CN106497937A - Cabbage type rape nuclear factor NF YA gene BnNF YA9 and its application - Google Patents
Cabbage type rape nuclear factor NF YA gene BnNF YA9 and its application Download PDFInfo
- Publication number
- CN106497937A CN106497937A CN201610872209.6A CN201610872209A CN106497937A CN 106497937 A CN106497937 A CN 106497937A CN 201610872209 A CN201610872209 A CN 201610872209A CN 106497937 A CN106497937 A CN 106497937A
- Authority
- CN
- China
- Prior art keywords
- bnnf
- gene
- arabidopsis
- type rape
- cabbage type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8291—Hormone-influenced development
- C12N15/8293—Abscisic acid [ABA]
Abstract
The invention discloses cabbage type rape nuclear factor NF YA gene BnNF YA9 and its application.A kind of cabbage type rape nuclear factor NF YA gene BnNF YA9, it is characterised in that with the CDS sequences as shown in SEQ ID NO.1, with the cDNA sequence as shown in SEQ ID NO.2.Its protein for encoding, with the amino acid sequence as shown in SEQ ID NO.3.Described cabbage type rape nuclear factor NF YA gene BnNF YA9 overexpression plant pair salt, arid and ABA process show resistance, and the abiotic stress regulatory process of BnNF YA9 involved in plant is described.
Description
Technical field
The invention belongs to genetic engineering field, be related to cabbage type rape nuclear factor NF-YA genes BnNF-YA9 and its
Application.
Background technology
The abiotic stresses such as arid, high salt are the main stress factors for affecting plant growth and crop yield.So people
Always search for for a long time effective measures come cultivate can resist abiotic stress and under various adverse circumstances grow farming
Thing.With the development of molecular biology, crops adversity gene is improved using genetic engineering, cultivate the new product with anti-adversity ability
Planting becomes a kind of feasible scheme.
Gene expression in each bion body is to be limited to cause with environmental stimuli and strict by space-time
Adjust and control.Transcription factor (Transcription Factor) is also called trans-acting factor, refers to that those have same
The protein of the cis-acting elements specific binding activity in eukaryotic gene promoter, it is compiled by transcription factor gene
Code.The class protein for being known as transcription factor of controlling gene expression in eucaryote body, it can activate downstream phase
The transcription of correlation gene.Become one kind and have very much using the transcription factor improvement of activation adversity gene and the comprehensive resistance of enhancing plant
The method of potentiality.
Initially in plant, report NF-Ys genes can trace back to last century the nineties.NF-Y(Nuclear factor
Y it is) a class transcription factor, belongs to the i.e. CBF of CCAAT box binding factor family (CCAAT box binding factor) and exist
In high eucaryote, it is also referred to as HAP (Heme-associated proteins)：It is by three subunit's groups
Into being NF-YA (animals and plants)/CBF-B (filamentous fungi)/HAP2 (yeast), NF-YB/CBF-A/HAP3 and NF-YC/ respectively
CBF-C/HAP5.These three subunits can form the complex of trimerization, and the compound physical efficiency is suitable with downstream gene promoter region
Formula functional element CCAAT box is combined, and is expressed so as to regulate and control which.In fungi and animal, each subunit is generally individually by a list
Only gene code；However, in plant, either monocotyledon or dicotyledon are multiple Sequences similars
One subunit of gene code, so that form a gene family.
NF-YA (CBF-B or HAP2) is a subunit of transcription regulatory factor NF-Y, it with two other subunit NF-YB,
NF-YC constitute heterotrimer, be incorporated on the CCAAT box of downstream gene jointly, so as to activate or suppressor expression.
CCAAT-box is normally at promoter transcription initiation site (TSS) -60～-100bp of upstream places, is the basic tune in promoter
One of control element.NF-Y is a very conservative class transcription regulatory factor, and each subunit has its specific conservative region.NF-
The conservative region of YA is located at C-terminal, and the region is responsible for being combined with DNA sequence dna, and guiding NF-YB/NF-YC heterodimers are incorporated into
CCAAT-box.With regard to the heterotrimeric assemblings of NF-Y, a kind of possible assembling process is as shown in Figure 1-2：NF-YB first with
NF-YC combines to form heterodimer, and then NF-YA combines to form complete NF-Y with heterodimer again, and finally transcription is adjusted
Control factor NF-Y is combined with the CCAAT box of downstream gene.Research finds that NF-YA is similar to the protein structure of CO in arabidopsis.
CO equally can combine to form a tripolymer with NF-YB, NF-YC, and the tripolymer is incorporated in the promoter of FT genes
On CCAAT box, and activate the expression of FT genes.When to NF-YA overexpression, it is repressed existing that plant can show FT genes
As.This explanation NF-YA and CO in the plant body is the relation that vies each other, the NF-YA of great expression can competitively with NF-
YB/NF-YC heterodimers are combined, and so as to cause missing the target for CO, and then inhibit the expression of FT genes.
Content of the invention
It is an object of the invention to provide a kind of cabbage type rape gene nuclear factor NF-YA genes BnNF-YA9 and its should
With.
The purpose of the present invention can be achieved through the following technical solutions：
A kind of cabbage type rape nuclear factor NF-YA gene BnNF-YA9, its CDS sequence is as shown in SEQ ID NO.1.
Described cabbage type rape nuclear factor NF-YA genes BnNF-YA9 is with cabbage type rape " southern salt oil 1 "
CDNA is template, with BnNF-YA9-F and BnNF-YA9-R as primer, is obtained by PCR amplifications.
BnNF-YA9-F：5'GAAGATCTATGCAAGTGCCAACA 3'
BnNF-YA9-R：5'GGACTAGTCGTCCCTGACATGCT 3'
The protein of above-mentioned cabbage type rape nuclear factor NF-YA genes BnNF-YA9 codings, with such as SEQ ID
Amino acid sequence shown in NO.3.
One kind contains cabbage type rape nuclear factor NF-YA gene BnNF-YA9 recombinant vectors of the present invention.
Described recombinant vector, is that cabbage type rape nuclear factor NF-YA genes BnNF-YA9 is inserted expression vector
Gained between I restriction enzyme site of Bgl II and Spe of pCAMBIA1302.
A kind of Agrobacterium tumefaciems EHA105 containing described cabbage type rape nuclear factor NF-YA genes.
Above-mentioned recombinant vector is preferably proceeded in Agrobacterium tumefaciems EHA105 by described Agrobacterium tumefaciems through electricity.
Above-mentioned cabbage type rape nuclear factor NF-YA genes BnNF-YA9 improve plant salt tolerance, drought-resistant and/or
Application in anti-Exogenous ABA.
Above-mentioned application, preferably will carry containing cabbage type rape nuclear factor NF-YA gene BnNF-YA9 CDS restructuring
The Agrobacterium tumefaciems EHA105 of body, proceeds in arabidopsis, how to obtain homozygote for screening after breeding.
Cabbage type rape nuclear factor NF-YA genes BnNF-YA9 of the present invention is improving plant salt tolerance, resistance to dry
Application in non-irrigated and/or anti-Exogenous ABA.
Described Agrobacterium tumefaciems EHA105 is proceeded to wildtype Arabidopsis thaliana through many by a kind of method for building salt tolerant arabidopsis
The homozygote for obtaining is screened after generation breeding is salt tolerant arabidopsis.
Described Agrobacterium tumefaciems EHA105 is proceeded to wildtype Arabidopsis thaliana warp by a kind of method for building drought-resistant arabidopsis
Screen, after many generation breedings, the homozygote for obtaining and be drought-resistant arabidopsis.
Described Agrobacterium tumefaciems EHA105 is proceeded to wild type and intends south by a kind of method for building the arabidopsis of resistance to Exogenous ABA
Mustard is screened, after many generation breedings, the homozygote for obtaining and is the arabidopsis of resistance to Exogenous ABA.
Beneficial effect：
Present invention clone obtains a new gene sequence, is named as BnNF-YA9, and the CDS total lengths of the gene are 699bp, compile
232 amino acid of code.By the preliminary sequence analysis shows to the gene, BnNF-YA9 is a NF-YA gene, with two
The helix domain A1 and A2 of difference in functionality.Wherein A1 can be interacted with NF-YB/C subunits, the distinguished sequence CCAAT box of A2
Interact with DNA.
The over-express vector of BnNF-YA9 is built, is mediated using Agrobacterium EHA105, wild type plan is infected using colored method is dipped in
Southern mustard (Col-0).BnNF-YA9 transgenic homozygous bodies are successfully obtained through the screening in excessive generation.
Every Physiological Experiment is carried out to the transgenic homozygous body arabidopsis of BnNF-YA9, is as a result shown：The mistake of BnNF-YA9
Expression plant pair salt, arid and ABA process show resistance.The abiotic stress regulatory mistake of BnNF-YA9 involved in plant is described
Journey.
Description of the drawings
Fig. 1, the amplification of cabbage type rape gene BnNF-YA9 sequences；
Fig. 2, PCR verify expression of the transfer-gen plant on transcriptional level.
The germination rate of Fig. 3, the lower transgenic arabidopsis strain of adverse circumstance process and wildtype Arabidopsis thaliana.
Total root of Fig. 4, the lower transgenic arabidopsis strain of adverse circumstance process and wildtype Arabidopsis thaliana is long.
Total tip of a root number of Fig. 5, the lower transgenic arabidopsis strain of adverse circumstance process and wildtype Arabidopsis thaliana.
The elongation of the root of Fig. 6, the lower transgenic arabidopsis strain of adverse circumstance process and wildtype Arabidopsis thaliana.
Specific embodiment
1. the clone for implementing NF-YA gene BnNF-YA9
Design primer sequence is as follows：
BnNF-YA9-F1：5'ACAATGCAAGTGCCAACA 3'
BnNF-YA9-R1：5'CTGGAGCAAGATTATGAC 3'
DNA with cabbage type rape ' southern salt oil 1 ' is expanded as template with the primer of designed rape BnNF-YA9
Increase, its PCR system is as follows with response procedures：
PCR primer clicks and enters electrophoresis in 1% Ago-Gel, obtains the specific band of about 722bp or so, as shown in Figure 1.
Purpose fragment is carried out cutting glue reclaim, connects cloning vector pMD19-T, positive strain is delivered the sequencing of Jin Weizhi companies, its CDS
Sequence as shown in SEQ ID NO.1, cDNA sequence as shown in SEQ ID NO.2, the protein amino acid sequence such as SEQ ID of coding
Shown in NO.3., analyzed by online DNA folding predictions, determine that newcomer BnNF-YA9 has typical case's knot of NF-YA gene families
Structure.
The structure of 2 NF-YA gene BnNF-YA9 over-express vectors of embodiment
As BnNF-YA9 is encoding gene, so the 35S being inserted in over-express vector pCAMBIA1302 and GFP
Connect together to form a fusion protein with GFP in gene and by which, need to remove the terminator codon of BnNF-YA9.According to
Restriction enzyme site on carrier in the sequence of existing restriction enzyme site and BnNF-YA9, we select Bgl II and Spe I restricted interior
Enzyme cutting, the primer of design are as follows, and restriction enzyme site is as shown in underscore：
BnNF-YA9-F2：5'GAAGATCTATGCAAGTGCCAACA3'
BnNF-YA9-R2：5'GGACTAGTCGTCCCTGACATGCT 3'
Sequence with SEQ ID NO.2 enters performing PCR amplification as template with high-fidelity enzyme, and reaction system is as follows：
PCR primer clicks and enters electrophoresis in 1% Ago-Gel, obtains the single band that length is about 715bp or so, and pre-
The size of phase is identical.By on the gene fragment clone to the flat ends vectors of pEASY-Blunt, (concrete operations are with reference to pEASY-
Blunt Cloning Kit specifications are carried out), that is, obtain cloning vector pEASY-B-BnNF-YA9.
PEASY-B-BnNF-YA9 and zero load pCAMBIA1302 use Bgl II and I digestion with restriction enzyme of Spe respectively, so
Afterwards by digestion after the single fragments of pCAMBIA1302 and cloning vector in BnNF-YA9 fragments reclaim, then use T4 ligases
The two enzyme is connected, that is, obtains expression vector pCAMBIA1302-BnNF-YA9, expression vector converts thin to E. coli competent
In born of the same parents DH5 α (TAKARA D9057S), positive colony is selected, deliver company's sequencing.Sequencing result correctly shows vector construction
Success.
Embodiment 3.BnNF-YA9 arabidopsis transgenosis
1st, colored method (agriculture bacillus mediated) arabidopsis thaliana transformation is dipped in
The operating procedure for dipping in colored method arabidopsis thaliana transformation is as follows：
Agrobacterium infects the preparation of re-suspension liquid：Sucrose (50mg L-1), silwet L-77 (0.02%, V/V), Agrobacterium
Thalline, sterilized water；The Agrobacterium line activation containing destination gene expression carrier of preservation (there are the solid YEP cultures of antibiotic
Base), picking monoclonal is inoculated in YEP fluid nutrient mediums (Kan (the 50mg L of 50mL added with antibiotic-1) and Str (50mg L-1)), 28 DEG C of constant-temperature tables, 200rpm cultivate 2d, to OD600=0.8～1.5；Collects thalline：Take above-mentioned bacterium solution 10mL packing
In the centrifuge tube of 2mL, 4000～6000rpm is centrifuged 3～4min, abandons the culture medium on upper strata, resuspended with isopyknic re-suspension liquid
Thalline；Drawn with disposable glue head dropper and infect bacterium solution, on the careful bud for instilling arabidopsis, it is ensured that whole titbit is all infiltrated
(flower that has bloomed need to be cut when infecting for the first time)；Arabidopsis after infecting puts polybag, 12～24h of light culture；
Remove 5～7d of normal culture after polybag, then carry out secondary infection, same plant continuously can be infected 2～3 times, be turned with increasing
The efficiency of change；The arabidopsis that conversion is 2～3 times recovers normal and cultivates, and wipes out the lateral bud for newly growing in time.In arabidopsis Later growth
Can water on a small quantity, to accelerate arabidopsis ripe；When a small amount of silique starts to turn yellow, whole strain arabidopsis is encased with envelope, accelerated
Seed maturity；Collect seed：The removal of impurity is gone, clean seed is loaded in 1.5mL centrifuge tubes, is deposited in 4 DEG C of refrigerators.
2nd, the screening of arabidopsis transgenic positive seedling.
Preparatory work of experiment：70% alcoholic solution, sterilized water, the pipette tips of sterilizing, the MS solid medium (Hyg containing antibiotic
Concentration is 25mg L-1)；Transgenic arabidopsis seed to be screened in right amount is taken in 10mL centrifuge tubes, deionized water immersion is added
At least 30min；In aseptic super-clean bench, 70% alcohol-pickled arabidopsis seed 2min uses sterilized water after going upper solution
Rinse 5～6 times；The seed coating of sterilizing is drawn on MS flat boards with aseptic pipette tips, appropriate amounts of sterilized water is added, is jiggled flat
Plate makes seed as far as possible sprawl to come, carefully draw unnecessary sterilized water；Seed-bearing for paving flat board is uncapped and is positioned in super-clean bench,
The moisture of media surface is dried up, then flat board is sealed, 4 DEG C of placement 2d；Seed after cold treatment is positioned over long-day (16-h
Light/8-h dark), 7～10d is cultivated in 22～24 DEG C of environment, (positive seedling plant type is larger to select the arabidopsis that grows fine
And root system is longer), it is transplanted in matrix and grows；When arabidopsis has certain biomass, collection blade extracts RNA, and carries out
Positive seedling checking.
3rd, the identification of arabidopsis transgenic positive seedling
By PCR amplification checking transgenic positive seedlings.
Because gene BnNF-YA9 is together with the GFP Gene Fusions on expression vector pCAMBIA1302, transcription is produced
Thing will be BnNF-YA9-GFP, and therefore can design the following primer of primer is：Forward primer in BnNF-YA9 regions,
Reverse Primer are in GFP regions.The checking primer of genes of interest is as follows：
35S-BnNF-YA9-F:5'ATGGCTTCTTGGCTCCT3'
GFP-R:5'TTCCGTATGTTGCATCACCT3'
In order to more accurately verify transgenic positive seedling, can verify that the fragment of amplification carries out sequencing analysis to PCR.PCR
The result is as shown in Figure 2.
4th, the screening of arabidopsis transgenic homozygous body
Seed that 40 or so individual plants collect (F3 generation) is taken respectively, according to the method for screening transgenic positive seedling in step 2
Seed is processed, and seed is positioned over on resistant MS solid mediums.Seed after cold treatment is positioned over the long-day
(16-h light/8-h dark), cultivates 7～10d in 22～24 DEG C of environment.The strain that all seedling all grow fine is as pure
Fit strain, will determine as seedling replanting continued growth in matrix of homozygote strain, waits and collects follow-on seed.
2 35S are filtered out::The number of the homozygote strain of BnNF-YA2 is 4.
The germination percentage of embodiment 4.BnNF-YA9 arabidopsis transgenic line is determined
Transgenic arabidopsis and wild type (WT) vegetable seeds are carried out disinfection, with the random picking of the toothpick that sterilized, each turns
50 seeds of gene strain, put respectively and are multicast to containing variable concentrations NaCl (50mM, 100mM and 150mM), mannitol
In (150mM, 200mM and 250mM), ABA (0.1 μM, 0.2 μM and 0.3 μM) and the MS flat boards of blank CK, observation seed is sprouted
Send out the sensitiveness to NaCl, arid and ABA.After program request, seed places 3d in 4 DEG C of refrigerators, and flat board is just put, greenhouse (22 DEG C) just
Often cultivate.It is considered as sprouting when seed young root has passed kind of a skin, daily the germination rate of statistics seed.The arabidopsis of BnNF-YA9
The germination rate such as Fig. 3 of transgenic homozygous body in the case where blank CK, 100mM NaCl, 200mM mannitol and 0.2 μM of ABA are processed
Shown, as a result show turn BnNF-YA9 arabidopsis transgenic line tie up to these three process under sprouting speed be all not less than wild
Type, shows resistance to adverse circumstance process.
The root elongation of embodiment 5.BnNF-YA9 arabidopsis transgenic line is determined
Transgenosis and wild type seeds after sterilizing, point are multicast to sprout in MS flat boards.After seed is sprouted, carefully will with toothpick
Wild type and transgenic line each 3 sprouting seedling be transferred to respectively plus NaCl, mannitol, the MS solid plates of ABA in, per
Individual process does 3 groups of biological repetitions.The concentration of NaCl is respectively set as 50mM, 100mM and 150mM, and the concentration of mannitol is set respectively
It is set to 150mM, 200mM and 250mM, the concentration of ABA is respectively set as 0.1 μM, 0.2 μM and 0.3 μM.Once root was measured per 2 days
The length of growth, is counted 5 times altogether, and the time point of measurement need to be consistent (such as 10 every time:00).Multiple measurement results are made even
Average, calculates the elongation of root.The elongation statistics of root is as shown in fig. 6, it is found that in three kinds of abiotic sides of body from figure
Under compeling to process (NaCl, mannitol, ABA), the root elongation of the arabidopsis transgenic line of BnNF-YA9 is higher than wild type.
The root system scanning of embodiment 6.BnNF-YA9 arabidopsis transgenic line
The transgenosis and wild-type Arabidopsis plants for determining the elongation for completing root in embodiment 5 respectively is removed, and is put into
In transparent square plastic flat board equipped with clear water.Carefully the root system of every plant of arabidopsis is separated with toothpick, and be put into root system scanning
Root system scanning is carried out in instrument, finally obtains and record the data such as total root length (Length), tip of a root number (Tips).Statistic analysis result
As shown in Figure 4 and Figure 5, under NaCl, mannitol and ABA process, total root length of the arabidopsis of overexpression BnNF-YA9, tip of a root number
Will be higher than wild type.Arabidopsis plant so as to show overexpression BnNF-YA9 is resistant to abiotic stress.
Claims (10)
1. a kind of cabbage type rape nuclear factor NF-YA gene BnNF-YA9, it is characterised in that its CDS sequence such as SEQ ID
Shown in NO.1.
2. the protein that the cabbage type rape nuclear factor NF-YA genes BnNF-YA9 described in claim 1 is encoded, its feature
It is with the amino acid sequence as shown in SEQ ID NO.3.
3. a kind of recombinant vector of the cabbage type rape nuclear factor NF-YA gene BnNF-YA9 containing described in claim 1.
4. recombinant vector according to claim 3, it is characterised in that the Wild cabbage type rape kernet described in claim 1 is transcribed
Gained between I restriction enzyme site of Bgl II and Spe of factor NF-YA gene BnNF-YA9 insertion expression vector pCAMBIA1302.
5. a kind of crown gall agriculture bar of the cabbage type rape nuclear factor NF-YA gene BnNF-YA9 containing described in claim 1
Bacterium EHA105.
6. Agrobacterium tumefaciems according to claim 5, it is characterised in that the recombinant vector described in claim 4 is turned through electricity
Change and proceed in Agrobacterium tumefaciems EHA105.
7. the cabbage type rape nuclear factor NF-YA genes BnNF-YA9 described in claim 1 is improving plant to salt, arid
And/or the application in Exogenous ABA resistance.
8. a kind of build salt tolerant arabidopsis method, it is characterised in that by the Agrobacterium tumefaciems EHA105 described in claim 5 turn
Entering wildtype Arabidopsis thaliana, the homozygote for obtaining as salt tolerant arabidopsis is screened after many generation breedings.
9. a kind of method for building drought-resistant arabidopsis, it is characterised in that by the Agrobacterium tumefaciems EHA105 described in claim 5
Proceeding to wildtype Arabidopsis thaliana, the homozygote for obtaining as drought-resistant arabidopsis is screened after many generation breedings.
10. a kind of build the arabidopsis of resistance to Exogenous ABA method, it is characterised in that by the Agrobacterium tumefaciems described in claim 5
EHA105 proceeds to wildtype Arabidopsis thaliana and screens the homozygote for the obtaining as arabidopsis of resistance to Exogenous ABA after many generation breedings.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610872209.6A CN106497937B (en) | 2016-09-30 | 2016-09-30 | Cabbage type rape nuclear factor NF-YA gene BnNF-YA9 and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610872209.6A CN106497937B (en) | 2016-09-30 | 2016-09-30 | Cabbage type rape nuclear factor NF-YA gene BnNF-YA9 and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106497937A true CN106497937A (en) | 2017-03-15 |
| CN106497937B CN106497937B (en) | 2019-07-09 |
Family
ID=58290189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610872209.6A Active CN106497937B (en) | 2016-09-30 | 2016-09-30 | Cabbage type rape nuclear factor NF-YA gene BnNF-YA9 and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106497937B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113005217A (en) * | 2021-04-01 | 2021-06-22 | 中国农业科学院生物技术研究所 | ZmNF-YA8 gene SNP marker related to salt tolerance of corn and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104988158A (en) * | 2015-07-15 | 2015-10-21 | 南京农业大学 | Nuclear transcription factor NF-YA gene BnNF-YA12 of cabbage type rape and application thereof |
| CN105695482A (en) * | 2016-04-15 | 2016-06-22 | 南京农业大学 | Brassica napus nuclear transcription factor NF-YA gene BnNF-YA3 and application thereof |
-
2016
- 2016-09-30 CN CN201610872209.6A patent/CN106497937B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104988158A (en) * | 2015-07-15 | 2015-10-21 | 南京农业大学 | Nuclear transcription factor NF-YA gene BnNF-YA12 of cabbage type rape and application thereof |
| CN105695482A (en) * | 2016-04-15 | 2016-06-22 | 南京农业大学 | Brassica napus nuclear transcription factor NF-YA gene BnNF-YA3 and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| LI XU ET AL: "Multiple NUCLEAR FACTOR Y Transcription Factors Respond to Abiotic Stress in Brassica napus L.", 《PLOS ONE》 * |
| LIANG M ET AL: "AHI94936.1", 《GENBANK》 * |
| LIANG M ET AL: "KC787684.1", 《GENBANK》 * |
| MINGXIANG LIANG ET AL: "Identification and characterization of NF‑Y transcription factor families in Canola (Brassica napus L.)", 《PLANTA》 * |
| 徐妙云等: "植物miR169/NF-YA调控模块研究进展", 《遗传》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113005217A (en) * | 2021-04-01 | 2021-06-22 | 中国农业科学院生物技术研究所 | ZmNF-YA8 gene SNP marker related to salt tolerance of corn and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106497937B (en) | 2019-07-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101955521B (en) | Plant stress tolerance associated protein, and coded genes and application thereof | |
| CN107435047B (en) | Low-phosphorus-resistant key gene GmPHR25 in plant phosphorus signal network and application thereof | |
| CN104988158B (en) | Cabbage type rape nuclear factor NF-YA genes BnNF-YA12 and its application | |
| CN110643618A (en) | Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants | |
| CN105695482B (en) | Cabbage type rape nuclear factor NF-YA genes BnNF-YA3 and its application | |
| US20220106577A1 (en) | Modified plants containing combination of apyrase genes and method for making modified plants with combination of apyrase genes | |
| CN105294847A (en) | Stress tolerance-related protein of plants and encoding gene and application of stress tolerance-related protein | |
| CN109628475B (en) | Application of brassinolide synthetic gene PaCYP724B1 in regulation and control of plant branches | |
| CN106367433B (en) | Plant is improved to the method and its application of gibberellin inhibitor sensitiveness | |
| CN105802931A (en) | CRK4 protein and application of coded gene thereof in regulating and controlling growth of plant stems and leaves | |
| CN106497937A (en) | Cabbage type rape nuclear factor NF YA gene BnNF YA9 and its application | |
| CN104628840B (en) | Plant stress tolerance correlative protein VrDREB2A and its encoding gene and application | |
| CN103923922B (en) | Heavy metal evoked promoter is cultivating the application in heavy metal pollution of soil early warning transgenic plant | |
| CN106892973A (en) | Plant adversity resistance related protein GhMYB4 and encoding gene and application | |
| CN101993479B (en) | Plant stress tolerance related transcription factor TaWRKY1 as well as coding gene and application thereof | |
| CN104099355A (en) | Method for cultivating StP5CS salt-tolerance transgenic soybeans | |
| CN104711287B (en) | A kind of albumen for improving plant root hair generative capacity and its encoding gene and application | |
| US11932862B1 (en) | Genetic regulatory elements | |
| WO2022082865A1 (en) | Stress-resistant functional system acsedcdw for improving biological salt tolerance and drought resistance performance and use thereof | |
| CN103451193B (en) | Populus deltoidesx populus nigra PdHSP70 gene and application thereof | |
| WO2022082866A1 (en) | Stress-resistant gene line acdwem and use thereof in improvement of salt tolerance, drought resistance and high temperature resistance of crops | |
| CN108795973B (en) | Application of arabidopsis glycosyl transferase gene UGT79B8 in improving plant photosynthetic efficiency | |
| CN105802930A (en) | CRK5 protein and application of coded gene thereof in regulating and controlling growth of plant stems and leaves | |
| CN114517202A (en) | Application of aquaporin gene SlPIP1 and 2 in improving resistance of tomatoes to facility continuous cropping soil | |
| CN117736286A (en) | Pdecambp-1 proteins associated with plant organogenesis and biomass and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |