daltons. When a recombinant protein having a sequence of methionine-alanine as a terminal sequence was expressed in Escherichia coli, it was confirmed that the amino terminal methionine residue corresponding to the initiation codon usually found was processed.

  About the obtained protein, the binding activity with human IgG was investigated using Biacore.

  The results are shown in Table 6. In this table, for reference, the value of the mutant protein represented by n = 1 is shown for comparison. It was clarified that by taking the repeated sequence, the value of the binding force Kd with IgG became smaller and the binding force increased (Table 6).

[Example 7] Production of a protein having a sequence containing no cysteine and lysine residues based on the sequence derived from the B1 domain of protein L derived from Peptostreptococcus and measurement of its IgG binding activity To introduce a repeated sequence, Based on the sequence derived from the domain B1 of protein L, the gene that encodes the sequence part that does not contain cysteine and lysine residues is duplicated, and a new Cfr9I cleavage sequence (CCCGGG) is included as a restriction enzyme cleavage sequence. A DNA sequence (SEQ ID NO: 33) shown below that can be inserted into a vector by cutting with BamHI and EcoRI was designed and synthesized.
GGATCCTTGACAATATCTTAACTATCTGTTATAATATATTGACCAGGTTAACTAACTAAGCAGCAAAAGGAGGAACGACTATGGCTACTATTCGTGCTAATCTGATTTATGCTGATGGTCGTACTCAGACTGCTGAGTTTCGTGGTACTTTTGAGGAGGCTACTGCTGAGGCTTATCGTTATGCTGATCTGCTGCCTCGTGAGAATGGTCGTTATACTGTTGATGTTGCTGATCGTGGTTATACTCTGAATATTCGTTTTGCTCCCGGGGCTACTATTCGTGCTAATCTGATTTATGCTGATGGTCGTACTCAGACTGCTGAGTTTCGTGGTACTTTTGAGGAGGCTACTGCTGAGGCTTATCGTTATGCTGATCTGCTGCCTCGTGAGAATGGTCGTTATACTGTTGATGTTGCTGATCGTGGTTATACTCTGAATATTCGTTTTGCTGGTGGTGGCGGTGGCTGCGCTGATGACGATGACGATGACCATCATCACCACCATCATTAAGAATTC (SEQ ID NO: 33)

pLLD is obtained by inserting the sequence shown in SEQ ID NO: 33 into the BamHI-EcoRI site of pUC18vector. By expressing pLLD in E. coli, in the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 having the sequence of SEQ ID NO: 26 repeated twice, the sequence of the R1 portion is represented by PQ. I was
P = does not exist
Q = (Ala-Thr-Ile-Arg-Ala-Asn-Leu-Ile-Tyr-Ala
Asp-Gly-Arg-Thr-Gln-Thr-Ala-Glu-Phe-Arg
Gly-Thr-Phe-Glu-Glu-Ala-Thr-Ala-Glu-Ala
Tyr-Arg-Tyr-Ala-Asp-Leu-Leu-Ala-Arg-Glu
Asn-Gly-Arg-Tyr-Thr-Val-Asp-Val-Ala-Asp
Arg-Gly-Tyr-Thr-Leu-Asn-Ile-Arg-Phe-Ala
Pro-Gly-) n (n is an arbitrary integer from 2 to 5, and the sequence in parentheses is SEQ ID NO: 26)
R2 = Gly-Gly-Gly-Gly (SEQ ID NO: 16)
R3 = Cys-Ala
R4 = Asp-Asp-Asp-Asp-Asp-Asp (SEQ ID NO: 21)
R5 = His-His-His-His-His-His (SEQ ID NO: 22)
Thus, a protein represented by n = 2 was expressed. Subsequently, the protein was separated and purified according to the above-described method. As a result of conducting amino terminal sequence and mass number analysis of the obtained protein, the amino terminal is alanine, and the mass number measured using a mass analyzer of the obtained purified protein is 15,779 daltons. When a recombinant protein having a sequence of methionine-alanine as a terminal sequence was expressed in Escherichia coli, it was confirmed that the amino terminal methionine residue corresponding to the initiation codon usually found was processed.

Furthermore, in order to introduce a repetitive sequence in which n is 3 or more, the following DNA sequence having a Cfr9I cleavage sequence (CCCGGG) at both ends was synthesized (SEQ ID NO: 34).
CCCGGGGCTACTATTCGTGCTAATCTGATTTATGCTGATGGTCGTACTCAGACTGCTGAGTTTCGTGGTACTTTTGAGGAGGCTACTGCTGAGGCTTATCGTTATGCTGATCTGCTGCCTCGTGAGAATGGTCGTTATACTGTTGATGTTGCTGATCGTGGTTATACTCTGAATAGTCGTTTTGCTCCCGGGG (SEQ ID NO: 34

  This is cleaved with Cfr9I, mixed with pAAD cleaved with Cfr9I, and ligated with T4 DNA ligase to produce a recombinant plasmid in which one or more DNA sequences of SEQ ID NO: 34 cleaved with Cfr9I are linked. This was cut with BamHI and EcoRI and separated by agarose electrophoresis to obtain several sizes of about 0.70 kilobase pair, about 0.89 kilobase pair, about 1.1 kilobase pair and larger. Each DNA fragment from which the DNA fragment could be obtained was separated from the gel and introduced into the BamHI-EcoRI site of the pUC18 vector to separate the recombinant plasmid. Plasmids introduced with DNA fragments of about 0.70 kilobase pairs, about 0.89 kilobase pairs, and about 1.1 kilobase pairs (referred to as pLL3T, pLL4Q, and pLL5P, respectively) have portions corresponding to SEQ ID NO: 34, As a result, it was revealed that the amino acid sequence corresponding to n = 3, 4 and 5 was encoded in the Q sequence. In addition, E. coli JM109 strain transformed with recombinant plasmids pLL3T, pLL4Q, and pLL5P was shown to express and accumulate a large amount of proteins of about 23 kilodaltons, about 30 kilodaltons, and about 37 kilodaltons, respectively. .

Examination of the base sequence of the BamHI-EcoRI site of pLL3T revealed the following DNA sequence.
GGATCCTTGACAATATCTTAACTATCTGTTATAATATATTGACCAGGTTAACTAACTAAGCAGCAAAAGGAGGAACGACT
(SEQ ID NO: 35)

  Using Escherichia coli JM109 strain transformed with pLL3T, the protein was separated and purified according to the method described above. As a result of performing amino terminal sequence and mass number analysis of the obtained protein, the amino terminal is alanine, and the mass number measured using a mass analyzer of the obtained purified protein is 22,751 dalton. When a recombinant protein having a sequence of methionine-alanine as a terminal sequence was expressed in Escherichia coli, it was confirmed that the amino terminal methionine residue corresponding to the initiation codon usually found was processed.

  About the obtained protein, the binding activity with human IgG was investigated using Biacore.

  The results are shown in Table 7. In this table, for reference, the value of the mutant protein represented by n = 1 is shown for comparison. It was clarified that by taking the repeated sequence, the value of the binding force Kd with IgG becomes smaller and the binding force increases. It was clarified that by taking the repeated sequence, the value of the binding force Kd with IgG became smaller and the binding force increased (Table 7).

  Using the sequence represented by the general formula R1-R2-R3-R4-R5 of the present invention, the protein to be immobilized can be efficiently immobilized on the immobilization carrier in a controlled orientation, It can be used as a protein-immobilizing carrier for diagnosis, immobilized enzyme, etc. used in the medical field such as disease diagnosis.

SEQ ID NOs: 1-6, 10-23, 27-35

Claims (8)

A protein comprising an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 used for immobilizing a protein comprising an amino acid sequence represented by R1-R2 on an immobilization carrier, wherein It is used to immobilize the moiety represented by R1-R2 by cyanating the SH group of cysteine contained and acting on an immobilization carrier having a primary amine, and the primary surface of the carrier surface after immobilization. A method of designing a protein in which acetylation other than amino-terminal acetylation does not occur by acetylation treatment with a masking agent used to mask amines, and the amino acid sequences of R1, R2, R3, R4 and R5 parts are as follows: A method that includes selecting to meet the conditions of:
(a) as a sequence of the R1 portion, a sequence of the protein to be immobilized, which is characterized by not containing lysine residues and cysteine residues;
(b) if R2 or the absence of sequence portions, or Ru is present and selects the spacer sequence composed of amino acid residues other than lysine and cysteine residues;
(c) as a sequence of the R3 portion, a sequence composed of two amino acids represented by cysteine-alanine is selected;
(d) The R4 portion sequence does not contain lysine residues and cysteine residues, and the isoelectric point of the entire protein consisting of the amino acid sequence represented by the general formula R1-R2-R3-R4-R5 is acidic. Selecting a sequence characterized by containing acidic amino acid residues that can be
(e) An affinity tag sequence for purifying the protein is selected as the sequence of the R5 portion.   In the amino acid sequence of the general formula R1-R2-R3-R4-R5, the sequence of the R1 part is the amino acid sequence of a naturally derived protein, or all lysine residues and cysteine residues in the amino acid sequence, And a protein comprising an amino acid sequence modified to an amino acid sequence not containing a lysine residue and a cysteine residue, obtained by substitution with an amino acid residue other than a cysteine residue, which is equivalent to the naturally-occurring protein. The general formula R1-R2- used for immobilizing a protein comprising an amino acid sequence represented by R1-R2 on the immobilization carrier according to claim 1, wherein the protein has a functional amino acid sequence. A method for designing a protein having an amino acid sequence represented by R3-R4-R5. The sequence of R1 part is represented by PQ,
When the P portion sequence is not present or is present, a sequence consisting of (Ser or Ala)-(Gly) n (n is an arbitrary integer from 1 to 10) is selected, and the Q portion sequence is 2. The immobilized carrier according to claim 1, wherein the sequence is a protein sequence having a repeating unit and is a sequence in which a sequence unit not containing lysine residues and cysteine residues is repeated. -A method for designing a protein comprising an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 used for immobilizing a protein comprising an amino acid sequence represented by R2.   In the amino acid sequence represented by PQ, the repeat unit sequence of the Q portion is the amino acid sequence of the protein derived from nature, or all lysine residues and cysteine residues in the amino acid sequence other than lysine residues and cysteine residues. A protein consisting of an amino acid sequence modified to an amino acid sequence not containing lysine residues and cysteine residues, obtained by substitution with an amino acid residue, and having a function equivalent to that of the naturally-derived protein A general formula R1-R2-R3-R4-R5 used for immobilizing a protein comprising the amino acid sequence represented by R1-R2 on the immobilization carrier according to claim 3, A method for designing a protein comprising the amino acid sequence represented.   The amino acid sequence represented by the general formula R1-R2-R3-R4-R5, wherein the sequence of the R2 portion is a sequence consisting of 0 to 10 glycines. Designing a protein comprising an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 used for immobilizing a protein comprising an amino acid sequence represented by R1-R2 on the immobilization carrier described in item 1. how to. In the amino acid sequence represented by the general formula R1-R2-R3-R4-R5, the sequence of the R4 portion is a sequence having 1 to 10 amino acid residues consisting of two types of amino acid residues, aspartic acid and glutamic acid. A general formula R1-R2-R3- used for immobilizing a protein having an amino acid sequence represented by R1-R2 on the immobilization carrier according to any one of claims 1 to 5. A method for designing a protein having an amino acid sequence represented by R4-R5.   The amino acid sequence represented by the general formula R1-R2-R3-R4-R5, wherein the sequence of the R5 portion is an amino acid sequence consisting of 4 or more histidine residues. A protein comprising an amino acid sequence represented by the general formula R1-R2-R3-R4-R5 used for immobilizing a protein comprising the amino acid sequence represented by R1-R2 on the immobilization carrier according to any one of the items How to design.   The immobilization carrier according to any one of claims 1 to 7, wherein in the amino acid sequence represented by PQ, the repeating unit sequence of the Q portion has a function of specifically interacting with the antibody molecule. A method for designing a protein comprising an amino acid sequence represented by the general formula R1-R2-R3-R4-R5, which is used for immobilizing a protein comprising the amino acid sequence represented by R1-R2.