CN106480169B - The detection and application in people's AQP10 and SOX17 gene methylation site - Google Patents
The detection and application in people's AQP10 and SOX17 gene methylation site Download PDFInfo
- Publication number
- CN106480169B CN106480169B CN201510546525.XA CN201510546525A CN106480169B CN 106480169 B CN106480169 B CN 106480169B CN 201510546525 A CN201510546525 A CN 201510546525A CN 106480169 B CN106480169 B CN 106480169B
- Authority
- CN
- China
- Prior art keywords
- gene
- methylation
- aqp10
- site
- sox17
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses methylation sites and the applications of liver cancer relevant people AQP10 gene and SOX17 gene, feature is the methylation level using a kind of pyrosequencing quantitative detection people AQP10 gene specific site cg20713492 and SOX17 gene loci cg02919422, the upstream and downstream PCR amplification primer and Pyrosequencing primer for two sites are devised, wherein an amplimer band biotin labeling.The specific position of the present invention screening AQP10 gene and SOX17 gene in hepatocellular carcinoma patients can carry out fast and accurately quantitative detection to its methylation level.
Description
Technical field
This research is related to people AQP10 (aquaporin 10, aquaporin 10) gene and SOX17 (SRY (sex
Determining region Y)-box 17, sex-determining region Y's frame protein 17) gene specific DNA (DNA)
The change of methylation quantitative information of the methylation sites in liver cancer, in particular to application pyrosequencing techniques find AQP10
Gene specific DNA methylation site (cg20713492) methylation in liver cancer reduces；SOX17 gene specific DNA
Methylation sites (cg02919422) methylation in liver cancer increases.These be explore liver cancer pathogenesis, find with
Diagnosis or treatment-related potential marker provide support.
Background technique
Hepatocellular carcinoma is the malignant tumour that worldwide disease incidence is the 6th, and its lethality is up to third
Position.The risk factor of hepatocellular carcinoma includes excessive drinking, hepatites virus infections, aflatoxins intake and environmental pollution etc..But due to
Pathogenic factor is complicated, pathogenesis is unknown, and the diagnosing and treating of hepatocellular carcinoma all suffers from huge challenge.In recent years numerous grind
Study carefully and shows that epigenetic factor plays an important role in the occurrence and development of liver cancer.DNA methylation is as main commitment
Mechanism refers to 5 ' carbon atoms of DNA molecular CpG dinucleotides upper eye lid pyrimidine ring by S-adenosylmethionine (S-adenosyl
Methionine a kind of) the reversible covalent modification generated as methyl donor.Study liver cancer related gene specific position first
The change of base facilitates the pathogenesis for understanding liver cancer, provides effective action target spot for the prevention and treatment of liver cancer.
AQP10 gene is located at No. 1 2nd area of chromosome long arm, 1 band, is the member in aquaporin family (Aquaporin, AQP),
Coding albumen is located on cell membrane, is the channel of the Neutral Solutes such as epithelial cell absorption and drain water, glycerol, urea, with substance
It transports and is metabolized and is closely bound up.AQP10 promotes the absorption of water and glycerol in duodenum, jejunum, ileum great expression.Glycerol
It is to recombine triacylglycerol and the important substrate of glucose, as the adjuster of control glycerol disengaging cell, aquaporin
The imbalance of family and metabolic disease are in close relations, and such as obesity, insulin resistance, non-alcoholic fatty liver disease, and the latter is
One of risk factors of liver cancer.Rarely have at present to the research of AQP10 and be related to tumor area, Martens JH et al. discovery is all-trans
In the acute promyelocytic leukemia cell NB4 cell strain of formula vitamin A acid processing, the up-regulation of AQP10 protein expression may relate to a group egg
The acylated epigenetics process of Baiyi.
SOX17 gene is located at No. 8 12nd area of chromosome long arm, 23 bands, it is known that participates in embryonic development and adjusts, passes through transcriptional control
Inhibit Wnt signal path.Research shows that the extensive methylation of SOX17 gene significantly increases during the canceration of Colorectal Adenomas to cancer
Add；SOX17 gene promoter zone methylation prompts poor prognosis in breast cancer serum.In addition, SOX17 is by influencing sexual gland hair
Educate, lead to reproduction cell dysmaturity, by recognize be germinocarcinoma candidate diagnosis marker.Have no the gene in liver cancer at present
In relevant report.
Summary of the invention
The present invention provides a kind of pyrosequencing quantitative detection people AQP10 gene and SOX17 gene specific sites
Methylation level and specific primer, can accurately be detected in people's Hepatocellular Carcinoma using the primer specific
The methylation level in the site DNA.
The primer of pyrosequencing quantitative detection people AQP10 gene and SOX17 gene specific site methylation level,
Including PCR (polymerase chain reaction) primer and methylation sequencing primer.Wherein, the PCR upstream primer sequence of the AQP10 gene
It is classified as: biotin-5 '-ATTTGTTAGGATGGGGGAGGTTAG-3 ', downstream primer sequence are as follows: 5 '-
TCCCTCTATCTACATAAACACACTATCAC-3 ', methylate sequencing primer sequence are as follows: 5 '-
CTTTAAAACCATTAACTCAATTC-3′；The PCR upstream primer sequence of SOX17 gene are as follows: 5 '-
GTTATTAGGTAGGTTGGGGGTTT-3 ', downstream primer sequence are as follows: biotin-5 '-ACCTACCCCCCTCCCCTCAA-3 ',
Methylate sequencing primer sequence are as follows: 5 '-TTTGGGTAAGTTGTAGATTAGAT-3 '.
The present invention utilizes Illumina infinium humanmethylation27beadchip methylation chip screening
Difference between primary hepatoma and methylome in corresponding cancer beside organism finds the gene in primary hepatoma
In group DNA, the site of the gene promoter area AQP10 one (number of the site in above-mentioned methylation chip is cg20713492)
Methylation level significantly lower than group by cancer；And the methylation water of one site (cg02919422) in the gene promoter area SOX17
It is flat to be apparently higher than group by cancer.
In order to avoid the sieve of methylation chip surveys result error, and guarantee that sieve surveys the accuracy of result, the present invention is using burnt
Phosphoric acid sequencing detects the methylation level of two sites (cg20713492, cg02919422).Detection method includes as follows
Step:
1. the genomic DNA of Hepatocellular Carcinoma and cancer beside organism is extracted respectively, respectively to the base of all samples
Because group DNA carries out bisulfite conversion, unmethylated cytimidine is changed into uracil, and the cytimidine to methylate is not
Become；
2. the human gene group DNA after being converted using bisulfite is template, for site (cg20713492,
Cg02919422 PCR primer and sequencing primer described in upstream and downstream sequence design).
3. the human gene group DNA after being converted using bisulfite is template, using the PCR primer and sequencing primer into
Row pyrosequencing analyzes the methylation level in the site (cg20713492, cg02919422).
Through detecting, the methylation level in the site cg20713492 is come significantly lower than same sample in primary hepatoma group
The cancer beside organism in source, the methylation level in the site cg02919422 are apparently higher than the cancer beside organism of same Specimen origin, with methyl
The sieve survey result for changing chip is consistent.Showing the site cg20713492 and cg02919422 respectively is in AQP10 and SOX17 gene
Specific position.
Compared with the prior art, the invention has the benefit that present invention finds with primary hepatoma crowd's phase
The specific DNA methylation sites of correlation gene, and draw for specific position design pyrosequencing PCR primer and sequencing
Object can carry out fast and accurately quantitative detection to the methylation of the specific position by pyrosequencing.
Detailed description of the invention
Fig. 1 is AQP10 pyrosequencing result figure, wherein the site of wire cylindrical part apparent methylation and methylation
Percentage；1 is cancerous tissue, and 2 be cancer beside organism.
Fig. 2 is SOX17 gene pyrosequencing result figure, wherein the site of wire cylindrical part apparent methylation and first
Base percentage；1 is cancerous tissue, and 2 be cancer beside organism.
Specific embodiment
Invention is further described in detail with reference to the accompanying drawings and detailed description.
1. specific position is analyzed
With Infinium HumanMethylstion27 BeadChip methylation chip screening primary hepatoma with
Difference in corresponding cancer beside organism between methylome finds the AQP10 base in the genomic DNA of primary hepatoma
Because the methylation level of one site of promoter region (number of the site in above-mentioned methylation chip is cg20713492) is bright
Aobvious to be lower than group by cancer, the methylation level of one site (cg02919422) in the gene promoter area SOX17 is significantly lower than group by cancer.
Sequence where AQP10 gene specific site is (SEQ ID No.1):
TGTGTTCATAGCCTGCTCCCAGACATTCTCTTGTTATCTCTCTGTTTCCTAGCCTACACA[CG]TGCA
CAGACACGTAGCTGCTGTTCAGGAACTGAGCTAATGGTTTTAAAGTCTGTTCCTTA
Sequence where SOX17 gene specific site is (SEQ ID No.5):
CAGGGGCGCCCGCAGTGTCACTAGGCCGGCTGGGGGCCCTGGGTACGCTGTAGACCAGAC[CG]CGAC
AGGCCAGAACACGGGCGGCGGCTTCGGGCCGGGAGACCCGCGCAGCCCTCGGGGCA
For the accuracy for detecting the screening results, relative specific primer is designed, it is special to this using pyrosequencing
The specificity in property site is verified.
2. human gene group DNA extracts
1) cancerous tissue and the cancer beside organism for acquiring 42 hepatocellular carcinoma patients, extract the genome of each sample
DNA, operation are carried out according to German QIAGEN QIAamp DNA mini kit (Cat.No.51304) specification.
2) agarose gel electrophoresis analysis is carried out to the genomic DNA sample of acquisition.
3) bisulfite converts
Weight is carried out using German QIAGEN company conversion reagent box Epitect Bisulfite Kit (Cat.No.59104)
Sulphite conversion, step are carried out according to the kit specification.
4. design of primers
Using the genomic DNA after bisulfite converts as template, QIAGEN company PyroMark Assay is used
Design2.0 software design pyrosequencing PCR primer and sequencing primer, and closed by Shanghai Sheng Gong bioengineering Co., Ltd
At.
5. pyrosequencing
1) PCR amplification
Genomic DNA after being converted using bisulfite carries out PCR reaction as template, using following condition, and system is as follows:
Reaction condition: 94 DEG C of 2min；
94 DEG C of 30sec, 60 DEG C of 1min, 68 DEG C of 1min (50 circulations)；
68℃10min.
2% agarose gel electrophoresis is carried out to PCR product after the reaction was completed, verifies the specificity and accuracy of product.
2) pyrosequencing
On German QIAGEN PyroMark Q96ID platform, pyrosequencing is carried out, specific steps press instrument specification
It carries out.
3) DNA methylation testing result
Methylate as the result is shown: the methylation level of the site cg20713492 cancer group is significantly lower than group by cancer, the site cancer
Group methylation average level is 23.08 ± 14.82, and group methylation average level is 59.72 ± 6.57 (p < 0.01) by cancer；
For the methylation level of the site cg02919422 cancer group significantly lower than group by cancer, site cancer group methylation average level is 47.88
± 14.29, cancer side group methylation average level is 16.67 ± 4.67 (p < 0.01).Sequencer map is shown in Fig. 1,2 respectively.
4) conclusion: in result of study discovery primary hepatoma, the methylation water in the site AQP10 gene cg20713492
Flat to be significantly lower than group by cancer, the methylation level in the site SOX17 gene cg02919422 is apparently higher than group by cancer.Therefore, this hair
Bright pyrosequencing PCR primer and sequencing primer for site cg20713492 and cg02919422 design can be used for primary
The methylation level in two sites carries out quantitative detection in hepatocellular carcinoma.
Claims (2)
1. on a kind of pyrosequencing PCR for liver cancer relevant AQP10 gene-specific methylation site cg20713492,
The application of downstream primer and methylation sequencing primer in the kit of preparation auxiliary detection and diagnosis primary hepatoma；
Wherein, the nucleic acid sequence where the specific position are as follows:
TGTGTTCATAGCCTGCTCCCAGACATTCTCTTGTTATCTCTCTGTTTCCTAGCCTACACACGTGCACAGACA
CGTAGCTGCTGTTCAGGAACTGAGCTAATGGTTTTAAAGTCTGTTCCTTA；Base is methylation sites at underscore
Accurate location, 110 away from transcription initiation site, site base.
2. application as described in claim 1, which is characterized in that PCR upstream primer sequence are as follows:
Biotin-5 '-ATTTGTTAGGATGGGGGAGGTTAG-3 ', PCR downstream primer sequence are as follows:
5 '-TCCCTCTATCTACATAAACACACTATCAC-3 ', methylate sequencing primer sequence are as follows:
5′-CTTTAAAACCATTAACTCAATTC-3′。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510546525.XA CN106480169B (en) | 2015-09-01 | 2015-09-01 | The detection and application in people's AQP10 and SOX17 gene methylation site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510546525.XA CN106480169B (en) | 2015-09-01 | 2015-09-01 | The detection and application in people's AQP10 and SOX17 gene methylation site |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106480169A CN106480169A (en) | 2017-03-08 |
| CN106480169B true CN106480169B (en) | 2019-10-08 |
Family
ID=58235207
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510546525.XA Active CN106480169B (en) | 2015-09-01 | 2015-09-01 | The detection and application in people's AQP10 and SOX17 gene methylation site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106480169B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110734966B (en) * | 2019-09-19 | 2021-06-25 | 广州医科大学附属肿瘤医院 | Detection system and kit for detecting methylation sites of SAV1 gene promoter region |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012104642A1 (en) * | 2011-02-04 | 2012-08-09 | Ucl Business Plc | Method for predicting risk of developing cancer |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6242388B2 (en) * | 2012-06-14 | 2017-12-06 | オーフス ユニバーシテットＡａｒｈｕｓ Ｕｎｉｖｅｒｓｉｔｅｔ | Prostate cancer biomarker |
-
2015
- 2015-09-01 CN CN201510546525.XA patent/CN106480169B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012104642A1 (en) * | 2011-02-04 | 2012-08-09 | Ucl Business Plc | Method for predicting risk of developing cancer |
Non-Patent Citations (1)
| Title |
|---|
| Genome-wide methylation analysis and epigenetic unmasking identify tumor suppressor genes in hepatocellular carcinoma;Revill K et al;《Gastroenterology》;20131231;第145卷(第6期);摘要以及表2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106480169A (en) | 2017-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Khor et al. | DNA methylation profiling revealed promoter hypermethylation-induced silencing of p16, DDAH2 and DUSP1 in primary oral squamous cell carcinoma | |
| Xu et al. | Pan-cancer transcriptome analysis reveals a gene expression signature for the identification of tumor tissue origin | |
| WO2020020071A1 (en) | Methylation modification-based tumor marker stamp-ep1 | |
| Pobsook et al. | Improved measurement of LINE-1 sequence methylation for cancer detection | |
| Hu et al. | RNA over-editing of BLCAP contributes to hepatocarcinogenesis identified by whole-genome and transcriptome sequencing | |
| WO2020135859A1 (en) | Tumor marker stamp-ep3 based on methylation modification | |
| US20210292850A1 (en) | Methylation modification-based tumor marker stamp-ep2 | |
| WO2020135862A1 (en) | Tumor marker stamp-ep5 based on methylated modification | |
| CN110257525A (en) | There is the marker and application thereof of conspicuousness to diagnosing tumor | |
| JP2024020392A (en) | Composition for diagnosing liver cancer by using cpg methylation changes in specific genes, and use thereof | |
| CN106480019B (en) | The detection and application in people's NUDT2 and PCDH8 gene methylation site | |
| Nabatchian et al. | miR-581-related single nucleotide polymorphism, rs2641726, located in MUC4 gene, is associated with gastric cancer incidence | |
| CN106480169B (en) | The detection and application in people's AQP10 and SOX17 gene methylation site | |
| Varol et al. | Methylation analysis of histone 4-related gene HIST1H4F and its effect on gene expression in bladder cancer | |
| CN109371138A (en) | Tumor marker STAMP-EP4 based on methylation modification | |
| CN109652541A (en) | Tumor marker STAMP-EP6 based on methylation modification | |
| Kang et al. | Stage-specific methylome screen identifies that NEFL is downregulated by promoter hypermethylation in breast cancer | |
| CN106544403B (en) | It can be used for detecting kit and the application of TM4SF1 and NPY gene specific methylation sites | |
| US20240229157A1 (en) | Compositions comprising nullomers and methods of using the same for cancer detection and diagnosis | |
| US10934590B2 (en) | Biomarkers for breast cancer and methods of use thereof | |
| CN106544406B (en) | The primer of quantitative detection SLC2A14 and STON2 gene specific site methylation level and application | |
| KR20170072685A (en) | A method for classification of subtype of triple-negative breast cancer | |
| Mustafa et al. | A method to correlate mRNA expression datasets obtained from fresh frozen and formalin-fixed, paraffin-embedded tissue samples: a matter of thresholds | |
| CN106544405B (en) | The primer of quantitative detection S100A8 and ZMYND8 gene specific site methylation level and application | |
| CN108875314B (en) | Target gene detection method based on epigenetics modification difference |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |