CN106399153B - There is the bacillus and application thereof of tolerance to vanadium - Google Patents
There is the bacillus and application thereof of tolerance to vanadium Download PDFInfo
- Publication number
- CN106399153B CN106399153B CN201610723745.XA CN201610723745A CN106399153B CN 106399153 B CN106399153 B CN 106399153B CN 201610723745 A CN201610723745 A CN 201610723745A CN 106399153 B CN106399153 B CN 106399153B
- Authority
- CN
- China
- Prior art keywords
- vanadium
- bacillus
- environment
- pfyn01
- tolerance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F3/00—Biological treatment of water, waste water, or sewage
- C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F2101/00—Nature of the contaminant
- C02F2101/10—Inorganic compounds
- C02F2101/20—Heavy metals or heavy metal compounds
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Water Supply & Treatment (AREA)
- Environmental & Geological Engineering (AREA)
- Hydrology & Water Resources (AREA)
- Biodiversity & Conservation Biology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
- Processing Of Solid Wastes (AREA)
Abstract
The invention belongs to microorganism fields, and in particular to a kind of pair of vanadium has the bacillus and application thereof of tolerance.The technical problem to be solved by the present invention is to the biological prosthetic offer technical solutions to contaminated by heavy metals environment.The present invention solves the technical solution of technical problem there is provided a kind of bacillus sp.PFYN01, and deposit number is CCTCC NO:M2016174.The bacterium in addition to can high resistance to vanadium, and tolerance is all had to heavy metals such as Cd, Cr, Pb, Ni, Co and Zn, 2000mg/L is up to the tolerance of vanadium.The bacterial strain has the ability that pentavalent vanadium is reduced into tetravalence vanadium in basic medium simultaneously, conversion ratio is 46.7%, the characteristic for reducing high price vanadium toxicity in solution can be reached, especially can development and usage removal of vanadium toxicity in the high vanadium toxicity liquid environment containing other heavy metal contaminants microbial inoculum, had a good application prospect in biological prosthetic to Heavy-metal Polluted Environment.
Description
Technical field
The invention belongs to microorganism fields, and in particular to a kind of pair of vanadium has the bacillus and application thereof of tolerance.
Background technique
Heavy metal pollution is on the rise, a large amount of discharges of trade waste, agricultural effluent and sanitary sewage, heavy metal pollution
Object is also discharged together, causes Heavy Metal Pollution in Water Environment.After heavy metal is discharged into environment, it is not easy to degradation and can be in the environment
Permanence accumulation, dealing with improperly for heavy metal will lead to the toxic compounds for discharging potentially large number of carcinogenic and mutagenesis, lead
It causes heavy metal pollution very serious to the harmfulness of biology and environment, therefore, reinforces Heavy Metal Pollution Control, improve human health
It is most important with ecology erroneous zone.
Vanadium is a kind of silver grey non-ferrous metal, has many characteristics, such as that ductility, matter are hard, nonmagnetic, 1890 ± 10 DEG C of fusing point, boiling point
3380 DEG C, belong to the column of high-melting-point rare metal.Vanadium has played important because of its excellent physicochemical properties in industrial aspect
Irreplaceable role has the good reputation of metal " vitamin ".In recent years due to industrial discharge and anthropogenic discharge, lead to environment and life
Vanadium constantly accumulates in object, causes the pollution of vanadium problem being on the rise.In the sintering of vanadium smelting and vanadium symbiotic ore, generate
Small particle is easier to evaporate into atmosphere, causes atmosphere pollution of vanadium.In addition, the burning of coal and petroleum, the spray of volcanic ash
Hair, melting of old metal etc. can all generate pollution of vanadium.Vanadium has 2,3,4 and 5 valences of oxidation state, the toxicity of vanadium with valence state increase
And increase, pentavalent vanadium toxicity highest.Chemical form into the vanadium in atmosphere is mainly oxyvanadium compound, such as VO, V2O3、VO2With
V2O5Deng, these oxyvanadium compounds are contacted with other particles or compound through various channels in an atmosphere, synergistic effect is generated,
It is often more toxic to biology.There is stimulation, Acute inhalation V when vfanadium compound sucks2O5Bronchopneumonia can be caused,
Even pulmonary edema.When chronic sucking, nervous system and respiratory system can be damaged, more seriously cause toxic type nephrosis and
Protein metabolism exception etc..
The problem of pollution of vanadium is brought is increasingly severe, leads to the existence health event and hidden danger hair of a series of animals and humans
It is raw, cause the great attention of countries in the world, and make corresponding laws and regulations, the discharge of strict control vanadium, reduce by
Environmental pollution caused by vanadium.Physical chemistry, bioremediation technology are mainly used currently, administering and repairing pollution of vanadium technology.It is physico
Recovery technique is learned in spite of certain effect, but because suddenly, water body physicochemical property itself and internal structure ingredient answer
Polygamy, and expensive, it is complicated for operation, and the presence for many restrictions sexual factor such as be easy to cause secondary pollution, it causes mostly
Counting method is also in laboratory stage, can't be applied to practical pollution control during short.
Bioremediation technology is a kind of modern times side itself to be curbed environmental pollution with structure and chemical characteristic using biology
Method achievees the purpose that remove the heavy metal in environment or reduces heavy metal toxicity.Bioremediation of waters is mainly microorganism remediation
Technology, this method has become a hot topic in various countries' environmental engineering Science and Technology research field at present.It is micro-
Bioremediation technology be have by certain micro-organisms itself clear is reached to the effects of absorption of heavy metal, precipitating, conversion
Except the purpose of heavy metal in environment, or reduce a kind of new technology of heavy metallic poison.Microorganism is administering heavy metal pollution
Multiple technologies in there is excellent performance, microorganism first adsorbs and fixes and inhaled by self structure and macromolecular substances
Heavy metal is received to achieve the purpose that remove heavy metal in environment；Secondly microorganism acts on the reduction-oxidation of heavy metal, changes a huge sum of money
The valence state of category reduces the toxicity of heavy metal in environment with this；In addition some microorganisms and rhizosphere have synbiosis, thus it is possible to vary
Rhizosphere environment improves absorption and fixation of the plant to heavy metal in soil, to achieve the purpose that repairing heavy metal pollution.
Currently, at the biological prosthetic aspect of vanadium, there are no good practical plans.
Summary of the invention
The technical problem to be solved by the present invention is to the biological prosthetic offer technical solutions to contaminated by heavy metals environment.This
Invention solves the technical solution of technical problem there is provided a kind of bacillus sp.PFYN01, and deposit number is
CCTCC NO:M2016174.
Bacillus sp.PFYN01 is on April 5th, 2016 to China typical culture collection center
(CCTCC) biological deposits are submitted, China typical culture collection center address is the Wuhan Wuhan University, China, and deposit number is
CCTCC NO:M2016174。
Further, the correspondence nucleotides sequence of the bacillus sp.PFYN01,16sRNA are classified as SEQ
Shown in ID No.1.
In addition, the present invention also provides above-mentioned bacillus sp.PFYN01 in removal environment vanadium toxicity
Purposes.The purposes be included in independent vanadium it is abnormal or except vanadium extremely in addition to there are also a kind of to a variety of gold in Cd, Cr, Pb, Ni, Co, Zn
Belong to the purposes that vanadium toxicity is removed in abnormal environment.
Further, above-mentioned environment is liquid environment.
Meanwhile the present invention also provides a kind of vanadium toxicity removal agent.The vanadium toxicity removal agent is with above-mentioned bacillus
Bacillus sp.PFYN01 is what main active was prepared.
In addition, the present invention also provides a kind of methods of heavy metal vanadium toxicity in removal environment.This method includes following step
It is rapid: above-mentioned bacillus sp.PFYN01 to be introduced in the environment by pollution of vanadium, incorporation way is directly by institute
Strain growth is stated to the bacterium solution of logarithmic phase or is grown being introduced into liquid environment using the bacterial strain as the preparation of main active,
To achieve the purpose that remove environment heavy metal vanadium toxicity.The liquid environment pH value is 4~11.
The bacterium solution can be prepared as follows: above-mentioned bacillus sp.PFYN01 is being trained substantially
It supports and is cultivated in base, be formulated as tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L and pH 7.0, grown to it
The logarithmic phase bacterium solution is introduced into pollution of vanadium liquid environment by logarithmic phase, achievees the purpose that remove environment vanadium toxicity.
Wherein, the treatment temperature in the above method is 15~50 DEG C, and the preferred temperature of processing is 30 DEG C or so.
The beneficial effects of the present invention are:
1, bacillus sp.PFYN01 provided by the present invention is to vanadium tolerance with higher, Er Qieneng
Enough other heavy metals such as enduring high-concentration Cr (800mg/L) and Pb (1200mg/L), vanadium tolerance are greater than 2000mg/L.Together
When bacterial strain Bacillus sp.PFYN01 be bacillus Bacillus report pentavalent vanadium can be reduced into tetravalence for the first time
Vanadium provides microorganism resource for high pollution of vanadium environmental improvement.
2, bacterium provided by the invention only need to provide the simple source C, the source N and inorganic salts can it is complicated Bu Tong with much money
Belong in culture environment and survive and grow, vitality is strong, and the speed of growth is fast, and biomass is big, with higher to various heavy resistance to
By property, tolerable concentration is high.
3, pentavalent vanadium can will be reduced into tetravalence vanadium in higher concentrations by vanadium biological reductant of the present invention, also proper energy
Power is up to 46.67%.
4, bacterium of the present invention is resistant to heavy metal Cd, Cr, Pb, Ni, Co, Zn, is especially up to the tolerance of vanadium
2000mg/L is also up to 1200mg/L to the tolerance of Pb.Based on the high tolerance to various heavy, it is convenient for various extreme dirts
Vanadium toxicant removal in water body is contaminated, has simple, convenient, efficient advantage.
Detailed description of the invention
The bacterium colony photo of Fig. 1, bacterial strain Bacillus sp.PFYN01, show colony characteristics.
The Phylogenetic Analysis tree of Fig. 2, bacterial strain Bacillus sp.PFYN01.
Fig. 3, bacterial strain Bacillus sp.PFYN01 cultivated in the culture medium solution of LB containing vanadium after photo.It can be incited somebody to action after culture
The color of the culture medium solution of LB containing vanadium becomes dark blue or tends to black, it is seen that pentavalent vanadium effectively can be reduced into tetravalence vanadium.
Bacillus sp.PFYN01 of the present invention is on April 5th, 2016 to China typical culture collection
Biological deposits are submitted at center (CCTCC), and China typical culture collection center address is the Wuhan Wuhan University, China, deposit number
For CCTCC NO:M2016174.
Specific embodiment
The pollution of vanadium water acquired in the drainage of present invention acquisition city, Sichuan vanadium titano-magnetite Xi Zhaduichang, passes through
Screening, enrichment, isolated one plant of bacterium, identified, 16sRNA gene order and bacillus sp.Cp-
H36 has 99% similitude, is named as bacillus sp.PFYN01.The bacterium is on April 5th, 2016 in
State's Type Tissue Collection submits biological deposits, and deposit number is CCTCC NO:M2016174.
The suitable condition of culture of the bacterium are as follows: tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L and pH
7.0.Experiments have shown that high resistance to vanadium reducing microorganisms can be made using the bacterial strain, handled for vanadium-containing water.Furthermore the bacterium has
High resistance to heavy metal characteristic, can prepare extreme environment heavy metal toxicity remover；Especially prepare removal Heavy Metals in Waters
The pentavalent vanadium of high poison in solution can be reduced into less toxic tetravalence or other valence state vanadium by the biological reductant of vanadium toxicity.
The acquisition and separation of 1 bacterium of embodiment
1, it separates, the process of purification of bacterial:
(1) water containing pollution of vanadium in the western slag muck field drainage of Sichuan city, Sichuan vanadium titano-magnetite is taken, 2h is stood, takes
1mL supernatant is added in the fluid nutrient medium that 50mL vanadium containing heavy metal is 10mg/L, and 30 DEG C of 120rpm cultivate 4d；
(2) the fluid nutrient medium 1mL of culture 4d in (1) is taken to be added to the Liquid Culture that 50mL vanadium containing heavy metal is 50mg/L
In base, 30 DEG C of 120rpm cultivate 4d；
(3) it takes the fluid nutrient medium 1mL of culture 4d in (2) to be added to the liquid that 50mL vanadium containing heavy metal is 100mg/L to train
It supports in base, 30 DEG C of 120rpm cultivate 4d；
(4) it takes the fluid nutrient medium 1mL of culture 4d in (3) to be added to the liquid that 50mL vanadium containing heavy metal is 200mg/L to train
It supports in base, 30 DEG C of 120rpm cultivate 4d；
(5) it takes the fluid nutrient medium 1mL of culture 4d in (4) to be added to the liquid that 50mL vanadium containing heavy metal is 400mg/L to train
It supports in base, 30 DEG C of 120rpm cultivate 4d；
(6) it takes the fluid nutrient medium 1mL of culture 4d in (5) to be added to the liquid that 50mL vanadium containing heavy metal is 800mg/L to train
It supports in base, 30 DEG C of 120rpm cultivate 4d；
(7) the aqueous supernatant liquid 1mL of culture 4d in (6) is taken to be coated on containing V5+On the solid medium of (20mg/L), 30 DEG C
Constant incubator culture；
(8) single colonie that picking has been grown after 48h, then repeatedly scribing line growth, purifying obtain resistance to vanadium single colonie respectively.Name
For PFYN01
Above-mentioned solid culture based formulas are as follows: tryptone 10g/L, yeast extract 5g/L, agar powder 15g/L, sodium chloride
10g/L and pH 7.0.
Aforesaid liquid culture medium prescription are as follows: tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L and pH
7.0, it adds various concentration vanadium (10,50,100,200,400,800mg/L).
2 bacterial morphological characteristic of embodiment and Biology identification
1. morphological feature
Plate is inverted in constant temperature on LB solid medium by the monoclonal colonies streak inoculation that picking embodiment 1 obtains
In incubator, 30 DEG C of cultures for 24 hours, observe its colonial morphology.Bacillus sp.PFYN01 forms approximate circle, and surface is smooth wet
Profit, edge is irregular, and quality is soft, milky, pigment indiffusion, referring to Fig. 1.
2. physio-biochemical characteristics
The resulting monoclonal colonies of embodiment 1 are seeded in LB liquid minimal medium, logarithmic growth phase
Bacillus sp.PFYN01 bacterial strain carries out gram dye according to " common bacteria system identification handbook " (east show pearl etc., 2001)
Color, Starch Hydrolysis test, grease hydrolysis experiment, methyl red experiment, H2S experiment, gelatin hydrolysis test, sugared fermenting experiment, as a result
It is shown in Table 1..
1 bacterial strain Bacillus sp.PFYN01 physio-biochemical characteristics of table
Note: "+" is positive or production acid, and "-" is feminine gender or does not produce acid.
3. 16sRNA characteristic and phylogenetic tree building
It extracts bacterial genomes DNA and carries out PCR amplification, primer is bacterium 16sRNA PCR universal primer (upstream primer
(SEQ ID No.2) 27F:5 '-AGAGTTTGATCCTGGCTCAG-3 ', downstream primer (SEQ ID No.3) 1492R:
CGGTTACCTTGTTACGACTTC), Taq polymerase is the rTaq enzyme of TaKaRa company production, PCR system are as follows: 10 × PCR is slow
Fliud flushing 5 μ L, dNTP (2.5mmol/L) 4 μ L, 27F (10 μM) 1uL, 1492R (10 μM) 1uL, genomic DNA 1uL, ExTaq enzyme
(5U/uL) 0.2 μ L adds 37.8 μ L of redistilled water.
PCR response procedures are as follows: 1. 94 DEG C of initial denaturation 5min；2. 94 DEG C of denaturation 30s；3. 54 DEG C of annealing 30s；4. 72 DEG C of extensions
1min30s；5. 72 DEG C of extension 10min；6. 4 DEG C of preservations.Wherein repeat step 2., 3., 4. 34 times, then carry out step 5., 6..
PCR product uses 2.0% agarose gel electrophoresis, gel extraction.Recovery product is public by the prosperous biology of Beijing ancient cooking vessel state
Department is sequenced.The sequence results of the 16sRNA measured are submitted to GenBank database, and utilize Blastn by strain
Listed sequence carries out sequence analysis in the sequence and GenBank database of 16sRNA, carries out sequence ratio with ClustalX
It is right, Phylogenetic Analysis is then carried out using Mega4.0 software.The Phylogenetic Analysis tree of the bacterial strain sees Fig. 2,16sRNA base
Because sequence and bacillus sp.Cp-h36 have 99% similitude, according to as a result, being named as bacillus
Bacillus sp.PFYN01。
Embodiment 3: maximal tolerable concentration of the bacterium to heavy metal
The monoclonal colonies that picking embodiment 1 obtains, are inoculated in LB liquid medium, 30 DEG C, 120rpm shaken cultivation
36h collects bacterial concentration OD600It is 1.2, bacterium solution is prepared into gradient bacterium according to 1,10,100,1000,10000 dilution proportion
Liquid；And prepare various concentration heavy metal LB solid medium.It is flat to various heavy metal concentrations that each 50 μ L of concentration bacterium solution is drawn respectively
Plate coating uniformly, is cultivated at 30 DEG C, every observing and recording bacterial growth situation for 24 hours, its appearance is inhibited obviously to grow in 120h
Minimum heavy metal concentration, the i.e. maximal tolerable concentration of the bacterium.
Above-mentioned various concentration heavy metal solid medium be respectively in LB solid medium add Cr, Pb, Cu, Ni, Co,
Cd, Zn or V.It is 100mg/L, 200mg/L, 400mg/L, 800mg/L, 1600mg/L that Cr, which adds concentration,；Pb adds concentration
100mg/L,200mg/L,400mg/L,800mg/L,1200mg/L,1600mg/L；Cu add concentration be 1mg/L, 2mg/L,
4mg/L,8mg/L,10mg/L,20mg/L,40mg/L；Ni add concentration be 10mg/L, 20mg/L, 40mg/L, 80mg/L,
160mg/L,200mg/L,320mg/L；Co add concentration be 10mg/L, 20mg/L, 40mg/L, 50mg/L, 100mg/L,
160mg/L；It is 10mg/L, 20mg/L, 40mg/L, 80mg/L, 100mg/L, 160mg/L that Cd, which adds concentration,；Zn adds concentration
10mg/L,20mg/L,40mg/L,80mg/L,100mg/L,160mg/L；It is 50mg/L, 125mg/L, 250mg/ that V, which adds concentration,
L、500mg/L、1000mg/L、2000mg/L。
Bacterial strain Bacillus sp.PFYN01 can be in heavy metal Cd, the higher solid training of Cr, Pb, Cu, Ni, Co, Zn content
It supports and is grown in base, the results showed that, bacterial strain Bacillus sp.PFYN01 is equal to V, Cd, Cr, Pb, Ni, Co, Zn these types heavy metal
There are higher tolerance, resistance of the bacterial strain Bacillus sp.PFYN01 to heavy metal are as follows: V > Pb > Cr > Ni > Zn=Cd > Co >
Cu。
Maximal tolerable concentration (unit: mg/L) of the 2 bacterial strain Bacillus sp.PFYN01 of table to heavy metal
Due to there is the resistance to strain affected report of vanadium in Bacillus sp strain, we with identical or approximate experiment condition,
The vanadium tolerance strain of bacillus Bacillus has been reported in comparative analysis.Wherein Ilunga Kamika (2014) reports bacterium
Kind Bacillus licheniform has tolerance to vanadium, and tolerance is 200mg/L (Effect of vanadium
toxicity at its different oxidation states on selected bacterial and
protozoan isolates in wastewater systems.Environmental Technology.35(16):
2075-2085), bacterial strain Bacillus sp.PFYN01 not of the same race of the invention is up to 2000mg/L to vanadium tolerance, significantly
Higher than bacillus Bacillus licheniform to the tolerance of vanadium.In addition, Jennifer (2004) reports gemma
For another strain Bacillus subtilis of Bacillus to the tolerance of vanadium, value reaches 5000mg/L, still, sensitive to chromium Cr,
Vanadium (Methods evaluating vanadium tolerance in bacteria isolated from is not tolerated
crude oil contaminated land.J.Microbiological Methods.58:87-100).And this test separates
Bacillus sp. new strains Bacillus sp.PFYN01 not only to vanadium tolerance with higher, and be resistant to height
Other heavy metals such as the Cr (800mg/L) and Pb (1200mg/L) of concentration, for comprehensively utilizing bacterial strain Bacillus
Sp.PFYN01, which repairs the pollution of vanadium water body containing other heavy metals, has good application prospect.
Embodiment 4: reduction effect of the bacterium to pentavalent vanadium
The monoclonal colonies that picking embodiment 1 obtains are inoculated into LB liquid medium, in 30 DEG C, 120rpm shaken cultivation
18h obtains logarithmic phase bacterium solution；Bacterium solution is accessed into LB liquid medium according to 0.2% volume fraction inoculum concentration and (contains V5+Concentration is
In 30mmol/L), shaken cultivation 48h；Then culture solution 6000rpm is centrifuged 10min, extracting centrifugal liquid supernatant liquor 10mL is pressed
According to it is old be imbued with " spectrophotometric analysis of different valence state vanadium in electrolyte of vanadium redox battery " (spectroscopy and spectrum analysis, 2011,31
(10): 2839-2842) pentavalent vanadium and tetravalence vanadium concentration in method measurement supernatant.
The result shows that the culture medium solution color of LB containing vanadium can be made to be changed by Huang is dark blue by bacterial strain Bacillus sp.PFYN01
Or tend to black, referring to Fig. 3.V in solution is measured by spectrophotometry5+And V4+It is total to measure 4 valences and 5 valence vanadium in solution for content
Concentration is 25.6mmol/L, V4+Concentration be 14.0mmol/L, V5+Concentration be 11.6mmol/L, the vanadium of other 4.4mmol/L
It is changed into trivalent or divalent.Bacterial strain Bacillus sp.PFYN01 can make V as a result,5+It is reduced into V4+, conversion ratio 46.7%, significantly
Reduce vanadium toxicity in solution.This reduction characteristic to vanadium of bacterial strain Bacillus sp.PFYN01 is in bacillus Bacillus
There is not been reported in bacterial strain.
Claims (6)
1. bacillus sp.PFYN01, it is characterised in that: its deposit number is CCTCC NO:M2016174.
2. bacillus sp.PFYN01 according to claim 1, it is characterised in that: the correspondence of its 16sRNA
Nucleotides sequence is classified as shown in SEQ ID No.1.
3. purposes of the bacillus sp.PFYN01 of any of claims 1 or 2 in removal environment vanadium toxicity.
4. purposes according to claim 3, it is characterised in that: the environment is liquid environment.
5. vanadium toxicity removal agent, it is characterised in that: be with the described in any item bacillus of claims 1 or 2
Sp.PFYN01 is what main active was prepared.
6. the method for removing environment vanadium toxicity, it is characterised in that have follow steps: introducing right in the environment by pollution of vanadium
It is required that bacillus sp.PFYN01 described in 1 or 2, incorporation way is directly by the strain growth to logarithmic phase
Bacterium solution or be introduced into liquid environment using the bacterial strain as the preparation of main active grow, the liquid environment pH value is 4
~11, achieve the purpose that remove environment vanadium toxicity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610723745.XA CN106399153B (en) | 2016-08-25 | 2016-08-25 | There is the bacillus and application thereof of tolerance to vanadium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610723745.XA CN106399153B (en) | 2016-08-25 | 2016-08-25 | There is the bacillus and application thereof of tolerance to vanadium |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106399153A CN106399153A (en) | 2017-02-15 |
| CN106399153B true CN106399153B (en) | 2019-04-30 |
Family
ID=58004452
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610723745.XA Active CN106399153B (en) | 2016-08-25 | 2016-08-25 | There is the bacillus and application thereof of tolerance to vanadium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399153B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106903148B (en) * | 2017-03-13 | 2020-07-03 | 哈尔滨师范大学 | Method for repairing vanadium ore polluted soil by utilizing bacillus subtilis to strengthen rorifolia |
| EP3806837A4 (en) * | 2018-06-18 | 2021-09-08 | Reed Institute | Bacterial compositions and methods of polymer degradation using the same |
| CN110294534B (en) * | 2019-07-09 | 2020-12-11 | 中国地质大学（北京） | Microbial functional material and method for removing pentavalent vanadium in underground water |
| CN114317369B (en) * | 2022-01-07 | 2023-04-21 | 成都理工大学 | Bacillus and application thereof in reduction of pentavalent vanadium and hexavalent chromium |
| CN114292792B (en) * | 2022-01-07 | 2023-04-21 | 成都理工大学 | Bacillus isolated from soil and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104585502A (en) * | 2014-12-25 | 2015-05-06 | 陈程 | Method for recycling vanadium ions in vanadium-containing industrial sewage |
| CN105670955B (en) * | 2015-10-14 | 2020-05-19 | 四川农业大学 | Ochrobactrum MGJ11 and method for fixing heavy metal cadmium in soil by utilizing Ochrobactrum |
| CN105886425B (en) * | 2016-03-09 | 2019-04-12 | 中国地质科学院矿产综合利用研究所 | Bacillus and method for bioleaching scandium from scandium-containing mineral by using same |
-
2016
- 2016-08-25 CN CN201610723745.XA patent/CN106399153B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN106399153A (en) | 2017-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399153B (en) | There is the bacillus and application thereof of tolerance to vanadium | |
| CN106148239B (en) | There is the deep-sea Exiguobacterium sp and application thereof of tolerance to vanadium | |
| Mishra et al. | Novel fungal consortium for bioremediation of metals and dyes from mixed waste stream | |
| Gupta et al. | Isolation and characterization of heavy metal tolerant Gram-positive bacteria with bioremedial properties from municipal waste rich soil of Kestopur canal (Kolkata), West Bengal, India | |
| Trevors et al. | Cadmium transport, resistance, and toxicity in bacteria, algae, and fungi | |
| Neethu et al. | Heavy-metal resistance in Gram-negative bacteria isolated from Kongsfjord, Arctic | |
| Lopez et al. | Identification of bacteria isolated from an oligotrophic lake with pesticide removal capacities | |
| Abou-Shanab et al. | Chromate-tolerant bacteria for enhanced metal uptake by Eichhornia crassipes (Mart.) | |
| CN104531585B (en) | A kind of Dell's Ford bacterium and its application | |
| CN105670980B (en) | A kind of application of the microbial strains of restoration of soil polluted by heavy metal | |
| CN107090413B (en) | Glyphosate degradation bacterium and its processing heavy metal-glyphosate combined pollution in apply | |
| CN105802890B (en) | A kind of achromobacter CZ207 bacterial strain of preventing from heavy metal promoting growth of plants and application thereof | |
| CN108753667B (en) | Heavy metal tolerant enterobacter populus YG-14 | |
| Qing et al. | Detection, isolation, and identification of cadmium-resistant bacteria based on PCR-DGGE | |
| CN104357035B (en) | Biological bactericide for preventing and controlling SRB (sulfate reducing bacteria) in high-temperature water body and SRB inhibition method of bactericide | |
| CN112322550B (en) | Stenotrophomonas maltophilia and application thereof in heavy metal treatment | |
| CN105039212A (en) | Rhodococcus strain C3, microbial agent containing rhodococcus strain C3, and applications of rhodococcus strain C3 and microbial agent | |
| CN104371948B (en) | Microbacterium sp. strain and application thereof | |
| CN110106109B (en) | Bacillus welchii and application thereof | |
| CN103937704B (en) | One Achromobacter xylosoxidans and the application in heavy-metal ion removal thereof | |
| Kumar et al. | 16S rRNA molecular profiling of heavy metal tolerant bacterial communities isolated from soil contaminated by electronic waste | |
| CN104818234A (en) | Streptomycete with cadmium tolerant characteristic and application thereof | |
| CN104357366A (en) | Pseudomonas and application thereof | |
| CN104745515B (en) | A kind of acinetobacter calcoaceticus of degrading polycyclic aromatic hydrocarbons and its application | |
| CN103937703B (en) | One strain serratia marcescens M7a and the application in heavy-metal ion removal thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |