CN106480193B - Primers for molecular detection of alternaria citrea and detection method thereof - Google Patents
Primers for molecular detection of alternaria citrea and detection method thereof Download PDFInfo
- Publication number
- CN106480193B CN106480193B CN201610914813.0A CN201610914813A CN106480193B CN 106480193 B CN106480193 B CN 106480193B CN 201610914813 A CN201610914813 A CN 201610914813A CN 106480193 B CN106480193 B CN 106480193B
- Authority
- CN
- China
- Prior art keywords
- verticillium
- primers
- alternaria
- downstream
- upstream
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A primer for detecting a alternaria citrea molecule and a detection method thereof screen 2 specific genome DNA sequences in the alternaria citrea by using RAPD technology, and the obtained genome DNA sequences have higher specificity as shown by the fact that homologous sequence information is not obtained through Blast comparison analysis of NCBI database; then, specific primer design is carried out according to the sequence determination result, and a molecular detection system comprising 2 pairs of specific primers Cc-SP1 and Cc-SP2 is successfully established by utilizing SCAR-PCR technology. The invention establishes a PCR detection system of the alternaria citrea, and the method is rapid, accurate and high in sensitivity, and can be applied to identification and early prediction of the alternaria citrea.
Description
Technical Field
The invention relates to the technical field of agricultural biology, in particular to a primer for molecular detection of alternaria citrea and a detection method thereof.
Background
Citrus alternaria leaf spot (Citrus target spot) is a newly discovered destructive disease in the northest edge of Citrus producing areas in China-city and fixed counties (107.3E, 33.2N) in Shaanxi province in 2006. The disease only occurs in winter and spring, and the disease condition is more serious at lower temperature, and when the disease is serious, a plurality of disease spots are combined into large spots, the diseased leaves are easy to fall off until the whole plant dies, even the dead tree destroys the garden.
The pathogenic bacterium of citrus verticillium is Cryptosporiopsis citricarpa sp. Mainly harmful to citrus leaves and parts of twigs. At the early stage of the disease, reddish brown spots are generated on the leaf surface, then the disease spots gradually expand to become nearly round reddish brown disease spots, the middle parts of the disease spots gradually become white, and yellow halo is formed at the edges of the disease spots on the back of the leaf. The middle of the disease spot on the back of the leaf at the later stage is dense, dark brown and hairy, and the spots are arranged in a ring line shape. In severe cases, many diseased spots are combined into large spots, and the diseased leaves are easy to fall off.
Due to the limit of the cognition level of the citrus alternaria leaf spot, the citrus alternaria leaf spot cannot be diagnosed as soon as possible, and the control effect is not good for a long time, so that serious economic loss is caused. If the disease can be predicted and forecasted early, when the disease does not show obvious symptoms, measures are taken in time to effectively prevent and treat the disease in the bud, and the method has important significance for reducing economic loss caused by the disease.
Disclosure of Invention
In view of the above, an object of the present invention is to provide a primer for detecting a citrus alternaria molecule, so as to solve the problem of the primer used in the molecular detection of citrus alternaria.
The invention solves the technical problems by the following technical means:
a primer for molecular detection of citrus alternaria leaf spot is characterized in that specific upstream and downstream primers for molecular detection of citrus alternaria leaf spot are as follows:
Cc-SP 1-upstream: CCTTTCACAATGAAGCAGGAATAG
Cc-SP 1-downstream: GTGGCTGTACCATCCTTAGAAA
And/or
Cc-SP 2-upstream: GCTGATTGAGTGCCCATAGA
Cc-SP 2-downstream: ACTCCAACCAACGAGATGATAG are provided.
The invention also aims to provide a method for detecting the alternaria citrea, so as to solve the problems that the alternaria citrea can not be detected in an early stage and a quick and accurate detection method is unavailable.
The invention solves the technical problems by the following technical means:
the detection method of the verticillium citrosum comprises the following steps:
s1: 2 specific genome DNA sequences in the alternaria citrea are utilized to design and synthesize two pairs of specific upstream and downstream primers Cc-SP1 and Cc-SP2 in Primier 6 software; wherein the content of the first and second substances,
Cc-SP 1-upstream: CCTTTCACAATGAAGCAGGAATAG
Cc-SP 1-downstream: GTGGCTGTACCATCCTTAGAAA
And/or
Cc-SP 2-upstream: GCTGATTGAGTGCCCATAGA
Cc-SP 2-downstream: ACTCCAACCAACGAGATGATAG, respectively;
s2: adding the specific primers Cc-SP 1-upstream and Cc-SP 1-downstream of the verticillium citrosum obtained in the step S1 and 1 piece of genomic DNA corresponding to the primers into a PCR reaction system, and carrying out a plurality of circular reactions under the PCR reaction conditions;
and/or adding specific primers Cc-SP 2-upstream and Cc-SP 2-downstream of the verticillium citrosum obtained in the step S1 and 1 piece of genomic DNA corresponding to the primers into a PCR reaction system, and carrying out a plurality of circular reactions under the PCR reaction conditions;
s3: after the PCR reaction is finished, 5 mu L of amplification product is put into agarose gel which is added with Glodview in advance, electrophoresis is carried out under the condition of 100V voltage, observation and photographing are carried out on a BIO-RAD gel imaging system, and if fragments with the size of 224bp and/or 389bp can be detected, the verticillium citrosum can be judged.
Further, in S2, the total volume of the PCR reaction system was 20. mu.L, wherein 10. mu.L of 2 XTaq PCR Mix, the forward primer at a final concentration of 0.2. mu. mol/L, the reverse primer at a final concentration of 0.2. mu. mol/L, 100ng of genomic DNA, and ultrapure water were made up to 20. mu.L.
Further, in S2, the PCR reaction conditions were 94 ℃ for 5 minutes, 94 ℃ for 30 seconds, 55 ℃ for 30 seconds, 72 ℃ for 30 seconds, and 72 ℃ for 10 minutes for 35 cycles.
Further, in S3, the agarose gel concentration was 1.0%, and the electrophoresis time was 20 min.
Further, in S3, the nucleotide sequence of the 224bp sized fragment is shown in SEQ ID NO.1 of the sequence Listing.
Further, in S3, the nucleotide sequence of the 389 bp-sized fragment is shown as SEQ ID NO.2 of the sequence table.
The invention has the beneficial effects that: the molecular detection method for the citrus verticillium is established for the first time, and the detection method has the characteristics of short time, low cost, high sensitivity, strong specificity, high detection accuracy and the like; the detection system can be used for the inoculation of pathogenic bacteria of the citrus alternaria leaf spot, the specific molecular detection of field samples and the early rapid diagnosis.
Drawings
FIG. 1 is a PCR amplification electrophoresis chart of primers Cc-SP1(A) and Cc-SP2(B) on test strains, and is a chart of the result of verifying the specificity of primers for detecting Physarum citrosum, wherein M: DL 2000 DNA marker; lanes 1-9, c.citricarpa; alternatia alternata; colletotrichum gloeosporioides; diaporthe citri; alternaria tenuissima; aspergillus japonica; phyllosticta capitalensis; penicillium italicum; penicillium digitatum.
FIG. 2 is a PCR amplification electrophoretogram of primers Cc-SP1(A) and Cc-SP2(B) for test strains, and is a graph showing the sensitivity detection result of a primer specific to M: DL 2000 DNA marker; lanes 1-8 show the results of amplification with 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg and 10fg DNA in 20. mu.L of the system, respectively.
Detailed Description
The invention will be described in detail below with reference to the following drawings:
the first embodiment is as follows:
2 specific genome DNA sequences in the alternaria citrea are screened out by using RAPD technology. Through Blast comparison analysis of NCBI database, homologous sequence information is not obtained, which shows that the obtained genome DNA sequence has high specificity, and specific upstream and downstream primers are designed according to the sequence determination result:
Cc-SP 1-upstream: 5'-CCTTTCACAATGAAGCAGGAATAG-3'
Cc-SP 1-downstream: 5'-GTGGCTGTACCATCCTTAGAAA-3'
And
Cc-SP 2-upstream: 5'-GCTGATTGAGTGCCCATAGA-3'
Cc-SP 2-downstream: 5'-ACTCCAACCAACGAGATGATAG-3' are provided.
Example two:
a detection method for detecting the physalospora citrea by using molecules of 1 pair of specific primers Cc-SP1 is established by using the SCAR-PCR technology, and comprises the following steps:
s1: specific upstream and downstream primers Cc-SP 1-upstream and Cc-SP 1-downstream are designed and synthesized in Primier 6 software by using 1 genome DNA sequence in the citrus verticillium dahliae, wherein,
Cc-SP 1-upstream: 5'-CCTTTCACAATGAAGCAGGAATAG-3'
Cc-SP 1-downstream: 5'-GTGGCTGTACCATCCTTAGAAA-3' are provided.
S2: adding the specific primers Cc-SP 1-upstream and Cc-SP 1-downstream of the verticillium citreum obtained in the step S1 and 1 piece of genomic DNA corresponding to the primers into a PCR reaction system, and carrying out a plurality of circular reactions under the PCR reaction conditions. The total volume of the PCR reaction system is 20 mu L, wherein 10 mu L of 2 xTaq PCR Mix, the final concentration of the forward primer is 0.2 mu mol/L, the final concentration of the reverse primer is 0.2 mu mol/L, 100ng of genome DNA and ultrapure water are used for complementing 20 mu L. The PCR conditions were 94 ℃ for 5 minutes, 94 ℃ for 30 seconds, 55 ℃ for 30 seconds, 72 ℃ for 10 minutes, for 35 cycles.
S3: after the PCR reaction is finished, taking 5 mu L of amplification product, carrying out electrophoresis for 20min under the condition of 100V voltage in 1.0% agarose gel in which Glodview is added in advance, and observing and photographing on a BIO-RAD gel imaging system; if the fragment with the size of 224bp can be detected, the verticillium citrosum can be judged.
The nucleotide sequence of the 224bp fragment is shown as a sequence table SEQ ID NO.1 and comprises:
example three:
a detection method for detecting the physalospora citrea by using molecules of 1 pair of specific primers Cc-SP2 is established by using the SCAR-PCR technology, and comprises the following steps:
s1: specific upstream and downstream primers Cc-SP2 were designed and synthesized in Primier 6 software using 1 genomic DNA sequence in Phyllospora citricola, wherein,
Cc-SP 2-upstream: 5'-GCTGATTGAGTGCCCATAGA-3'
Cc-SP 2-downstream: 5'-ACTCCAACCAACGAGATGATAG-3' are provided.
S2: adding the specific primers Cc-SP 2-upstream and Cc-SP 2-downstream of the verticillium citreum obtained in the step S1 and 1 piece of genomic DNA corresponding to the primers into a PCR reaction system, and carrying out a plurality of circular reactions under the PCR reaction conditions. The total volume of the PCR reaction system is 20 mu L, wherein 10 mu L of 2 xTaq PCR Mix, the final concentration of the forward primer is 0.2 mu mol/L, the final concentration of the reverse primer is 0.2 mu mol/L, 100ng of genome DNA and ultrapure water are used for complementing 20 mu L. The PCR conditions were 94 ℃ for 5 minutes, 94 ℃ for 30 seconds, 55 ℃ for 30 seconds, 72 ℃ for 10 minutes, for 35 cycles.
S3: after the PCR reaction is finished, taking 5 mu L of amplification product, carrying out electrophoresis for 20min under the condition of 100V voltage in 1.0% agarose gel in which Glodview is added in advance, and observing and photographing on a BIO-RAD gel imaging system; if the segment with size of 389bp can be detected, the verticillium citrosum can be judged.
The nucleotide sequence of the 389bp fragment is shown as a sequence table SEQ ID NO.2 and comprises:
example four:
as shown in fig. 1-2, in order to verify the use effect of the molecular detection primers and the detection method for the zymophyte citrobacter, the following experiments were performed:
s1: respectively separating and culturing the citrus verticillium (C.citricarpa), citrus brown spot (Alternaria alternata), citrus anthracnose (Colletotrichioeposities), citrus black spot (Diaporthe citri), citrus sooty mold (Alternaria alternata), Aspergillus japonicus (Aspergillus japonicus), citrus black spot (Phyllosticapatiensis), citrus Penicillium (Penicillium italicum) and citrus green fungus (Penicillium citrinum) which can cause citrus diseases by adopting a conventional plant pathogen identification technology to obtain each pathogen purification strain.
S2: and extracting DNA of each pathogenic bacteria purified strain for later use.
Collecting about 1g of pathogenic bacteria hyphae, grinding by using liquid nitrogen, then adopting CTAB solution (2% (w/v) CTAB, 100mmol/L Tris-HCl (pH 8.0),20mmol/L EDTA,1.4mol/L NaCl,40mmol/L β -mercaptoethanol) to incubate fully ground hyphae under the condition of liquid nitrogen freezing for 60 minutes at 65 ℃, shaking occasionally, then adding isometric chloroform, slightly reversing and uniformly mixing, centrifuging at room temperature for 10 minutes at 12000r/min, sucking supernatant, adding isometric isopropanol, standing at-20 ℃ for 30 minutes after uniform mixing, centrifuging at 12000r/min for 10 minutes at room temperature, removing supernatant, rinsing precipitates by using 75% ethanol, adding 100uL TE buffer solution (10mmol/L Tris-HCl, 1mmol/L EDTA) after DNA is air-dried, and dissolving for standby.
S3: for verification of the detection primer specificity, the DNA of each pathogen-purified strain in the step S3 was used as a template, and multiple cycles of reactions were performed under PCR reaction conditions. The total volume of the PCR reaction system is 20 mu L, wherein 10 mu L of 2 xTaq PCRMix, the final concentration of 0.2 mu mol/L forward primer, the final concentration of 0.2 mu mol/L reverse primer, 100ng genome DNA and ultrapure water are complemented to 20 mu L. The PCR conditions were 94 ℃ for 5 minutes, 94 ℃ for 30 seconds, 55 ℃ for 30 seconds, 72 ℃ for 10 minutes, for 35 cycles.
S4: and (3) verifying the sensitivity of the detection system, namely sequentially diluting the genomic DNA of the alternaria citrea from 100 ng/mu L to 10 fg/mu L by 10 times, taking 1 mu L of each concentration as a template, and amplifying by using the optimized system.
And (4) analyzing results:
the detection primer specificity verification result is shown in fig. 1, only the lane of the citrus verticillium c.citricarpa has the amplified target bands of 224bp (Cc-SP1) and 389bp (Cc-SP2), respectively, and the designed primer is a specific primer and can detect the citrus verticillium from a plurality of pathogenic bacteria.
As shown in FIG. 2, the results of the sensitivity verification of the detection system show that 2 pairs of specific primers Cc-SP1 and Cc-SP2 can amplify specific bands of corresponding sizes from templates with mass concentrations of 100 pg/. mu.L and above, but cannot amplify specific bands from template DNA diluted to 100 pg/. mu.L or below and controls.
Although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the spirit and scope of the invention as defined in the appended claims.
----------------------- Page 1-----------------------
Sequence listing
SEQUENCELISTING
<110> university of southwest
<120> primers for molecular detection of alternaria citrea and detection method thereof
<130>02
<160>2
<170>PatentInversion 3.5
<210>1
<211>224
<212>DNA
<213> Artificial sequence
<400>1
cctttcacaatgaagcaggaatagatatgcttcgaataagactacgactataaattacag 60
atcagaaggaggaaacgggggtggtggtcgatcgactccaggacgtcaacatcgtcccct 120
aaatttaaacaccttggatccatttgcccccatttcgccgaaaccagaacgccagacttg 180
aggggtttgt ctcccctctt cctttctaaggatggtacagccac 224
<210>2
<211>389
<212>DNA
<213> Artificial sequence
<400>2
gctgattgagtgcccatagaaggatgccagctcacaggtcggctggtttttgacatctga 60
gttccgtcattggaaggtaccattcctcct gcgaagtgtt ctgccatcattgctcttctg 120
cggaatggtgcatctgtggt gaccgtcctccttctaccgagtcccattgagcctcgtggg 180
ctactgctcgcactgttcggcttgaccacacgcatcgacccactgggtct ctgaccggta 240
10
----------------------- Page 2-----------------------
gatcctcgagaacatctgcgtgataggttt gaagaggccatctgccttgatacgtcgtcc 300
agaatagact ccacggttgcataacctaacatatttccct cgtacatcgacggcccatac 360
ccagaatctatcatctcgtt ggttggagt 389
11
Claims (6)
1. The primers for detecting the alternaria citrea molecules are characterized in that specific upstream primers and specific downstream primers for detecting the alternaria citrea molecules are as follows:
Cc-SP 1-upstream: CCTTTCACAATGAAGCAGGAATAG
Cc-SP 1-downstream: GTGGCTGTACCATCCTTAGAAA
And/or
Cc-SP 2-upstream: GCTGATTGAGTGCCCATAGA
Cc-SP 2-downstream: ACTCCAACCAACGAGATGATAG are provided.
2. The detection method of the verticillium citrosum is characterized by comprising the following steps of:
s1: designing and synthesizing two pairs of specific upstream and downstream primers Cc-SP1 and Cc-SP2 according to claim 1 in Primier 6 software by using 2 genomic DNA sequences in Verticillium citreum;
s2: adding specific primers Cc-SP 1-upstream and Cc-SP 1-downstream of the verticillium citreum obtained in the step S1 and genomic DNA of the verticillium citreum corresponding to the primers into a PCR reaction system, and carrying out a plurality of circular reactions under the PCR reaction condition;
and/or adding specific primers Cc-SP 2-upstream and Cc-SP 2-downstream of the verticillium citrosum obtained in the step S1 and the genomic DNA of the verticillium citrosum corresponding to the primers into a PCR reaction system, and carrying out a plurality of cyclic reactions under the PCR reaction condition;
s3: and after the PCR reaction is finished, taking 5 mu L of amplification product, carrying out electrophoresis in agarose gel under the condition of 100V voltage, observing and photographing on a BIO-RAD gel imaging system, and if the fragment with the size of 224bp and/or 389bp can be detected, judging the verticillium citrosum.
3. The method for detecting verticillium citreum according to claim 2, wherein: in S2, the total volume of the PCR reaction system is 20. mu.L, wherein 10. mu.L of 2 XTaq PCR Mix, 0.2. mu.M forward primer, 0.2. mu.M reverse primer, 100ng genomic DNA, and ultrapure water make up 20. mu.L.
4. The method for detecting citrus verticillium bacteria according to claim 2, wherein: in S3, the agarose gel concentration is 1.0%, and the electrophoresis time is 20 min.
5. The method for detecting citrus verticillium bacteria according to claim 2, wherein: in S3, the nucleotide sequence of the 224bp fragment is shown in the sequence table SEQ ID NO. 1.
6. The method for detecting citrus verticillium bacteria according to claim 2, wherein: in S3, the nucleotide sequence of the 389bp fragment is shown in a sequence table SEQ ID NO. 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610914813.0A CN106480193B (en) | 2016-10-20 | 2016-10-20 | Primers for molecular detection of alternaria citrea and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610914813.0A CN106480193B (en) | 2016-10-20 | 2016-10-20 | Primers for molecular detection of alternaria citrea and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106480193A CN106480193A (en) | 2017-03-08 |
| CN106480193B true CN106480193B (en) | 2020-02-18 |
Family
ID=58269878
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610914813.0A Active CN106480193B (en) | 2016-10-20 | 2016-10-20 | Primers for molecular detection of alternaria citrea and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106480193B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113303156A (en) * | 2021-05-08 | 2021-08-27 | 重庆三峡农业科学院(重庆市万州区甘宁蚕种场) | Rapid resistance identification method for citrus verticillium |
-
2016
- 2016-10-20 CN CN201610914813.0A patent/CN106480193B/en active Active
Non-Patent Citations (5)
| Title |
|---|
| A Destructive New Disease of Citrus in China Caused by Cryptosporiopsis citricarpa sp. nov.;Li Zhu等;《Plant Disease》;20120630;第96卷(第6期);第804-812页，全文 * |
| cause of a Citrus leaf spot in the Pacific Islands.《New Zealand Journal of Experimental Agriculture》.1988,第16卷第159-163页. * |
| P. R. JOHNSTON，R. A. FULLERTON.Cryptosporiopsis citri sp. nov. * |
| SPECIES-SPECIFIC PCR PRIMERS FOR GUIGNARDIA CITRICARPA AND GUIGNARDIA MANGIFERAE;K.R. EVERETT and J. REES-GEORGE;《New Zealand Plant Protection》;20061231;第59卷;第141-145页，全文 * |
| 五种柑橘真菌性病害病原鉴定;朱丽;《中国优秀硕士学位论文全文数据库 农业科技辑》;20140215(第2期);D046-253，全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106480193A (en) | 2017-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Collins et al. | Polymorphisms in grapevine DNA detected by the RAPD PCR technique | |
| CN107557434B (en) | Characteristic sequence, labeled primer and identification method of Carya illinoensis variety Van Deman | |
| CN102899335A (en) | Method for obtaining genome sequence of papaya ringspot virus through high-throughput small RNA sequencing | |
| CN117089631B (en) | Sequence combination for rapidly detecting solenopsis invicta based on CRISPR/Cas12a-RPA and application thereof | |
| CN106480193B (en) | Primers for molecular detection of alternaria citrea and detection method thereof | |
| CN103789441B (en) | SSR (Simple Sequence Repeat) molecular marker method for identifying two hippocampus populations | |
| CN104498593B (en) | Identify or auxiliary identify storage bean weevil primer to and test kit | |
| CN113151521B (en) | Ribosomal RNA gene of mulberry red rust pathogenic bacteria Puccinia sp and application thereof | |
| CN101451164A (en) | Method for detecting chrysanthemum chlorotic mottle virus | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN106011277B (en) | A kind of primer pair, kit and the detection method of quick detection coffee rust | |
| CN114540519A (en) | Primer, kit and identification method for identifying bacillus amyloliquefaciens in yeast for making hard liquor | |
| CN104946637B (en) | A kind of multiple DPO PCR detection kits of two kinds of wheel branch germs of sunflower verticillium wilt and its application | |
| CN106011265B (en) | Molecular biology distinguishing method for two rice leaf roller larvae | |
| CN107058559B (en) | Molecular detection method and kit for plant pathogenic fungi | |
| CN109628625A (en) | Identify specific primer, the kit, method and its application of six younger sister hickory chicks | |
| CN108103218B (en) | DNA bar code primer, DNA bar code, kit, method and application for rapidly identifying alternaria adefovea strain | |
| CN101451165A (en) | Method for detecting chrysanthemum B virus | |
| CN105256050B (en) | The compound group EST-SSR molecular labelings special primer system of Pleurotus eryngii and its application | |
| CN101451166B (en) | Method for detecting tomato aspermy virus | |
| CN102534049B (en) | Gene diagnostic reagent kit and detection method of mikania micrantha wilt virus | |
| KR102091282B1 (en) | Method for Deciding Pathogen of Species-Specific Red Rot Disease Using Restriction Fragment Length Polymorphism | |
| CN114438257B (en) | Primer group and kit for simultaneously detecting 5 pathogenic bacteria of tobacco and application of primer group and kit | |
| KR20140010617A (en) | Primers for distinguishing misgurnus mizolepis and method using the same | |
| CN115820925A (en) | Primer group, kit, method and application for detecting pathogenic bacteria of brown spot of oak leaves |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |