CN106520757A - Preparation method of listeria monocytogenes nucleic acid standard substance - Google Patents
Preparation method of listeria monocytogenes nucleic acid standard substance Download PDFInfo
- Publication number
- CN106520757A CN106520757A CN201610944062.7A CN201610944062A CN106520757A CN 106520757 A CN106520757 A CN 106520757A CN 201610944062 A CN201610944062 A CN 201610944062A CN 106520757 A CN106520757 A CN 106520757A
- Authority
- CN
- China
- Prior art keywords
- gdna
- standard substance
- preparation
- nucleic acid
- listeria monocytogenes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a preparation method of listeria monocytogenes nucleic acid standard substance. According to the preparation method, the standard substance is obtained through the steps of high-concentration gDNA extraction and characteristic verification of gDNA. The adopted primers are as follows: LIP1: 5'-GAT ACA GAA ACA TCG GTT GGC-3'; LIP2: 5'-GTG TAA CTT GAT GCC ATC AGG-3'. With the adoption of the preparation method, the standardization problem of listeria monocytogenes detection is solved, the uniform standard substance is provided for realizing the rapidness and effectiveness for detecting Listeria monocytogenes, the standard substance provided by the invention can realize the applications including authentication, evaluation, analysis, safety monitoring and the like, and thus a reference value is provided for developing the standard substance with biological features.
Description
Technical field
The invention belongs to biological technical field, and in particular to a kind of single preparation side for increasing listeria spp nucleic acid standard substance
Method.
Background technology
Since the nineties in 20th century, the gene diagnosis technology based on nucleic acid amplification quickly grows, in field of food
Multiple subjects such as microbiology, science of heredity are applied to, the animal and plant quarantine is also widely used.And it is increasingly becoming entry and exit mouth
One of bank inspection and quarantine method for quick.And Listeria Monocytogenes（Listeria monocytogenes）It is a kind of people and dynamic
Thing pathogen ill altogether.Monocytosis, septicemia and meningitis are mainly shown as after human poultry infection.The country is using most general
Time be genes of interest fragment round pcr, and based on real-time fluorescence quantitative PCR detection technique.But as the country does not have now
There is unified standard, each kit accepted standard is not consistent, and the factors such as extraction efficiency cannot also be examined by same working stamndard
It is thorough to consider, and so results in same part sample difference reagent difference personnel's operating result and differs greatly, feed exported product inspection
Quarantine brings very big error.The standardization issue solved by Listeria monocytogenes detection, and detection Listeria monocytogenes
Quick validity, needs a unified standard substance, therefore develops Listeria monocytogenes genomic DNA（gDNA）Standard substance gesture
Must go.The standard substance that the present invention is provided can be played including purposes such as identification, evaluation, analysis, security monitorings, be biological special
Property standard substance development provide reference value.
The content of the invention
It is an object of the invention to provide a kind of single preparation method for increasing listeria spp nucleic acid standard substance, solves single increasing
The standardization issue of Listeria detection, and the quick validity of detection Listeria monocytogenes.
For achieving the above object, the present invention is adopted the following technical scheme that：
A kind of single preparation method for increasing listeria spp nucleic acid standard substance, by the extraction of high concentration gDNA, the feature of gDNA
Property verification step obtain standard substance.
The extracting method of high concentration gDNA is specially：
（1）Draw 20 mL cell cultures centrifuge tube on ice is put to 50mL；13000-16000g is centrifuged 5s sedimentation cells, from
Heart 1-2 time；With the careful abandoning supernatant of liquid-transfering gun；
（2）Draw after 10 mL TE are well mixed with precipitation, 13000-16000g centrifugation 5s sedimentation cells, repeated centrifugation 1-2 time；
With the careful abandoning supernatant of liquid-transfering gun；
（3）Add 20 mL cell suspending liquids, upper and lower pressure-vaccum；Add 100 μ L enzymatic lysis solution, and turn upside down under 25；
37 DEG C of incubation 40min；13000-16000g is centrifuged 1min sedimentation cells；Supernatant is abandoned in shifting；
（4）Add 20 mL cytolysates, and with the upper and lower pressure-vaccum of liquid-transfering gun, 80 DEG C of incubation 5min dissolving cells；
（5）100 μ L RNase A liquid are added, is turned upside down 25 times and is mixed；36 DEG C of incubation 60min；1min is incubated in cooled on ice；
8mL protein precipitants are added, at a high speed sufficient vortex 20s；13000-16000g is centrifuged 3min, and the protein of precipitation must shape
Into a close particle, such as no-trump sample is placed；
（6）Draw in the centrifuge tube of 20mL isopropanols to a clean 50mL, and the supernatant mixing walked on carefully drawing；Gently
Light reverse mixing 50 times, isopropanol is stored in -20 DEG C, takes out and directly uses；13000-16000g is centrifuged 1min, and ttom of pipe is shown in white
The particle precipitation of color, abandoning supernatant will blot remaining liq with aseptic blotting paper after being gently inverted centrifuge tube, obtain white
Particle is gDNA.
The characteristic verification method of gDNA is：PrfA genetic fragments in gDNA are carried out expanding, are sequenced, compare, according to
Characteristic indication determines acquisition gDNA standard substances.
The primer adopted in the characteristic verification method of described gDNA is as follows：
It is the sequence analysis by prfA genes that identification monocyte increases Li Shi spy Salmonellas.
LIP1 5'-GAT ACA GAA ACA TCG GTT GGC-3'；
LIP2 5'-GTG TAA CTT GAT GCC ATC AGG-3'。
Primer is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
It is an advantage of the current invention that：
Develop per bottle of gDNA dry powder sample containing about 1 μ g of Listeria Monocytogenes gDNA standard substances.PrfA genes
The online Blast results of sequence：Score=507 bits (274), Expect=2e-140, Identities=274/274
(100%), Gaps=0/274 (0%), Strand=Plus/Minus.The A280/A260=1.86 of gDNA standard substances.gDNA
Standard substance is -20 DEG C within the cycle of 8 months, 4 DEG C, 25 DEG C of 3 temperature can preserve preferable stability, concentration is still protected
Hold in 1 μ g/ bottles, 0.8% agarose gel electrophoresis of gDNA standard substances and prfA gene magnifications have clearly target stripe.
Uncertainty evaluation result, when assay is represented with the mean value of 3 measured values, its value interval is distributed in ± 0.735 μ
Between g/mL.
Description of the drawings
0.8% agarose gel electrophoresis result of 20 bottles of gDNA standard substances of Fig. 1.M：DNA Ladder Marker；On figure
Numbering of the side for sample drawn.
20 bottles of gDNA standard substance prfA of Fig. 2 gene magnifications, 1.5% Ago-Gel electricity result.M：100 bp DNA Ladder
Marker；Numbering of the figure top for sample drawn.
Specific embodiment
Embodiment 1
1.1 it is prepared by bacterium solution culture
Listeria Monocytogenes（ATCC33090）After lyophilized bacterial strain rehydration, 10 μ L are drawn in 20mL trypticase soybean
Yeast extract meat soup（TSB-YE）In recovered, 36 ± 1 DEG C, 220r/min shaking table cultures 18-24h.The fresh bacterium of one ring of picking
Liquid lines 36 ± 1 DEG C of culture 18-24h of blood plate, and from blood plate, picking single bacterium colony is inoculated into 100mL TSB-YE respectively
In, 36 ± 1 DEG C, cultivate 18-24h.
The a large amount of gDNA of 1.2 high concentrations are extracted
Fresh bacterium solution is cultivated using fluid nutrient medium TSB-YE 2.0 × 10 are reached to concentration11Cells, using Puregene
Yeast/Bact.Kit B for Purification of Archive-quality DNA from Gram-Positive
Bacteria Culture Medium extract gDNA, extraction step are improved according to gDNA purity：
（1）Draw 20 mL cell cultures（About contain 2.0 × 1011 cells）Centrifuge tube on ice is put to 50mL（Parallel 2
Centrifuge tube）.（2）13000-16000g is centrifuged 5s sedimentation cells, and whether closely, otherwise repeated centrifugation is once for observation precipitation.（3）With
The careful abandoning supernatant of liquid-transfering gun.（4）Draw 10 mL TE with precipitation mix after, 13000-16000g be centrifuged 5s sedimentation cells,
Whether closely, otherwise repeated centrifugation is once for observation precipitation.With the careful abandoning supernatant of liquid-transfering gun.（5）20 mL cells are added to hang
Supernatant liquid, upper and lower pressure-vaccum.（6）Add 100 μ L enzymatic lysis solution, and turn upside down under 25.37 DEG C of incubation 40min.
（7）13000-16000g is centrifuged 1min sedimentation cells.Supernatant is abandoned in shifting.（8）20 mL cytolysates are added, and
With the upper and lower pressure-vaccum of liquid-transfering gun, cell is dissolved.80 DEG C of incubation 5min could dissolve cell.（9）100 μ L RNase A liquid are added, on
Overturn down 25 mixing.36 DEG C of incubation 60min.（10）1min is incubated in cooled on ice.（11）8mL protein precipitants are added, it is high
Fast sufficiently vortex 20s.
（12）13000-16000g centrifugation 3min precipitations, the protein of precipitation necessarily be formed a close particle, if
Protein particulate not enough tightly, sample is placed and be incubated on ice 5min and be centrifuged again.
（13）Draw in the centrifuge tube of 20mL isopropanols to a clean 50mL, and the supernatant walked on carefully drawing
Mixing.Reverse mixing gently 50 times.Isopropanol is stored in -20 DEG C, takes out and directly uses.
（15）13000-16000 × g centrifugation 1min precipitations.The particle precipitation of ttom of pipe visible white（As DNA）.
（16）Abandoning supernatant, will blot remaining liq with aseptic blotting paper after being gently inverted centrifuge tube, and guarantee white
Particle still in ttom of pipe.
（17）Add 70% ethanol of 30mL reverse cleaning DNA particles for several times.70% ethanol is stored in -20 DEG C, takes out direct
Use.（18）13000-16000g centrifugation 1min precipitations.（19）Operate same step（16）.
（20）Stand in Biohazard Safety Equipment, be dried 5min or so, and avoid over-drying and to cause DNA be difficult to molten
Solution.
（21）Add 8mL DNA lysates and with middling speed vortex 5s.65 DEG C of incubation 1h are with dissolving DNA.It is incubated at room temperature,
It is shaken gently for overnight.Guarantee that pipe cap is closed, to avoid leakage.
1.3 gDNA concentration and purity testing
Concentration Testing is carried out to the DNA for extracting with reference to Picogreen dyestuffs using The Picofluor Portable fluorescences instrument.
From 48502 bp, the outer reference material that the λ DNA of 2 μ g/mL are calibrated as calibration curve.
Using TE buffer dilute samples so as to which concentration is 100 μ g/mL.Using ultramicron nucleotides analyzer to dilute
The gDNA for releasing carries out the detection of purity.
The preparation of 1.4 gDNA standard substances
The preparation technology of Listeria monocytogenes gDNA standard substances mainly carries out dividing for equivalent using the gDNA liquid of even concentration
Dress, pre-freeze, lyophilized, packaging, characteristic gene fragments checking, uniformity, short-acting stability test, long-term stability test
Etc. link.Comprise the following steps that：
（1）- 20 DEG C of gDNA will be stored in（Concentration：100 μ g/mL, add up to 40mL）Thaw, be placed on ice.
（2）The gDNA liquid concentration and purity for preserving is detected with 1.3 step methods.
（3）Using 6 × loading buffer, 0.8% agarose gel electrophoresis detects the integrality of gDNA.10×
Loading buffer, 1.5% agarose gel electrophoresis checking characteristic gene prfA genetic fragments.
（4）The gDNA solution for having detected is sub-packed in into aseptic 0.5mL polypropylene vials, 10 μ L/ bottles, i.e. 1 μ g/ bottles.
（5）By step（4）Sample in -70 DEG C of refrigerators pre-freeze 4h, carry out in putting rapidly freeze drier after taking-up into
It is lyophilized；
（6）After lyophilized EP (end of program), the interface of nitrogen cylinder is connected with the air entry of freeze dryer.Nitrogen is charged into, polypropylene is made
Bottle is also filled with nitrogen.
1.5 Listeria monocytogenes gDNA characteristic fragments are verified
PrfA genes are the transcriptional controls for encoding Listeria Monocytogenes Major Virulence Factors Li bacillus hemolysin
Albumen.PrfA genetic fragments in gDNA are carried out expanding, are sequenced, than reciprocity step.This experiment is to use high-fidelity HotStar
HiFidelity Polymerase expand prfA genes, deliver to genome company's sequencing.
Pcr amplification reaction thermodynamic cycle parameter is：
PCR reaction systems are as shown in table 1.
1 high-fidelity PCR amplification reaction system of table is constituted
LIP1 5'-GAT ACA GAA ACA TCG GTT GGC-3'；
LIP2 5'-GTG TAA CTT GAT GCC ATC AGG-3'。
After PCR amplifications terminate, two PCR reaction tubes PCR primers are mixed, whole PCR primers about 100 μ L and 10 μ L is taken
10 × loading buffer mixing electrophoresis.Shanghai life work will be delivered to be sequenced after PCR primer lid mouth sealer.Sequencing is obtained
PrfA gene orders carry out online BLAST.Analyses and comparison result whether there is difference.In this, as the gDNA standard substances
Characteristic indication.
1.6 uniformity test：20 samples are randomly selected from the standard substance for completing to prepare to be detected, each sample
This test three times.As a result analyzed using F inspection statistics.
1.7 stability test
Whether short-term stability can keep enough stablizing when being then and transporting the standard substance under simulation condition of different temperatures.Temperature
Degree is set as -20 DEG C, 4 DEG C, 25 DEG C, 60 DEG C of 4 thermogrades.The time of measure is beginning（t=0）, after one week（t=1）, 2 weeks
Afterwards（t=2）, after 3 weeks（t=3）, after 4 weeks（t=4）, after 8 weeks（t=8）.Each thermograde takes out 3 samples every time, and each sample is every
It is secondary to carry out three measurements and average.
Whether long-time stability are steady under -20 DEG C, 4 DEG C, 25 DEG C, 60 DEG C of preservation conditions in order to observe the standard substance
It is fixed.The time of measure is beginning（T=0）, after January（T=1）, after April（T=2）, after August（T=3）.Each thermograde takes out 3 every time
Individual sample, each sample carry out three measurements every time and average.
1.8 uncertainties of measurement are assessed
The uncertainty of measurement of this part gDNA standard substances measures the fluorescence of sample mainly due to PicofluorTM fluorescence photometers
Value is brought, therefore the uncertainty that fluorescence method measurement dsDNA brings mainly is examined or check in this part.This belongs to A class uncertainties.
The assessment of A class uncertainties is that the statistical analysis carried out to observation row is made to be assessed..
Carry out n independent identical equal precision measurement first to input quantity xI, the measurement result for obtaining is：
x1、x2……xn
For its arithmetic mean of instantaneous value, as：；
The standard deviation of single measurement result experiment is：；
The mean value of observation row is that the uncertainty of estimate standard is；
2 results of implementation：Single preparation for increasing listeria spp nucleic acid standard substance
The gDNA of 2.1 high concentrations is extracted
Fresh bacterium solution is cultivated using fluid nutrient medium TSB-YE 2.0 × 10 are reached to concentration11Cells, using Puregene
Yeast/Bact.Kit B for Purification of Archive-quality DNA from Gram-Positive
Bacteria Culture Medium extract gDNA.Measure concentration is 284 μ g/mL, A260/280=1.86.By the gDNA by than
Example be diluted to 100 μ g/mL with pH8.0 TE buffer, preserve to -20 DEG C it is stand-by.Genomic integrity passes through electrophoresis, it is determined that nothing
Miscellaneous band.
The packing and freeze-drying of 2.2 gDNA
The gDNA liquid of extraction is diluted to into 100 μ g/mL with TE, 10 μ L are sub-packed in polypropylene tubes, and every bottle of standard substance contains
The amount of gDNA is 1 μ g or so.Freeze-drying and filling nitrogen are carried out after -70 DEG C of pre-freeze 4h.
The characteristic fragments checking of 2.3 gDNA standard substances
GDNA integrity checks are carried out to standard substance sample（0.8% agarose gel electrophoresis）And prfA genetic fragments are expanded
Increase.100 μ L of product and 10 μ L 10 × loading buffer mixing electrophoresis.As a result as illustrated in fig. 1 and 2.
The sequencing peak figure of 2.4 prfA genes
Select the above-mentioned PCR primer that can amplify about 274bp bands to deliver to genome company to be sequenced, sequencing result is used
Chromas is opened, and sequencing peak figure signal is strong, and the result not interfered with is high-visible.
With designed primer by 274 bases of the gene from sequencing sequence in find out, with FASTA forms represent as
Under：
>Listeria monocytogenes strain ATCC 7644 positive regulatory factor A
gene
TGTAATCTTGATGCCATCAGGAGTTTCTTTACCATACACATAGGTCAGGATTAAAAGTTGACTGCAAATAGAG
CCAAGCTTCCCGTTAATCGAAAAATCATTAAATTTAGCTAGGCTGTATGAAACTTGTTTTTGTAGGGTTTGGAAAAC
ATAGAAAAAGTGCGTAAGATTTTTGCTCAGTAGTTCTTTTAGTTCGTTTATTTTGATAACGTATGCGGTAGCCTGCT
CGCTAATGACTTCTAAATTATAATAGCCAACCGATGTTTCTGTATCA。
2.5 the control experiment result of prfA genes
The result of sequencing is uploaded to into http with the form of FASTA://blast.ncbi.nlm.nih.gov/ is carried out
Nucleotide blast, database select nucleotide collection（nr/nt）.Itself and known monocyte hyperplasia
The prfA of listeria spp ATCC 19113 compares.Find through comparing analysis, the 274bp and online monocyte hyperplasia
It is all the same that the similarity of listeria spp ATCC19113 prfA genes reaches 100%, 274bp.Score =507, Expect
= 2e-140.It is possible thereby to infer, the gDNA standard substances possess Listeria Monocytogenes feature.Meet gene
The requirement of group standard substance.
2.6 uniformity test
Uniformity of the uniformity test using Variance Analysis Evaluation sample.Method is with reference to CNAS-GL03:2006《Proficiency testing sample
Product uniformity and estimation of stability guide》Require, using fluorescent value method to same sample determination 3 times, and carry out variance analysis.
2 the results of analysis of variance of table
By above-mentioned variance analysis result of calculation,FIt is worth for 1.522, F critical values F0.05（19,40）=1.853 calculating, the value
＜F Critical value, this shows in 0.05 significance, and the gDNA contents in sample are uniform.
2.7 stability test
2.7.1 short-term stability
The stability of the gDNA standard substances under the different temperature transport environment of laboratory simulation, it is main investigate 4 DEG C, 25 DEG C, 60
DEG C 3 thermogrades.The time of measure is beginning（t=0）, after one week（t=1）, after 2 weeks（t=2）, after 3 weeks（t=3）, after 4 weeks
（t=4）, after 8 weeks（t=8）, continue 8 weeks altogether.Each thermograde takes out 3 samples every time, and each sample carries out three measurements every time
Average.And the integrality and characterizing gene amplification of standard substance is then the gDNA mono- at the whole temperature by each time point
Play checking.The gDNA standard substance concentration of said determination is depicted as into curve, standard substance can be intuitively found out from curve
Can the stable level in 1.00 μ g//bottle within 8 weeks under preservation condition under the conditions of -20 DEG C.
The standard substance is analyzed by the stability and agarose gel electrophoresis of Mathematical Statistics Analysis gDNA standard substance
Integrality, it is known that, the t check analyses standard substance is preserved 8 weeks under -20 DEG C, 4 DEG C, 25 DEG C of 3 thermogrades and can be kept
Stability, every bottle of standard substance gDNA content is in 1.00 μ g or so.0.8% agarose gel electrophoresis result shows, the standard substance
The integrality that can keep genome for 8 weeks is preserved under -20 DEG C, 4 DEG C, 25 DEG C of 3 thermogrades.Monocyte hyperplasia Liszt
Salmonella gDNA characterizing gene prfA amplifications show, be stored in -20 DEG C, 4 DEG C, 8 weeks can be complete under 25 DEG C of 3 thermogrades
Amplify prfA genes.And the standard substance is preserved under 60 DEG C of high temperature, show the standard substance through fluorescence spectrometry result
The dsDNA of 0.1 μ g or so is remained after 1 week is preserved under 60 DEG C of high temperature only, 0.8% agarose gel electrophoresis result shows, at this temperature
GDNA has substantially been degraded into small fragment, but prfA characterizing genes remain able to amplification out, and band is clear, illustrates gDNA
The fragment ruptured under 60 DEG C of preservation conditions is more than 274bp, moreover it is possible to ensure the presence of characterizing gene.
2.8 long-time stability：
Whether long-time stability are stable under -20 DEG C, 4 DEG C, 25 DEG C, 60 DEG C of preservation conditions in order to observe the standard substance, are protected
Depositing the time typically continues 2 years, but as experiment starts about 9 months so far, so the number of front August is first done in long-time stability experiment
According to.The time point of measure is beginning（T=0）, after January（T=1）, after April（T=4）, after August（T=8）.Each thermograde is each
3 samples are taken out at random, the numbering of extraction is write down, and are carried out three measurements to each sample every time and are averaged, then carry out t inspections
Test.The result of inspection.As short-term stability, the integrality of standard substance and characterizing gene amplification are then by each time point
Whole temperature under gDNA verify together.
GDNA standard substances show that through 0.8% agarose gel electrophoresis result the standard substance is at -20 DEG C, 4 DEG C, 25 DEG C
The integrality that can keep genome for 8 months is preserved under 3 thermogrades.Listeria Monocytogenes gDNA characterizing genes
PrfA amplifications show, be stored in -20 DEG C, 4 DEG C, the lower 8 monthly energy of 25 DEG C of 3 thermogrades can completely amplify prfA
Gene.And the standard substance is preserved under 60 DEG C of high temperature, show the standard substance in 60 DEG C of high temperature through fluorescence spectrometry result
It is lower preserve 1 week after only surplus 0.1 μ g or so dsDNA, 0.8% agarose gel electrophoresis result shows, gDNA is substantially at this temperature
Small fragment is degraded into, but through the High temperature storage up to 8 months, prfA characterizing genes have remained able to amplification out, bar
Band is clear, illustrates that genetic fragments of the gDNA under 60 DEG C of preservation conditions after 8 months in standard substance still has the piece more than 274bp
Section, moreover it is possible to ensure the presence of characterizing gene.
2.9 Evaluation of Uncertainty results
Prepare 30 and be about 500ng/mL gDNA stoste centrifuge tubes containing 100 μ L concentration, 100 μ L are then added toward centrifuge tube
Hydration PicoGreen working reagents.Be sufficiently mixed 2-5min is incubated in room temperature lucifuge.Then The Picofluor are applied
Portable fluorescence instrument Jing row concentration mensurations, every time test read 3 numbers, are averaged value as the structure of analysis, will now determine
Average results are arranged to table 3.
3 The Picofluor Portable fluorescence instrument reading measurement results of table
For its arithmetic mean of instantaneous value, as：；
The standard deviation of single measurement result experiment is：；
The mean value of observation row is that the uncertainty of estimate standard is；
When assay is represented with the mean value of 3 measured values, its value interval is distributed between ± 0.735 ng/mL.This
Interval is suitable for any one-shot measurement.
The foregoing is only presently preferred embodiments of the present invention, all impartial changes done according to scope of the present invention patent with
Modification, should all belong to the covering scope of the present invention.
SEQUENCE LISTING
<110>Inspection ＆ Quarantine Technology Center of Fujian Entry-Exit Inspection ＆ Quar
<120>A kind of single preparation method for increasing listeria spp nucleic acid standard substance
<130> 2
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence
<400> 1
gatacagaaa catcggttgg c 21
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<400> 2
gtgtaacttg atgccatcag g 21
Claims (4)
1. a kind of list increases the preparation method of listeria spp nucleic acid standard substance, it is characterised in that：Carrying by high concentration gDNA
Take, the characteristic verification step of gDNA obtains standard substance.
2. a kind of list according to claim 1 increases the preparation method of listeria spp nucleic acid standard substance, it is characterised in that：
The extracting method of high concentration gDNA is：
（1）Draw 20 mL cell cultures centrifuge tube on ice is put to 50mL；13000-16000g is centrifuged 5s sedimentation cells, from
Heart 1-2 time；With the careful abandoning supernatant of liquid-transfering gun；
（2）Draw after 10 mL TE are well mixed with precipitation, 13000-16000g centrifugation 5s sedimentation cells, repeated centrifugation 1-2 time；
With the careful abandoning supernatant of liquid-transfering gun；
（3）Add 20 mL cell suspending liquids, upper and lower pressure-vaccum；Add 100 μ L enzymatic lysis solution, and turn upside down under 25；37
DEG C incubation 40min；13000-16000g is centrifuged 1min sedimentation cells；Supernatant is abandoned in shifting；
（4）Add 20 mL cytolysates, and with the upper and lower pressure-vaccum of liquid-transfering gun, 80 DEG C of incubation 5min dissolving cells；
（5）100 μ L RNase A liquid are added, is turned upside down 25 times and is mixed；36 DEG C of incubation 60min；1min is incubated in cooled on ice；
8mL protein precipitants are added, at a high speed sufficient vortex 20s；13000-16000g is centrifuged 3min, and the protein of precipitation necessarily be formed
One close particle, such as no-trump sample are placed；
（6）Draw in the centrifuge tube of 20mL isopropanols to a clean 50mL, and the supernatant mixing walked on carefully drawing；
Reverse mixing gently 50 times, isopropanol is stored in -20 DEG C, takes out and directly uses；13000-16000g is centrifuged 1min, and ttom of pipe is shown in
The particle precipitation of white, abandoning supernatant will blot remaining liq with aseptic blotting paper after being gently inverted centrifuge tube, obtain white
Particle be gDNA.
3. a kind of list according to claim 1 increases the preparation method of listeria spp nucleic acid standard substance, it is characterised in that：
The characteristic verification method of gDNA is：PrfA genetic fragments in gDNA are carried out expanding, are sequenced, compare, according to characteristic indication
It is determined that obtaining gDNA standard substances.
4. a kind of list according to claim 3 increases the preparation method of listeria spp nucleic acid standard substance, it is characterised in that：
The primer adopted in the characteristic verification method of described gDNA for：
LIP1 5'-GAT ACA GAA ACA TCG GTT GGC-3'；
LIP2 5'-GTG TAA CTT GAT GCC ATC AGG-3'。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610944062.7A CN106520757A (en) | 2016-11-02 | 2016-11-02 | Preparation method of listeria monocytogenes nucleic acid standard substance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610944062.7A CN106520757A (en) | 2016-11-02 | 2016-11-02 | Preparation method of listeria monocytogenes nucleic acid standard substance |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106520757A true CN106520757A (en) | 2017-03-22 |
Family
ID=58292769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610944062.7A Pending CN106520757A (en) | 2016-11-02 | 2016-11-02 | Preparation method of listeria monocytogenes nucleic acid standard substance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106520757A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107513569A (en) * | 2017-09-19 | 2017-12-26 | 北京勤邦生物技术有限公司 | The LAMP primer group and detection method of a kind of Listeria Monocytogenes |
| CN111621581A (en) * | 2020-06-28 | 2020-09-04 | 河南大学 | Standard plasmid freeze-dried powder for detecting listeria monocytogenes |
| CN111719007A (en) * | 2020-08-06 | 2020-09-29 | 南方医科大学 | Listeria monocytogenes nucleic acid detection plasmid DNA reference sample, preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676506A (en) * | 2012-05-30 | 2012-09-19 | 曹际娟 | Mononuclear cell proliferation listeria monocytogenes nucleic acid standard sample and establishing method and application thereof |
| CN104140994A (en) * | 2014-08-07 | 2014-11-12 | 福建出入境检验检疫局检验检疫技术中心 | Staphylococcus aureus standard substance containing chicken matrix |
| CN104450940A (en) * | 2014-12-29 | 2015-03-25 | 南京农业大学 | Nucleotide sequence for detecting listeria monocytogenes and detection method and detection kit |
-
2016
- 2016-11-02 CN CN201610944062.7A patent/CN106520757A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676506A (en) * | 2012-05-30 | 2012-09-19 | 曹际娟 | Mononuclear cell proliferation listeria monocytogenes nucleic acid standard sample and establishing method and application thereof |
| CN104140994A (en) * | 2014-08-07 | 2014-11-12 | 福建出入境检验检疫局检验检疫技术中心 | Staphylococcus aureus standard substance containing chicken matrix |
| CN104450940A (en) * | 2014-12-29 | 2015-03-25 | 南京农业大学 | Nucleotide sequence for detecting listeria monocytogenes and detection method and detection kit |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107513569A (en) * | 2017-09-19 | 2017-12-26 | 北京勤邦生物技术有限公司 | The LAMP primer group and detection method of a kind of Listeria Monocytogenes |
| CN111621581A (en) * | 2020-06-28 | 2020-09-04 | 河南大学 | Standard plasmid freeze-dried powder for detecting listeria monocytogenes |
| CN111719007A (en) * | 2020-08-06 | 2020-09-29 | 南方医科大学 | Listeria monocytogenes nucleic acid detection plasmid DNA reference sample, preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105039149B (en) | A kind of closed experimental system setup of Rapid identification nucleic acid amplification product and application | |
| CN106520757A (en) | Preparation method of listeria monocytogenes nucleic acid standard substance | |
| CN105331714B (en) | A kind of peronophythora litchi LAMP primer and its rapid detection method | |
| CN107190055B (en) | Soil bacteria high throughput absolute quantification method | |
| CN101712924A (en) | Reaction tube used in loop-mediated isothermal amplification technique and use method thereof | |
| CN110229919A (en) | For detecting the composition, kit and method of Mycoplasma bovis | |
| CN103952463A (en) | Specific primer based kit for identifying five common cryptoleste stored grain insects | |
| CN105177127B (en) | A set of polynucleotides, method and kit for Listeria monocytogenes detection | |
| CN108823325A (en) | The application of Riemerellosis Anatipestifer Imp gene and its PCR detection kit and method | |
| CN106148548B (en) | multiplex PCR detection kit capable of simultaneously detecting clostridium perfringens, clostridium hemolyticus and clostridium novyi B and application thereof | |
| CN110117671A (en) | Riemerellosis Anatipestifer Specific PCR primers are to, PCR detection method and kit | |
| CN107460255A (en) | A kind of RT LAMP primers group, kit and application for detecting pig fourth type coronavirus | |
| CN106282417A (en) | Multi-fluorescence immunoassay primer, test kit and the method for a kind of quick differentiation CAV, MDV, REV, IBDV | |
| CN108796106A (en) | Giardia bovis, Cryptosporidium multiple PCR detection kit and its method | |
| CN108277290A (en) | The dry powdered LAMP quick detection kits of staphylococcus aureus | |
| CN109762916A (en) | The method and primer special of quantitative detection sulfate reducing bacteria | |
| CN102925578B (en) | Detection reagent kit and detection method of aeromonas bacteria | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| CN112359135B (en) | Indel labeled primer of fritillaria taipaiensis and application thereof | |
| CN104561263A (en) | Rapid detection kit and detection method for clostridium botulinum B employing loop-mediated isothermal gene amplification | |
| CN109988855A (en) | For detecting the LAMP primer composition and its application of six kinds of aspergillus | |
| CN107119121A (en) | A kind of real-time quantitative LAMP primer, kit and method for detecting bacillus rhusiopathiae suis | |
| CN105331722B (en) | Fast qualitative, immue quantitative detection reagent box and the detection method of enterococcus faecium for being added in feed and application | |
| CN109517887A (en) | The dry powdered LAMP quick detection kit of Vibrio vulnificus | |
| CN108265117A (en) | BCR-ABL1 fusion e14a2 hypotype plasmid candidate reference substances and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170322 |
|
| RJ01 | Rejection of invention patent application after publication |