CN106399153A - Bacillus with tolerance to vanadium and use thereof - Google Patents
Bacillus with tolerance to vanadium and use thereof Download PDFInfo
- Publication number
- CN106399153A CN106399153A CN201610723745.XA CN201610723745A CN106399153A CN 106399153 A CN106399153 A CN 106399153A CN 201610723745 A CN201610723745 A CN 201610723745A CN 106399153 A CN106399153 A CN 106399153A
- Authority
- CN
- China
- Prior art keywords
- vanadium
- bacillus
- environment
- pfyn01
- heavy metal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 229910052720 vanadium Inorganic materials 0.000 title claims abstract description 96
- LEONUFNNVUYDNQ-UHFFFAOYSA-N vanadium atom Chemical compound [V] LEONUFNNVUYDNQ-UHFFFAOYSA-N 0.000 title claims abstract description 96
- 241000193830 Bacillus <bacterium> Species 0.000 title claims abstract description 14
- 241000194110 Bacillus sp. (in: Bacteria) Species 0.000 claims abstract description 34
- 231100000419 toxicity Toxicity 0.000 claims abstract description 20
- 230000001988 toxicity Effects 0.000 claims abstract description 20
- 239000007788 liquid Substances 0.000 claims abstract description 17
- 230000001580 bacterial effect Effects 0.000 claims description 25
- 241000894006 Bacteria Species 0.000 claims description 19
- 238000000034 method Methods 0.000 claims description 15
- 239000003795 chemical substances by application Substances 0.000 claims description 3
- 238000010348 incorporation Methods 0.000 claims description 2
- 239000002773 nucleotide Substances 0.000 claims description 2
- 125000003729 nucleotide group Chemical group 0.000 claims description 2
- 238000002360 preparation method Methods 0.000 claims description 2
- 229910001385 heavy metal Inorganic materials 0.000 abstract description 47
- 244000005700 microbiome Species 0.000 abstract description 10
- 229910052804 chromium Inorganic materials 0.000 abstract description 7
- 229910052793 cadmium Inorganic materials 0.000 abstract description 6
- 229910052745 lead Inorganic materials 0.000 abstract description 6
- 229910052759 nickel Inorganic materials 0.000 abstract description 6
- 229910052725 zinc Inorganic materials 0.000 abstract description 6
- 238000006243 chemical reaction Methods 0.000 abstract description 3
- 238000004321 preservation Methods 0.000 abstract description 2
- 231100000331 toxic Toxicity 0.000 abstract description 2
- 230000002588 toxic effect Effects 0.000 abstract description 2
- 239000003344 environmental pollutant Substances 0.000 abstract 1
- 239000002068 microbial inoculum Substances 0.000 abstract 1
- 231100000719 pollutant Toxicity 0.000 abstract 1
- 239000002609 medium Substances 0.000 description 15
- 239000000243 solution Substances 0.000 description 14
- 239000011651 chromium Substances 0.000 description 11
- 238000005516 engineering process Methods 0.000 description 9
- 239000012530 fluid Substances 0.000 description 9
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 8
- 230000000844 anti-bacterial effect Effects 0.000 description 8
- 239000007787 solid Substances 0.000 description 7
- 230000000694 effects Effects 0.000 description 6
- 238000002474 experimental method Methods 0.000 description 6
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 6
- 238000012549 training Methods 0.000 description 5
- 241000193755 Bacillus cereus Species 0.000 description 4
- 229940041514 candida albicans extract Drugs 0.000 description 4
- 150000001875 compounds Chemical class 0.000 description 4
- 239000001963 growth medium Substances 0.000 description 4
- 229910052751 metal Inorganic materials 0.000 description 4
- 239000002184 metal Substances 0.000 description 4
- 239000011780 sodium chloride Substances 0.000 description 4
- 239000006228 supernatant Substances 0.000 description 4
- 239000012137 tryptone Substances 0.000 description 4
- 239000012138 yeast extract Substances 0.000 description 4
- 238000010521 absorption reaction Methods 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 230000007613 environmental effect Effects 0.000 description 3
- 230000007062 hydrolysis Effects 0.000 description 3
- 238000006460 hydrolysis reaction Methods 0.000 description 3
- 238000011081 inoculation Methods 0.000 description 3
- 238000007254 oxidation reaction Methods 0.000 description 3
- 238000013081 phylogenetic analysis Methods 0.000 description 3
- 230000008569 process Effects 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 241000712450 Bacillus sp. cp-h36 Species 0.000 description 2
