CN106520729A

CN106520729A - Maltooligosyl trehalose hydrolase and expression gene and application thereof

Info

Publication number: CN106520729A
Application number: CN201610937019.8A
Authority: CN
Inventors: 王瑞明; 薛乐平; 王腾飞; 汪俊卿
Original assignee: Qilu University of Technology
Current assignee: Qilu University of Technology
Priority date: 2016-10-25
Filing date: 2016-10-25
Publication date: 2017-03-22
Anticipated expiration: 2036-10-25
Also published as: CN106520729B

Abstract

The invention relates to a maltooligosyl trehalose hydrolase and an expression gene and an application thereof. The nucleotide sequence of maltooligosyl trehalose hydrolase expression gene MTHase is shown as a SEQ ID NO.3; and the amino acid sequence of maltooligosyl trehalose hydrolase MTHase is shown as a SEQ ID NO.4. The invention also relates to the application of maltooligosyl trehalose hydrolase expression gene MTHase in production of trehalose. The maltooligosyl trehalose hydrolase expression gene MTHase obtained by extracting Arthrobacter oxydans is firstly found, The maltooligosyl trehalose hydrolase expression gene MTHase expressed by gene is obviously better than the known maltooligosyl trehalose hydrolase MTHase, the enzyme and MTSase of Arthrobacter oxydans with same source are combined for action to produce trehalose, yield is high, and the maltooligosyl trehalose hydrolase has wide application prospect.

Description

Malt oligosaccharide based mycose hydrolytic enzyme and its expressing gene and application

Technical field

The present invention relates to malt oligosaccharide based mycose hydrolytic enzyme and its expressing gene and application, belong to technique for gene engineering neck Domain.

Background technology

Trehalose is a kind of safe irreducibility two being combined into by α -1,1 glycosidic bonds by two molecule glucoses Sugar, is widely present in plant, animal and microorganism.Trehalose has extensive biological significance, in medicine be it is a kind of very Good stabilizer, can be used to protect the thing of the easy in inactivation such as hormone, vitamin, antibiotic, biological preparation, enzyme, antiserum, vaccine Matter；Cell viability can be maintained in cosmetics, with moisturizing, radiation-resistant effect；Can maintain in agricultural crop high temperature, Normal growth under high drought, high salt conditions；It is used as improving the natural additive of quality and local flavor in food, while also having Fresh-keeping effect；Therefore " sugar of life " is described as in scientific circles.

The method of production trehalose mainly includes single enzyme process and two enzymes method at present.Single enzyme process mainly utilizes trehalose synthase Trehalose is generated by substrate of maltose, but the stability of the enzyme is poor, easily inactivates, it is not extensive using the technique at present The report of production trehalose.Two enzymes method is using malt oligosaccharide based mycose synthetase (MTSase), malt oligosaccharide based mycose Hydrolytic enzyme (MTHase), is directly catalyzed generation trehalose by substrate of amylose.MTSase major catalytic intramoleculars turn glycosyl α-Isosorbide-5-Nitrae-the glycosidic bond of the reducing end under neutral of starch is converted into α -1 by reaction, and 1- glycosidic bonds obtain intermediate product Fructus Hordei Germinatus oligose Base trehalose；α-Isosorbide-5-Nitrae-glycosidic bond that Fructus Hordei Germinatus oligose base is connected with trehalose in the MTHase single-minded inscribe intermediate product, produces The new Fructus Hordei Germinatus oligose of 2 glucose units of a raw molecule trehalose and reduction, and next round reaction is carried out as new substrate.Mesh Front two enzymes method is most economical practical process route, and is applied to industrialized production.

Malt oligosaccharide based mycose synthetase and malt oligosaccharide based mycose hydrolytic enzyme are most early in arthrobacterium Report is found in (Arthrobactor sp.StrainQ36), later again in root nodule bacteria (Rhizobium sp.Strain M11), micro- yellow brevibacterium (Brevibactierium helvolum), sulfolobus acidocaldarius (Sulfolobus Acidocaldarius ATCC33909) in be found that in succession both enzymes.The MTSase and MTHase of separate sources has not Same enzymatic property, 40 DEG C of the optimal reactive temperature of Arthrobactor sp.StrainQ36, pH6.5, high conversion rate reach 80%, Sulfolobus acidocaldarius ATCC33909 have 75 DEG C higher of optimal reactive temperature and relatively low PH 5.0, but enzyme activity is very low.

The content of the invention

The present invention is directed to the deficiencies in the prior art, there is provided malt oligosaccharide based mycose hydrolytic enzyme and its expressing gene with should With.

Technical solution of the present invention is as follows：

Malt oligosaccharide based mycose hydrolytic enzyme expressing gene MTHase, nucleotide sequence is as shown in SEQ ID NO.3.

Above-mentioned malt oligosaccharide based mycose hydrolytic enzyme MTHase, aminoacid sequence is as shown in SEQ ID NO.4.

A kind of recombinant expression carrier, inserts above-mentioned expressing gene MTHase in expression vector.

Preferably, the expression vector is expression vector pET-22b (+).

A kind of reconstitution cell, containing above-mentioned recombinant expression carrier.

Preferably, described reconstitution cell is by by after above-mentioned expression vector transformed competence colibacillus e. coli bl21 (DE3) Obtain.

Above-mentioned malt oligosaccharide based mycose hydrolytic enzyme MTHase, above-mentioned expressing gene MTHase, above-mentioned reconstitution cell are in system Application in standby production trehalose.

Beneficial effect

Present invention firstly discovers that the Fructus Hordei Germinatus oligose for obtaining is extracted by oxidation arthrobacterium (Arthrobacter oxydans) Base hydrolysis of trehalose expression of enzymes gene M THase, the malt oligosaccharide based mycose hydrolytic enzyme MTHase optimum temperatures of the gene expression For 57 DEG C, optimum pH 5.5 produces maltopentaose base trehalose by substrate of 20% maltopentaose, and enzyme activity can reach 35.7U/ml, Existing known malt oligosaccharide based mycose hydrolytic enzyme MTHase is significantly better than, the enzyme is with same from oxidation arthrobacterium During (Arthrobacter oxydans) collective effect production trehalose, yield is high, has broad application prospects.

Description of the drawings

Fig. 1 is the flow chart that MTSase, MTHase gene obtains process；

Fig. 2 is the electrophoresis detection result photo after the amplification of MTSase gene PCRs；

Fig. 3 is the electrophoresis detection result photo after the amplification of MTHase gene PCRs；

Specific embodiment

Technical scheme is described further with reference to embodiment, but institute's protection domain of the present invention is not limited to This.

Strain source

Oxidation arthrobacterium (Arthrobacter oxydans) is purchased from China General Microbiological collection (CGMCC), deposit number NO.1.1925.

Embodiment 1：The extraction of oxidation arthrobacterium (Arthrobacter oxydans) genome DNA.

By the oxidation arthrobacterium preserved at -80 DEG C (Arthrobacter oxydans) inoculation to LB fluid mediums In (peptone 10g/L, yeast powder 5g/L, NaCl 10g/L), activation culture 24 hours, is seeded to newly according to 1% inoculum concentration thereafter Cultivate 24 hours in fresh LB culture medium, take 10mL bacterium solutions and the method provided by work bacterial genomes extracts kit is given birth to according to Shanghai Extract the bacterium genome DNA.

Embodiment 2：The acquisition of MTSase, MTHase gene

The acquisition of MTSase, MTHase gene as shown in figure 1, according to homologous comparison separately design degenerate primer F1 and R1, F2 and R2.

F1：GGTTCCGSGTGSGASGTGAAGAACTGCCA

R1：TTGGCCATSACCATKCCSGAGGTCTGCTGGAA

F2：ATCTACGARCTSCACSTGGGCACCTT

R2：GGTTCCGSGTGSGASGTGAAGAACTGCCA

With genome DNA obtained in embodiment 1 as template, respectively with F1 (forward primer), R1 (downstream primer) and F2 (forward primer), R2 (downstream primer) are primer, are entered according to product description using the Ex TaqTM test kits of TaKaRa companies Performing PCR is expanded；

The PCR amplification system is as follows：

2 μ L of genomic DNA, 2 μ L of forward primer, 2 μ L of downstream primer, 25 μ L of Taq enzyme, ddH₂O 19μL。

PCR conditions are：95 DEG C of degeneration 5min；95 DEG C of degeneration 30sec, 64 DEG C of annealing 30sec, 72 DEG C of extension 1min, totally 30 Individual circulation；72 DEG C of extension 10min, 4 DEG C of preservations.

Gel electrophoresiss respectively obtain two 1000bp or so band, and rubber tapping is reclaimed.PCR primer is carried with pTOPO-T respectively Body connection is transformed in DH5 α, selects positive colony, is delivered to Shanghai life work sequencing, is denoted as sequencing result 1.

According to sequencing result 1 and homologous sequence design degenerate primer F3 and R3, F4 and R4, F5 and R5.

F3：ACSCGGCGGTAGGGCATGGWTTC

R3：CCGGGCAGTGGAGCGACGACT

F4：CCCGCCGTAGCCTTCATGGAC

R4：ACCTCGGGAATGGTCATGGC

F5：CTTGTCCAGGTCGTCGTCCGAG

R5：CTTGTCCAGGTCGTCGTCCGAG

With genome DNA obtained in embodiment 1 as template, respectively with F3 (forward primer) and R3 (downstream primer), F4 (forward primer) and R4 (downstream primer), F5 (forward primer) and R5 (downstream primer) are primer, using the Ex of TaKaRa companies TaqTM test kits carry out into performing PCR expanding according to product description；

The PCR amplification system is as follows：

PCR conditions are：95 DEG C of degeneration 5min；95 DEG C of degeneration 30sec, 64 DEG C of annealing 30sec, 72 DEG C of extension 1.5min, altogether 30 circulations；72 DEG C of extension 10min, 4 DEG C of preservations；

Gel electrophoresiss respectively obtain 1000bp, 1000bp, 1500bp or so band, and rubber tapping is reclaimed.By PCR primer respectively with The connection of pTOPO-T carriers is transformed in DH5 α, selects positive colony, is delivered to Shanghai life work sequencing, is denoted as sequencing result 2.

MTSase and MTHase gene head and the tail base sequences, and destination carrier pET-22b are obtained according to sequencing result 2 Sequence, designs by primer-design software CE Design V1.03Seamless clone's multi-discSection chimera primers F 6 and R6, F7 and R7.Boldface is restriction enzyme site Nde I and Xho I.

F6：taagaaggagatataAGGGTCCCGGCATCCAC

R6：gtggtggtggtggtgTGCCTTTTCTCCATCCGCC

F7：taagaaggagatataATGACCCTCGTCAATGGCGG

R7：gtggtggtggtggtgGGATTTGACGATTGCCGCA

With genome DNA obtained in embodiment 1 as template, respectively with F6 (forward primer) and R6 (downstream primer), F7 (forward primer) and R7 (downstream primer) are primer, are entered according to product description using the Ex TaqTM test kits of TaKaRa companies Performing PCR is expanded；

The PCR amplification system is as follows：

PCR conditions are：95 DEG C of degeneration 5min；95 DEG C of degeneration 30sec, 55 DEG C of annealing 30sec, 72 DEG C of extension 2.5min, altogether 30 circulations；72 DEG C of extension 10min, 4 DEG C of preservations；

Gel electrophoresiss respectively obtain 2300bp and 1800bp or so band, as shown in Figure 2 and Figure 3, are consistent with theoretical value, cut Glue reclaim.

Embodiment 3：The structure of recombiant plasmid and conversion

By genes of interest MTSase, MTHase product after purification respectively with linearisation after carrier pET-22b (+)/ (Nde I, Xho I) connects, and linked system as shown in table 1, connection product is converted into e. coli bl21 competent cell, 37 DEG C of 200r/min cultivate 1h, subsequently transformed cells are coated on the LB flat boards containing 100 μ g/mL ampicillin, 37 DEG C Constant temperature incubated overnight, picking single bacterium colony simultaneously obtain positive colony by bacterium colony PCR screenings, deliver to Shanghai life work sequencing, as a result Show Insert Fragment respectively containing a long 2328bp (such as SEQ ID NO:Shown in 1) and 1770bp (such as SEQ ID NO:3 institutes Show) open reading frame (ORF), be separately encoded by the protein of 775 and 589 amino acid encodings.

Table 1：Linked system

Embodiment 4：The abduction delivering of recombinant bacterial strain

Recombinant bacterial strain E.coli BL21 (pET-22b-MTSase) and E.coli BL21 (pET-22b-MTHase) are pressed According to mass percent 1% inoculum concentration be inoculated into 50mL containing concentration be 100 μ g.mL^-1The LB liquid cultures of ampicillin (Amp) In base, 37 DEG C are cultivated to OD₆₀₀=0.8, after adding IPTG derivants, then proceed to 22 DEG C of constant-temperature shaking incubators and carry out induction table Reach.After induction 12h, collects thalline 5000r/min centrifugation 5min, adds the resuspended thalline of phosphate buffer of 10mL pH 6.47, Ultrasonication (power 300W, intermittent time 6s, broken time 4s, whole process 13min) is carried out, in 8000rpm centrifugation 10min collections Clear liquid is used as crude enzyme liquid.

The LB fluid mediums, every liter of component are as follows：

Peptone 10g/L, yeast extract 5g/L, NaCl 10g/L, pH 7.0～7.4；

Embodiment 5：Ni-NTA affinitive layer purifications

Taking-up is stored in the nickel post of 4 DEG C of refrigerators, will be ethanol in post complete with the resuspended filler of ethanol and after filler sinks completely Portion releases.With the Ni-Native-0 buffer balance filler of 5-10 times of volume, flow speed control is 1mL/min；Add embodiment 4 Gained crude enzyme liquid, keeps flow velocity 1mL/min 30min, collects effluent；With Ni-Native-100 buffer solution purpose eggs In vain, coutroi velocity is 1mL/min, and collects effluent；With Ni-Native-250 buffer solution destination proteins, flow velocity is 1mL/min, collects effluent；The Ni-Native-0 buffer balance pillar of 5-10 times of volume is added, and with percent by volume is 30% ethanol solution preserves filler, and the enzyme liquid sample collected carries out SDS-PAGE analyses, obtains MTSase's and MTHase Molecular weight is respectively 85000Da and 65000Da.

Embodiment 6：The measure of MTSase and MTHase enzyme activity

MTSase enzyme activity determinations：Maltopentaose is dissolved in the phosphoric acid-citrate buffer solution of 50m mol/L pH 5.5, The solution that mass concentration is 20% is made into, the 100mL solution is taken and is added 1mL MTSase enzyme liquids, 50 DEG C of reaction 10min, 100 DEG C Boil 10min terminating reactions.After solution cooling, pH4.2 is adjusted, add 0.1mL saccharifying enzyme, 50 DEG C of saccharifying 24h, HPLC to determine The amount of trehalose.

MTSase enzyme-activity units (U) are defined：Per 1min, conversion maltopentaose generates 1m mol maltopentaose base trehaloses institute The enzyme amount of needs.

MTHase enzyme activity determinations：Maltopentaose is dissolved in the phosphoric acid-citrate buffer solution of 50m mol/L pH 5.5, The solution that mass concentration is 20% is made into, 100mL solution addition 200U MTSase enzyme liquids are taken, 50 DEG C are reacted 5h, and 100 DEG C are boiled Boiling 10min terminating reactions.After solution cooling, regulation pH5.5, addition 1mL MTHase enzyme liquids, 50 DEG C of reaction 10min, 100 DEG C 10min terminating reactions are boiled, HPLC determines the amount of trehalose.

MTSase enzyme-activity units (U) are defined：Maltopentaose is hydrolyzed per 1min and generates the enzyme amount required for 1m mol trehaloses.

Jing is determined, and the enzyme activity of MTSase and MTHase is respectively 35.7U/mL and 80.2U/mL.

Embodiment 7：Application of the two enzymes method in trehalose

Soluble starch is dissolved in the phosphoric acid-citrate buffer solution of 50m mol/L, the shallow lake that mass concentration is 20% is made into Powder solution, 80 DEG C of gelatinizing 10min, addition α-amylase 100U (g starch)-¹, 50 DEG C of reaction 10min, 120 DEG C of inactivation alphalise starch Enzyme, MTSase and MTHase crude enzyme liquids are added in starch solution, 60 DEG C of reaction 24h under conditions of pH5.5, trehalose Conversion ratio is 82.5%.

Two kinds of enzyme MTSase and MTHase of the present invention are compared with double enzymes that other are originated, with higher optimal reactive temperature 60 DEG C, and relatively low optimum pH 5.5, industrialized production is more suitable for, with starch solution that mass fraction is 20% as substrate, 24h is reacted under the conditions of double enzyme effects, conversion ratio may be up to 82.5%.

Comparative example：

Malt oligosaccharide based mycose hydrolytic enzyme (MTHase) and patent documentation CN103205475A (application numbers in the present invention 201310128939.1) react under conditions of in, the MTHase of embodiment 3-1 preparation is described in the embodiment of the present invention 6, this The enzyme activity of bright middle MTHase may be up to 80.2U/mL, higher than patent documentation CN103205475A (application number 201310128939.1) Described in MTHase enzyme activity 72.5U/mL.

Malt oligosaccharide based mycose synthetase (MTSase) and patent documentation CN103205475A (application numbers in the present invention 201310128939.1) in, malt oligosaccharide based mycose hydrolytic enzyme (MTHase) collective effect is in amylose, real in the present invention React under conditions of applying example 7, conversion ratio is only 70.5%；In the present invention, MTSase is common with the MTHase equally from the bacterial strain Same-action, conversion ratio may be up to 82.5%.

SEQUENCE LISTING

<110>Qilu University of Technology

<120>Malt oligosaccharide based mycose hydrolytic enzyme and its expressing gene and application

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 2328

<212> DNA

<213> Arthrobacter oxydans

<400> 1

atgagggtcc cggcatccac ctaccgactt cagatccgcc gcagcttcac cctgttcgac 60

gccgccgaca aggtcccgta cctcaaggac ctcggcgttg actgggtcta cctctcgccc 120

atcctcaccg cggagcaggg ctcggatcac ggctacgacg tgaccgaccc ctccgcggtg 180

gacccggagc ggggcggccc cgagggcctg ctggccctgt ccaaggctgc ccgcgagcac 240

ggcatgggtg tcctggtgga catcgtgccc aaccacgtgg gcgtagcgac gcccgtgcag 300

aacccctggt ggtggtccct gctgaaggaa gggcagggct cgccctacgc cgaagccttc 360

gacgtcgact gggacctggc aggcgggaag atccggctgc ccatgcttgg ctcggacgac 420

gacctggaca agcttgaaat caaggacggc gagctccgct actacgacca ccggttcccg 480

ctcgcttcgg gaagctactc ggagggcgac tccccccagg aagtgcacag ccggcagcac 540

tatgagctga tggactggcg ccgggcggac gccgaactga actaccggcg cttcttcgca 600

gtgaccacgt tggccgggat ccgggtggaa acccccaagg tcttcgagga agcacatgcc 660

gaggtgggcc gctggttcaa ggaaggcctg gtggacggcc tgcgggttga ccacccggac 720

ggcctggccg accccgccgg ctacctgcgc tggctgaagg acctcagcgg cggagcctac 780

gtcctggtgg aaaagatcct cgagccgggc gaaaccctgc cgcaggactt cgccaccgag 840

ggaaccaccg ggtacgacgc cctcgcggac gtggaccggg tgttcgtgga ccccgcaggc 900

cagcaggcgc tggacgagct cgacgcgaag cttcgcggct ccagcacccc cgcggactac 960

gcggagatga tcaggggcac caagcggatg atcgcggacg gcatcctgcg gtccgaggtc 1020

ctgcgcctgg cccgcctggt accggagtcc tatgggctgc cggtggagca ggcagcagat 1080

gccattgccg agatcatcgc tgccttcccg gtctaccgga cgtacctgcc caccggcgcc 1140

gagatcctca aggaagcgtg cgaatcagcg gcggcccacc ggcccgacct cgaggttgcc 1200

gtgggcaccc tgctgccgct gctccttgat cccgggaacc ccatcgcggt ccgcttccag 1260

cagacctcgg gaatggtcat ggccaagggc gtcgaggaca cggcgttcta ccgctacacc 1320

cgcctgggca ccctgacaga ggtgggggcc gaaccgacag agttctctgt ttccacggcc 1380

gagttccacc agcggatggc ccggcgccaa caggaacttc ccctgtccat gaccaccatg 1440

tccacgcatg acaccaagcg cagcgaggac gcccgggccc ggatctcggt catcgccgaa 1500

ctgccggagg agtgggcgga caccttggcc acgctccgcg gactcgcccc gattccggac 1560

ggcccctacg agaacctgct gtggcaggct gtggtggggg cttggcccgc aagcagggaa 1620

cgcctgcagg gctacgccga gaaggctgcc cgggaagccg gcaactccac cacctggacc 1680

agccccgacg aggacttcga atcctccgtc aaggccgcgg tggacgcagt gttcgacgac 1740

ggccgcgtca ccaaagcggt ggaggacttc gtggcacgga tcgattccta cgccgcgtcc 1800

aactccgtgt ccgccaagct ggtccagctg accatgcccg gcgtgccgga tgtttaccag 1860

ggcagcgagt tctgggaacg gtccctgacc gaccccgaca accggcggcc ggtggacttt 1920

gaagtccgcc ggcaggagct cgccaagctc gacgccggca ccctccccgc ggccggcacg 1980

gaacccagca agctcctggc cacgtcccgc gcgctccggc tccgccgcga ccggcccgaa 2040

ctgttccagg gctacagccc cgtgacagcc acgggcccgg cggcggatca cgtcctcgcg 2100

ttccaccgcg ggggtgacgg cgccctgggc gccctgaccc tggccacccg gcttcccgcc 2160

ggactcgcgg ccgacggcgg atggcgggac accgccgtcg agcttcccgt tgcggtgtgt 2220

gacgaactca ccggcaacgc ctacggaccc ggctccgttc cggtggccga ggtcctgggc 2280

acctaccccg tggcattgct cgtaccggcg gatggagaaa aggcatga 2328

<210> 2

<211> 775

<212> PRT

<213> Arthrobacter oxydans

<400> 2

Met Arg Val Pro Ala Ser Thr Tyr Arg Leu Gln Ile Arg Arg Ser Phe

1 5 10 15

Thr Leu Phe Asp Ala Ala Asp Lys Val Pro Tyr Leu Lys Asp Leu Gly

20 25 30

Val Asp Trp Val Tyr Leu Ser Pro Ile Leu Thr Ala Glu Gln Gly Ser

35 40 45

Asp His Gly Tyr Asp Val Thr Asp Pro Ser Ala Val Asp Pro Glu Arg

50 55 60

Gly Gly Pro Glu Gly Leu Leu Ala Leu Ser Lys Ala Ala Arg Glu His

65 70 75 80

Gly Met Gly Val Leu Val Asp Ile Val Pro Asn His Val Gly Val Ala

85 90 95

Thr Pro Val Gln Asn Pro Trp Trp Trp Ser Leu Leu Lys Glu Gly Gln

100 105 110

Gly Ser Pro Tyr Ala Glu Ala Phe Asp Val Asp Trp Asp Leu Ala Gly

115 120 125

Gly Lys Ile Arg Leu Pro Met Leu Gly Ser Asp Asp Asp Leu Asp Lys

130 135 140

Leu Glu Ile Lys Asp Gly Glu Leu Arg Tyr Tyr Asp His Arg Phe Pro

145 150 155 160

Leu Ala Ser Gly Ser Tyr Ser Glu Gly Asp Ser Pro Gln Glu Val His

165 170 175

Ser Arg Gln His Tyr Glu Leu Met Asp Trp Arg Arg Ala Asp Ala Glu

180 185 190

Leu Asn Tyr Arg Arg Phe Phe Ala Val Thr Thr Leu Ala Gly Ile Arg

195 200 205

Val Glu Thr Pro Lys Val Phe Glu Glu Ala His Ala Glu Val Gly Arg

210 215 220

Trp Phe Lys Glu Gly Leu Val Asp Gly Leu Arg Val Asp His Pro Asp

225 230 235 240

Gly Leu Ala Asp Pro Ala Gly Tyr Leu Arg Trp Leu Lys Asp Leu Ser

245 250 255

Gly Gly Ala Tyr Val Leu Val Glu Lys Ile Leu Glu Pro Gly Glu Thr

260 265 270

Leu Pro Gln Asp Phe Ala Thr Glu Gly Thr Thr Gly Tyr Asp Ala Leu

275 280 285

Ala Asp Val Asp Arg Val Phe Val Asp Pro Ala Gly Gln Gln Ala Leu

290 295 300

Asp Glu Leu Asp Ala Lys Leu Arg Gly Ser Ser Thr Pro Ala Asp Tyr

305 310 315 320

Ala Glu Met Ile Arg Gly Thr Lys Arg Met Ile Ala Asp Gly Ile Leu

325 330 335

Arg Ser Glu Val Leu Arg Leu Ala Arg Leu Val Pro Glu Ser Tyr Gly

340 345 350

Leu Pro Val Glu Gln Ala Ala Asp Ala Ile Ala Glu Ile Ile Ala Ala

355 360 365

Phe Pro Val Tyr Arg Thr Tyr Leu Pro Thr Gly Ala Glu Ile Leu Lys

370 375 380

Glu Ala Cys Glu Ser Ala Ala Ala His Arg Pro Asp Leu Glu Val Ala

385 390 395 400

Val Gly Thr Leu Leu Pro Leu Leu Leu Asp Pro Gly Asn Pro Ile Ala

405 410 415

Val Arg Phe Gln Gln Thr Ser Gly Met Val Met Ala Lys Gly Val Glu

420 425 430

Asp Thr Ala Phe Tyr Arg Tyr Thr Arg Leu Gly Thr Leu Thr Glu Val

435 440 445

Gly Ala Glu Pro Thr Glu Phe Ser Val Ser Thr Ala Glu Phe His Gln

450 455 460

Arg Met Ala Arg Arg Gln Gln Glu Leu Pro Leu Ser Met Thr Thr Met

465 470 475 480

Ser Thr His Asp Thr Lys Arg Ser Glu Asp Ala Arg Ala Arg Ile Ser

485 490 495

Val Ile Ala Glu Leu Pro Glu Glu Trp Ala Asp Thr Leu Ala Thr Leu

500 505 510

Arg Gly Leu Ala Pro Ile Pro Asp Gly Pro Tyr Glu Asn Leu Leu Trp

515 520 525

Gln Ala Val Val Gly Ala Trp Pro Ala Ser Arg Glu Arg Leu Gln Gly

530 535 540

Tyr Ala Glu Lys Ala Ala Arg Glu Ala Gly Asn Ser Thr Thr Trp Thr

545 550 555 560

Ser Pro Asp Glu Asp Phe Glu Ser Ser Val Lys Ala Ala Val Asp Ala

565 570 575

Val Phe Asp Asp Gly Arg Val Thr Lys Ala Val Glu Asp Phe Val Ala

580 585 590

Arg Ile Asp Ser Tyr Ala Ala Ser Asn Ser Val Ser Ala Lys Leu Val

595 600 605

Gln Leu Thr Met Pro Gly Val Pro Asp Val Tyr Gln Gly Ser Glu Phe

610 615 620

Trp Glu Arg Ser Leu Thr Asp Pro Asp Asn Arg Arg Pro Val Asp Phe

625 630 635 640

Glu Val Arg Arg Gln Glu Leu Ala Lys Leu Asp Ala Gly Thr Leu Pro

645 650 655

Ala Ala Gly Thr Glu Pro Ser Lys Leu Leu Ala Thr Ser Arg Ala Leu

660 665 670

Arg Leu Arg Arg Asp Arg Pro Glu Leu Phe Gln Gly Tyr Ser Pro Val

675 680 685

Thr Ala Thr Gly Pro Ala Ala Asp His Val Leu Ala Phe His Arg Gly

690 695 700

Gly Asp Gly Ala Leu Gly Ala Leu Thr Leu Ala Thr Arg Leu Pro Ala

705 710 715 720

Gly Leu Ala Ala Asp Gly Gly Trp Arg Asp Thr Ala Val Glu Leu Pro

725 730 735

Val Ala Val Cys Asp Glu Leu Thr Gly Asn Ala Tyr Gly Pro Gly Ser

740 745 750

Val Pro Val Ala Glu Val Leu Gly Thr Tyr Pro Val Ala Leu Leu Val

755 760 765

Pro Ala Asp Gly Glu Lys Ala

770 775

<210> 3

<211> 1770

<212> DNA

<213> Arthrobacter oxydans

<400> 3

atgaccctcg tcaatggcgg gcccgagcgc ttcgacgtct gggctcccga cgctaaatcc 60

gtgatactgc tggccggcgg ccagcagtat cccatggagg aaaaggacac ggcgcctggc 120

tctgaaggct ggtggacagc cccggacgct ccgggtggcg gtgaggtgga ctacggctac 180

ctgctggacg gtgacagtca cccagttccc gatccgcggt cgcgccgcct gcccgccggc 240

gtccatgagc tctccaggac gttcgacccc gcagcccacg cctggcagga ctccggctgg 300

aagggcaagg agctgaaggg ttcggtaatc tacgaactcc acatcggcac cttcacccct 360

gagggaaccc ttgacgctgc agccgaaaag ctcggctacc ttgcggacct gggaatcgac 420

tttgtcgagc tgctcccggt caatggcttc aacgggaccc acaactgggg ctacgacggc 480

gtccagtggt acgcggtcca tgaaggctac ggcgggcctg cggcctacca gcgctttgtg 540

gatgctgccc acgccgccgg cctgggcgtc atccaggacg tggtgtacaa ccacctcggc 600

ccgagcggaa actacctgtc caagttcggc ccgtacctga aacaggggga tgccaacacc 660

tggggtgact ccgtgaacct ggacggtccc ggctccgacg tggtgcggga atacatcctg 720

gacaaccttg ccctctggct ccgggattac cacgtggacg gcctccgcct ggacgccgtg 780

cacgcgctga aggacgagcg cgccgtgcac atccttgagg agttcggggc cctgggcgac 840

gccgtctcgg cggagaccgg gctgccgaag accctgattg ccgagtcgga cctgaacaac 900

ccccgcctgc tttacccgcg ggacgtcaac gggtacgggc tggccgggca gtggagcgac 960

gacttccacc acgcggtcca cgtcagcgtc agcggcgaga ccaccgggta ctacgaggac 1020

ttccagtccc tggcggtgct ggcaaaggtc ctgaaggacg gcttcctgca cgacggcagc 1080

tactccagct tccgcggccg gcaccacggc cggcctatca atgcctcgct ggtgcaccct 1140

gcggcgctgg tggtctgcaa ccagaaccac gaccagatcg gcaaccgcgc cacgggggac 1200

aggctctcgc agtcgctgtc ccacgggcag ctggccgtgg ccgccgtgct caccctgacg 1260

tccccgttca cgcccatgct gttcatgggc gaggagtttg cggccagcac cccttggcag 1320

ttcttcacct cccacccgga gccggagctg ggcaaggcta ccgcggaagg ccggatcaag 1380

gagttcgagc gcatggggtg ggatcccgcc gtcgtgcccg acccccagga tccggaaacc 1440

ttccgccggt ccaagctgga ctggaacgag tcctcaggcg gggaccacgc acggctcctg 1500

gagctttacc gctccctcac ggcgctgcgc cgcgggcacc ccgagcttgc cgggctcggc 1560

ttcaccgaga cggacgtgac gttcgacgac gacgccggct ggccgcgttt ccgccgcgga 1620

agcgttgagg tactgctgaa cctctcagac gccaaggtgc ggctggagga cgtttccggg 1680

acggtgctgc ttgcaacgga cgagggaacc ggccttgacg gcgaggccct cgccctggcg 1740

ccctggagtg cggcaatcgt caaatcctga 1770

<210> 4

<211> 589

<212> PRT

<213> Arthrobacter oxydans

<400> 4

Met Thr Leu Val Asn Gly Gly Pro Glu Arg Phe Asp Val Trp Ala Pro

1 5 10 15

Asp Ala Lys Ser Val Ile Leu Leu Ala Gly Gly Gln Gln Tyr Pro Met

20 25 30

Glu Glu Lys Asp Thr Ala Pro Gly Ser Glu Gly Trp Trp Thr Ala Pro

35 40 45

Asp Ala Pro Gly Gly Gly Glu Val Asp Tyr Gly Tyr Leu Leu Asp Gly

50 55 60

Asp Ser His Pro Val Pro Asp Pro Arg Ser Arg Arg Leu Pro Ala Gly

65 70 75 80

Val His Glu Leu Ser Arg Thr Phe Asp Pro Ala Ala His Ala Trp Gln

85 90 95

Asp Ser Gly Trp Lys Gly Lys Glu Leu Lys Gly Ser Val Ile Tyr Glu

100 105 110

Leu His Ile Gly Thr Phe Thr Pro Glu Gly Thr Leu Asp Ala Ala Ala

115 120 125

Glu Lys Leu Gly Tyr Leu Ala Asp Leu Gly Ile Asp Phe Val Glu Leu

130 135 140

Leu Pro Val Asn Gly Phe Asn Gly Thr His Asn Trp Gly Tyr Asp Gly

145 150 155 160

Val Gln Trp Tyr Ala Val His Glu Gly Tyr Gly Gly Pro Ala Ala Tyr

165 170 175

Gln Arg Phe Val Asp Ala Ala His Ala Ala Gly Leu Gly Val Ile Gln

180 185 190

Asp Val Val Tyr Asn His Leu Gly Pro Ser Gly Asn Tyr Leu Ser Lys

195 200 205

Phe Gly Pro Tyr Leu Lys Gln Gly Asp Ala Asn Thr Trp Gly Asp Ser

210 215 220

Val Asn Leu Asp Gly Pro Gly Ser Asp Val Val Arg Glu Tyr Ile Leu

225 230 235 240

Asp Asn Leu Ala Leu Trp Leu Arg Asp Tyr His Val Asp Gly Leu Arg

245 250 255

Leu Asp Ala Val His Ala Leu Lys Asp Glu Arg Ala Val His Ile Leu

260 265 270

Glu Glu Phe Gly Ala Leu Gly Asp Ala Val Ser Ala Glu Thr Gly Leu

275 280 285

Pro Lys Thr Leu Ile Ala Glu Ser Asp Leu Asn Asn Pro Arg Leu Leu

290 295 300

Tyr Pro Arg Asp Val Asn Gly Tyr Gly Leu Ala Gly Gln Trp Ser Asp

305 310 315 320

Asp Phe His His Ala Val His Val Ser Val Ser Gly Glu Thr Thr Gly

325 330 335

Tyr Tyr Glu Asp Phe Gln Ser Leu Ala Val Leu Ala Lys Val Leu Lys

340 345 350

Asp Gly Phe Leu His Asp Gly Ser Tyr Ser Ser Phe Arg Gly Arg His

355 360 365

His Gly Arg Pro Ile Asn Ala Ser Leu Val His Pro Ala Ala Leu Val

370 375 380

Val Cys Asn Gln Asn His Asp Gln Ile Gly Asn Arg Ala Thr Gly Asp

385 390 395 400

Arg Leu Ser Gln Ser Leu Ser His Gly Gln Leu Ala Val Ala Ala Val

405 410 415

Leu Thr Leu Thr Ser Pro Phe Thr Pro Met Leu Phe Met Gly Glu Glu

420 425 430

Phe Ala Ala Ser Thr Pro Trp Gln Phe Phe Thr Ser His Pro Glu Pro

435 440 445

Glu Leu Gly Lys Ala Thr Ala Glu Gly Arg Ile Lys Glu Phe Glu Arg

450 455 460

Met Gly Trp Asp Pro Ala Val Val Pro Asp Pro Gln Asp Pro Glu Thr

465 470 475 480

Phe Arg Arg Ser Lys Leu Asp Trp Asn Glu Ser Ser Gly Gly Asp His

485 490 495

Ala Arg Leu Leu Glu Leu Tyr Arg Ser Leu Thr Ala Leu Arg Arg Gly

500 505 510

His Pro Glu Leu Ala Gly Leu Gly Phe Thr Glu Thr Asp Val Thr Phe

515 520 525

Asp Asp Asp Ala Gly Trp Pro Arg Phe Arg Arg Gly Ser Val Glu Val

530 535 540

Leu Leu Asn Leu Ser Asp Ala Lys Val Arg Leu Glu Asp Val Ser Gly

545 550 555 560

Thr Val Leu Leu Ala Thr Asp Glu Gly Thr Gly Leu Asp Gly Glu Ala

565 570 575

Leu Ala Leu Ala Pro Trp Ser Ala Ala Ile Val Lys Ser

580 585

Claims

1. malt oligosaccharide based mycose hydrolytic enzyme expressing gene MTHase, nucleotide sequence is as shown in SEQ ID NO.3.

2. malt oligosaccharide based mycose hydrolytic enzyme MTHase described in claim 1, aminoacid sequence is as shown in SEQ ID NO.4.

3. a kind of recombinant expression carrier, it is characterised in that expressing gene described in claim 1 is inserted in expression vector MTHase。

4. recombinant expression carrier as claimed in claim 3, it is characterised in that the expression vector is expression vector pET-22b (+)。

5. a kind of reconstitution cell, containing above-mentioned recombinant expression carrier.

6. reconstitution cell as claimed in claim 5, it is characterised in that described reconstitution cell is by above-mentioned expression vector is turned Change competence e. coli bl21 (DE3) to obtain afterwards.

7. malt oligosaccharide based mycose hydrolytic enzyme MTHase described in expressing gene MTHase, claim 2 described in claim 1, Application of the reconstitution cell described in claim 5 in production trehalose is prepared.