- 241000196324 Embryophyta Species 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 230000002159 abnormal effect Effects 0.000 description 2
- 239000002253 acid Substances 0.000 description 2
- 239000003638 chemical reducing agent Substances 0.000 description 2
- 229910052802 copper Inorganic materials 0.000 description 2
- 238000003912 environmental pollution Methods 0.000 description 2
- 239000008187 granular material Substances 0.000 description 2
- 230000036541 health Effects 0.000 description 2
- SZVJSHCCFOBDDC-UHFFFAOYSA-N iron(II,III) oxide Inorganic materials O=[Fe]O[Fe]O[Fe]=O SZVJSHCCFOBDDC-UHFFFAOYSA-N 0.000 description 2
- 238000009630 liquid culture Methods 0.000 description 2
- 231100000783 metal toxicity Toxicity 0.000 description 2
- 230000003647 oxidation Effects 0.000 description 2
- 239000002574 poison Substances 0.000 description 2
- 231100000614 poison Toxicity 0.000 description 2
- 238000000746 purification Methods 0.000 description 2
- 238000011084 recovery Methods 0.000 description 2
- 230000009467 reduction Effects 0.000 description 2
- 230000008439 repair process Effects 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 231100000167 toxic agent Toxicity 0.000 description 2
- MCPTUMJSKDUTAQ-UHFFFAOYSA-N vanadium;hydrate Chemical compound O.[V] MCPTUMJSKDUTAQ-UHFFFAOYSA-N 0.000 description 2
- 239000003643 water by type Substances 0.000 description 2
- 229920001817 Agar Polymers 0.000 description 1
- 244000063299 Bacillus subtilis Species 0.000 description 1
- 235000014469 Bacillus subtilis Nutrition 0.000 description 1
- 239000002028 Biomass Substances 0.000 description 1
- VYZAMTAEIAYCRO-UHFFFAOYSA-N Chromium Chemical compound [Cr] VYZAMTAEIAYCRO-UHFFFAOYSA-N 0.000 description 1
- CWYNVVGOOAEACU-UHFFFAOYSA-N Fe2+ Chemical compound [Fe+2] CWYNVVGOOAEACU-UHFFFAOYSA-N 0.000 description 1
- 108010010803 Gelatin Proteins 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 206010037423 Pulmonary oedema Diseases 0.000 description 1
- 238000012300 Sequence Analysis Methods 0.000 description 1
- BQCADISMDOOEFD-UHFFFAOYSA-N Silver Chemical compound [Ag] BQCADISMDOOEFD-UHFFFAOYSA-N 0.000 description 1
- 238000003723 Smelting Methods 0.000 description 1
- 229920002472 Starch Polymers 0.000 description 1
- 108010006785 Taq Polymerase Proteins 0.000 description 1
- 230000001154 acute effect Effects 0.000 description 1
- 239000008272 agar Substances 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 238000003915 air pollution Methods 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 238000009835 boiling Methods 0.000 description 1
- 230000000711 cancerogenic effect Effects 0.000 description 1
- 231100000315 carcinogenic Toxicity 0.000 description 1
- 230000001684 chronic effect Effects 0.000 description 1
- 239000003245 coal Substances 0.000 description 1
- 239000011248 coating agent Substances 0.000 description 1
- 238000000576 coating method Methods 0.000 description 1
- 238000010411 cooking Methods 0.000 description 1
- 239000010779 crude oil Substances 0.000 description 1
- 239000012531 culture fluid Substances 0.000 description 1
- 230000007850 degeneration Effects 0.000 description 1
- 230000001934 delay Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 239000003792 electrolyte Substances 0.000 description 1
- 239000000284 extract Substances 0.000 description 1
- 239000008273 gelatin Substances 0.000 description 1
- 229920000159 gelatin Polymers 0.000 description 1
- 235000019322 gelatine Nutrition 0.000 description 1
- 235000011852 gelatine desserts Nutrition 0.000 description 1
- 239000003292 glue Substances 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 229910052737 gold Inorganic materials 0.000 description 1
- 239000010931 gold Substances 0.000 description 1
- 239000004519 grease Substances 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 239000002054 inoculum Substances 0.000 description 1
- 229910017053 inorganic salt Inorganic materials 0.000 description 1
- 230000001788 irregular Effects 0.000 description 1
- 208000017169 kidney disease Diseases 0.000 description 1
- 231100000053 low toxicity Toxicity 0.000 description 1
- 229920002521 macromolecule Polymers 0.000 description 1
- 238000002844 melting Methods 0.000 description 1
- 230000008018 melting Effects 0.000 description 1
- 238000013048 microbiological method Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 230000000877 morphologic effect Effects 0.000 description 1
- 230000003505 mutagenic effect Effects 0.000 description 1
- 210000000653 nervous system Anatomy 0.000 description 1
- 239000003921 oil Substances 0.000 description 1
- 239000000049 pigment Substances 0.000 description 1
- 230000010181 polygamy Effects 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 238000001556 precipitation Methods 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 208000005333 pulmonary edema Diseases 0.000 description 1
- 238000005067 remediation Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 210000002345 respiratory system Anatomy 0.000 description 1
- 230000004044 response Effects 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000010865 sewage Substances 0.000 description 1
- 230000001568 sexual effect Effects 0.000 description 1
- 229910052709 silver Inorganic materials 0.000 description 1
- 239000004332 silver Substances 0.000 description 1
- 238000005245 sintering Methods 0.000 description 1
- 239000002893 slag Substances 0.000 description 1
- 239000002689 soil Substances 0.000 description 1
- 238000002798 spectrophotometry method Methods 0.000 description 1
- 238000004611 spectroscopical analysis Methods 0.000 description 1
- 238000001228 spectrum Methods 0.000 description 1
- 239000007921 spray Substances 0.000 description 1
- 235000019698 starch Nutrition 0.000 description 1
- 239000008107 starch Substances 0.000 description 1
- 230000000638 stimulation Effects 0.000 description 1
- 239000003440 toxic substance Substances 0.000 description 1
- 150000003681 vanadium Chemical class 0.000 description 1
- 239000011782 vitamin Substances 0.000 description 1
- 229940088594 vitamin Drugs 0.000 description 1
- 229930003231 vitamin Natural products 0.000 description 1
- 235000013343 vitamin Nutrition 0.000 description 1
- 150000003722 vitamin derivatives Chemical class 0.000 description 1
- 239000002699 waste material Substances 0.000 description 1
- 239000002351 wastewater Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F3/00—Biological treatment of water, waste water, or sewage
- C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F2101/00—Nature of the contaminant
- C02F2101/10—Inorganic compounds
- C02F2101/20—Heavy metals or heavy metal compounds
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Water Supply & Treatment (AREA)
- Environmental & Geological Engineering (AREA)
- Hydrology & Water Resources (AREA)
- Biodiversity & Conservation Biology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Processing Of Solid Wastes (AREA)
Abstract
The invention belongs to the field of microorganism, and particularly relates to a bacillus with tolerance to vanadium and use thereof. The technical problem to be solved by the bacillus is to provide a technical scheme for the bioremediation of environment polluted by heavy metals. The technical scheme for solving the technical problem is to provide Bacillus sp.PFYN01 with a preservation number of CCTCCNO:M2016174. The bacillus has high tolerance to vanadium, and is tolerant to Cd, Cr, Pb, Ni, Co, Zn and other heavy metals, and the tolerance to vanadium is as high as 2000mg / L. At the same time, the bacillus has the ability to reduce pentavalent vanadium to tetravalent vanadium in a basic medium, the conversion rate is 46.7%, the bacillus has the characteristic of reducing toxicity of high-valent vanadium in a solution, can especially be developed for use in microbial inoculums for removal of toxicity of vanadium in high vanadium toxic liquid environment containing other heavy metal pollutants, and has good application prospects in the bioremediation of the environment polluted by the heavy metals.
Description
Technical field
The invention belongs to microorganism field is and in particular to a kind of have bacillus cereuss of toleration and application thereof to vanadium.
Background technology
Heavy metal pollution is on the rise, a large amount of discharges of trade waste, agricultural effluent and sanitary sewage, heavy metal pollution
Thing is also discharged together, causes Heavy Metal Pollution in Water Environment.After heavy metal is discharged into environment it is not easy to degraded and can be in the environment
Permanence accumulates, and dealing with improperly of heavy metal will lead to discharge potentially large number of carcinogenic and mutagenic action toxic compounds, leads
Cause heavy metal pollution very serious to biological and environment hazardness, therefore, strengthen Heavy Metal Pollution Control, improve human health
Most important with ecology erroneous zone.
Vanadium is a kind of silver grey non-ferrous metal, has the features such as ductility, matter is hard, nonmagnetic, 1890 ± 10 DEG C of fusing point, boiling point
3380 DEG C, belong to the row of high-melting-point rare metal.Vanadium, because of its excellent physicochemical properties, has played important in industrial aspect
Irreplaceable effect, has the good reputation of metal " vitamin ".In recent years due to industrial discharge and anthropogenic discharge, lead to environment and life
In object, vanadium constantly accumulates, and causes the pollution of vanadium problem being on the rise.In the sintering of vanadium smelting and vanadium symbiotic ore, produce
Small granule, is easier to evaporate in air, causes air pollution of vanadium.Additionally, the spray of the burning of coal and oil, volcanic ash
Send out, the melting of old metal etc. all can produce pollution of vanadium.Vanadium has 2,3,4 and 5 valencys of oxidation state, and the toxicity of vanadium is with the increase of valence state
And increase, pentavalent vanadium toxicity highest.The chemical form entering the vanadium in air is mainly oxyvanadium compound, such as VO, V2O3、VO2With
V2O5Deng, these oxyvanadium compounds are contacted with other granules or compound in an atmosphere through various channels, produce synergism,
Often have more toxicity to biological.Vfanadium compound has stimulation, Acute inhalation V when sucking2O5Bronchopneumonia can be caused,
Even pulmonary edema.During chronic suction, nervous system and respiratory system can be damaged, more seriously lead to toxic type nephropathy and
Proteometabolism exception etc..
The problem that pollution of vanadium brings is increasingly severe, leads to a series of existence health event of animals and humans and hidden danger to be sent out
Raw, cause the great attention of countries in the world, and make corresponding laws and regulations, the strict discharge controlling vanadium, reduce by
The environmental pollution that vanadium causes.At present, administer and repair pollution of vanadium technology mainly using physical chemistry, bioremediation technology.Physico
Learn recovery technique despite certain effect, but be because suddenly, the answering of water body physicochemical property itself and internal structure composition
Polygamy, and expensive, complex operation, and easily cause the presence of the many restrictions sexual factor such as secondary pollution, cause mostly
Counting method is also in laboratory stage, and short-term is interior can't to be applied to actual pollution control.
Bioremediation technology is that have, using biology, a kind of modern times side that structure and chemical characteristic are curbed environmental pollution in itself
Method, reaches the heavy metal removing in environment or the purpose reducing heavy metal toxicity.Bioremediation of waters is mainly microorganism remediation
Technology, current the method has become as a hot issue in various countries' environmental engineering Science and Technology research field.Micro-
Bioremediation technology is that the effect such as the absorption of the heavy metal being had by certain micro-organisms itself, precipitation, conversion is clear to reach
Except the purpose of heavy metal in environment, or a kind of new technique reducing heavy metallic poison.Heavy metal pollution is being administered in microorganism
Multiple technologies in there is excellent performance, self structure and macromolecular substances absorption, fixing and inhale are passed through in microorganism first
Receive heavy metal and reach the purpose removing heavy metal in environment；Secondly the reduction-oxidation effect of microorganism heavy metal, changes a huge sum of money
The valence state belonging to, reduces the toxicity of heavy metal in environment with this；In addition some microorganisms and rhizosphere have synbiosiss, thus it is possible to vary
In soil, rhizosphere environment to be improving absorption and the fixation of plant heavy metal, thus reaching the purpose of repairing heavy metal pollution.
At present, also there is no good practical plan in terms of the biological restoration of vanadium.
Content of the invention
The technical problem to be solved in the present invention is that the biological restoration to contaminated by heavy metals environment provides technical scheme.This
The technical scheme that invention solves technical problem there is provided a kind of bacillus sp.PFYN01, and its preserving number is
CCTCC NO：M2016174.
This bacillus sp.PFYN01 is on April 5th, 2016 to China typical culture collection center
(CCTCC) biological deposits are submitted to, China typical culture collection center address is China. Wuhan. Wuhan University, preserving number is
CCTCC NO:M2016174.
Further, described bacillus sp.PFYN01, the corresponding nucleotides sequence of its 16sRNA is classified as SEQ
Shown in ID No.1.
Additionally, present invention also offers above-mentioned bacillus sp.PFYN01 is in removing environment vanadium toxicity
Purposes.Described purposes include independent vanadium abnormal or except vanadium extremely in addition to also have in Cd, Cr, Pb, Ni, Co, Zn a kind of to multiple gold
Belong to the purposes removing vanadium toxicity in abnormal environment.
Further, above-mentioned environment is liquid environment.
Meanwhile, present invention also offers a kind of vanadium toxicity removal agent.This vanadium toxicity removal agent is with above-mentioned bacillus cereuss
Bacillus sp.PFYN01 is prepared from for main active.
Additionally, a kind of present invention also offers method removing heavy metal vanadium toxicity in environment.The method includes following step
Suddenly：Introduce above-mentioned bacillus sp.PFYN01 in the environment by pollution of vanadium, incorporation way is for directly by institute
State strain growth and be introduced into growth in liquid environment to the bacterium solution of logarithmic (log) phase or by the preparation with described bacterial strain as main active,
To reach the purpose removing environment heavy metal vanadium toxicity.Described liquid environment pH value is 4～11.
Described bacterium solution can be prepared as follows：Above-mentioned bacillus sp.PFYN01 is trained basic
Cultivate in foster base, formula is tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L and pH 7.0, treats that it grows to
Logarithmic (log) phase, described logarithmic (log) phase bacterium solution is introduced in pollution of vanadium liquid environment, reaches the purpose removing environment vanadium toxicity.
Wherein, the treatment temperature in said method is 15～50 DEG C, and the preferred temperature of process is 30 DEG C about.
The beneficial effects of the present invention is：
1st, bacillus sp.PFYN01 provided by the present invention has higher toleration, Er Qieneng to vanadium
Enough other heavy metals such as enduring high-concentration Cr (800mg/L) and Pb (1200mg/L), its vanadium tolerance is more than 2000mg/L.With
When this bacterial strain Bacillus sp.PFYN01 pentavalent vanadium can be reduced into tetravalence for bacillus Bacillus reported first
Vanadium, provides microorganism resource for high pollution of vanadium environmental improvement.
2nd, the antibacterial that the present invention provides only need to provide simple C source, N source and inorganic salt can complicated Bu Tong with much money
Belong in culture environment and survive and grow, vitality is strong, fast growth, Biomass is big, various heavy is had higher resistance to
By property, tolerable concentration is high.
3rd, pentavalent vanadium can be reduced into tetravalence vanadium by vanadium biological reductant of the present invention in higher concentrations, also proper energy
Power is up to 46.67%.
4th, antibacterial of the present invention is resistant to heavy metal Cd, Cr, Pb, Ni, Co, Zn, especially the tolerance of vanadium is up to
2000mg/L, is also up to 1200mg/L to the tolerance of Pb.Based on the high tolerance to various heavy, it is easy to various extreme dirts
In dye water body, vanadium toxicant removes, and possesses simple, convenient, efficient advantage.
Brief description
Fig. 1, the bacterium colony photo of bacterial strain Bacillus sp.PFYN01, show colony characteristicses.
Fig. 2, the Phylogenetic Analysis tree of bacterial strain Bacillus sp.PFYN01.
Fig. 3, bacterial strain Bacillus sp.PFYN01 cultivate in the culture medium solution of LB containing vanadium after photo.Can be by after culture
The color of the culture medium solution of LB containing vanadium is changed into dark blue or tends to black it is seen that effectively pentavalent vanadium can be reduced into tetravalence vanadium.
Bacillus sp.PFYN01 of the present invention is on April 5th, 2016 to China typical culture collection
Biological deposits are submitted at center (CCTCC) to, and China typical culture collection center address is China. Wuhan. Wuhan University, preserving number
For CCTCC NO:M2016174.
Specific embodiment
The present invention gathers the pollution of vanadium water gathering in the drainage of city of Sichuan vanadium titano-magnetite Xi Zhaduichang, passes through
Screening, enrichment, separate and obtain one plant of antibacterial, identified, its 16sRNA gene order and bacillus sp.Cp-
H36 has 99% similarity, is named as bacillus sp.PFYN01.This antibacterial on April 5th, 2016 in
State's Type Tissue Collection submits biological deposits to, and preserving number is CCTCC NO:M2016174.
The suitable condition of culture of this bacterium is：Tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L and pH
7.0.Experiment proves high resistance to vanadium reducing microorganisms can be obtained using this bacterial strain, processes for vanadium-containing water.In addition this bacterium has
High resistance to heavy metal characteristic, can prepare extreme environment heavy metal toxicity remover；Particularly prepare removal Heavy Metals in Waters
The pentavalent vanadium of high poison in solution can be reduced into the tetravalence of low toxicity or other valence state vanadium by the biological reductant of vanadium toxicity.
The acquisition of embodiment 1 antibacterial and separation
1st, separation, the process of purification of bacterial：
(1) take water containing pollution of vanadium in the drainage of Sichuan city of Sichuan vanadium titano-magnetite western slag muck field, stand 2h, take
1mL supernatant is added in the fluid medium that 50mL vanadium containing heavy metal is 10mg/L, and 30 DEG C of 120rpm cultivate 4d；
(2) the fluid medium 1mL taking culture 4d in (1) is added to the liquid culture that 50mL vanadium containing heavy metal is 50mg/L
In base, 30 DEG C of 120rpm cultivate 4d；
(3) the fluid medium 1mL taking culture 4d in (2) is added to the liquid training that 50mL vanadium containing heavy metal is 100mg/L
In foster base, 30 DEG C of 120rpm cultivate 4d；
(4) the fluid medium 1mL taking culture 4d in (3) is added to the liquid training that 50mL vanadium containing heavy metal is 200mg/L
In foster base, 30 DEG C of 120rpm cultivate 4d；
(5) the fluid medium 1mL taking culture 4d in (4) is added to the liquid training that 50mL vanadium containing heavy metal is 400mg/L
In foster base, 30 DEG C of 120rpm cultivate 4d；
(6) the fluid medium 1mL taking culture 4d in (5) is added to the liquid training that 50mL vanadium containing heavy metal is 800mg/L
In foster base, 30 DEG C of 120rpm cultivate 4d；
(7) the aqueous supernatant liquid 1mL taking culture 4d in (6) coats containing V5+(20mg/L) on solid medium, 30 DEG C
Constant incubator is cultivated；
(8) after 48h picking growth single bacterium colony, more respectively repeatedly line growth, purification obtains resistance to vanadium single bacterium colony.Name
For PFYN01
Above-mentioned solid culture based formulas are：Tryptone 10g/L, yeast extract 5g/L, agar powder 15g/L, sodium chloride
10g/L and pH 7.0.
Aforesaid liquid culture medium prescription is：Tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L and pH
7.0, add variable concentrations vanadium (10,50,100,200,400,800mg/L).
Embodiment 2 ne ar feature and Biology identification
1. morphological characteristic
The monoclonal bacterium colony streak inoculation that picking embodiment 1 obtains, on LB solid medium, flat board is inverted in constant temperature
In incubator, 30 DEG C of culture 24h, observe its colonial morphology.Bacillus sp.PFYN01 forms sub-circular, and smooth surface is wet
Profit, edge is irregular, and quality is soft, milky, and pigment indiffusion, referring to Fig. 1.
2. physio-biochemical characteristics
By in the monoclonal colony inoculation of embodiment 1 gained to LB liquid minimal medium, trophophase of taking the logarithm
Bacillus sp.PFYN01 bacterial strain according to《Common bacteria system identification handbook》(east show pearl etc., 2001) carries out gram dye
Color, Starch Hydrolysis test, grease hydrolysis experiment, C.I. 13020. experiment, H2S experiment, gelatin hydrolysis test, sugared fermenting experiment, result
It is shown in Table 1..
Table 1 bacterial strain Bacillus sp.PFYN01 physio-biochemical characteristics
Note:"+", is positive or produces acid, and "-" is negative or does not produce acid.
3. 16sRNA characteristic and phylogenetic tree build
Extract bacterial genomes DNA go forward side by side performing PCR amplification, primer is antibacterial 16sRNA PCR universal primer (forward primer
(SEQ ID No.2)27F：5 '-AGAGTTTGATCCTGGCTCAG-3 ', downstream primer (SEQ ID No.3) 1492R：
CGGTTACCTTGTTACGACTTC), the rTaq enzyme that Taq polymerase produces for TaKaRa company, PCR system is：10 × PCR delays
Rush liquid 5 μ L, dNTP (2.5mmol/L) 4 μ L, 27F (10 μM) 1uL, 1492R (10 μM) 1uL, genomic DNA 1uL, ExTaq enzyme
(5U/uL) 0.2 μ L, plus redistilled water 37.8 μ L.
PCR response procedures are：1. 94 DEG C of denaturations 5min；2. 94 DEG C of degeneration 30s；3. 54 DEG C of annealing 30s；4. 72 DEG C of extensions
1min30s；5. 72 DEG C of extension 10min；6. 4 DEG C of preservations.Wherein repeat step 2., 3., 4. 34 times, then carry out step 5., 6..
PCR primer adopts 2.0% agarose gel electrophoresiies, cuts glue reclaim.Recovery product is prosperous biological public by Beijing ancient cooking vessel state
Department is sequenced.The sequence results of the 16sRNA recording are submitted to GenBank data base, and using Blastn by strain
The sequence of 16sRNA carries out sequence analysis with listed sequence in GenBank data base, carries out sequence ratio with ClustalX
Right, then Phylogenetic Analysis are carried out using Mega4.0 software.The Phylogenetic Analysis tree of this bacterial strain sees Fig. 2, its 16sRNA base
Because sequence and bacillus sp.Cp-h36 have 99% similarity, according to result, it is named as bacillus cereuss
Bacillus sp.PFYN01.
Embodiment 3：The maximum tolerated concentration of antibacterial heavy metal
The monoclonal bacterium colony that picking embodiment 1 obtains, is inoculated in LB fluid medium, 30 DEG C, 120rpm shaken cultivation
36h, collects bacterial concentration OD600For 1.2, bacterium solution is prepared gradient bacterium according to 1,10,100,1000,10000 dilution proportion
Liquid；And prepare variable concentrations heavy metal LB solid medium.Draw each concentration bacterium solution 50 μ L respectively to put down to various heavy metal concentrations
Plate coating uniformly, is cultivated at 30 DEG C, suppresses it substantially growth in 24h observed and recorded bacterial growth situation, 120h
Minimum heavy metal concentration, i.e. the maximum tolerated concentration of this bacterium.
Above-mentioned variable concentrations heavy metal solid medium be respectively LB solid medium in add Cr, Pb, Cu, Ni, Co,
Cd, Zn or V.It is 100mg/L, 200mg/L, 400mg/L, 800mg/L, 1600mg/L that Cr adds concentration；Pb adds concentration
100mg/L、200mg/L、400mg/L、800mg/L、1200mg/L、1600mg/L；Cu add concentration be 1mg/L, 2mg/L,
4mg/L、8mg/L、10mg/L、20mg/L、40mg/L；Ni add concentration be 10mg/L, 20mg/L, 40mg/L, 80mg/L,
160mg/L、200mg/L、320mg/L；Co add concentration be 10mg/L, 20mg/L, 40mg/L, 50mg/L, 100mg/L,
160mg/L；It is 10mg/L, 20mg/L, 40mg/L, 80mg/L, 100mg/L, 160mg/L that Cd adds concentration；Zn adds concentration
10mg/L、20mg/L、40mg/L、80mg/L、100mg/L、160mg/L；It is 50mg/L, 125mg/L, 250mg/ that V adds concentration
L、500mg/L、1000mg/L、2000mg/L.
Bacterial strain Bacillus sp.PFYN01 can be in the higher solid training of heavy metal Cd, Cr, Pb, Cu, Ni, Co, Zn content
Grow in foster base, result shows, this several heavy metal species is equal to V, Cd, Cr, Pb, Ni, Co, Zn for bacterial strain Bacillus sp.PFYN01
There is higher toleration, the resistance of bacterial strain Bacillus sp.PFYN01 heavy metal is：V>Pb>Cr>Ni>Zn=Cd>Co>
Cu.
Maximum tolerated concentration (the unit of table 2 bacterial strain Bacillus sp.PFYN01 heavy metal：mg/L)
Due to there being vanadium resistance to strain the affected report in Bacillus sp strain, we with identical or approximate experiment condition,
The vanadium toleration strain of bacillus Bacillus has been reported in relative analyses.Wherein Ilunga Kamika (2014) reports bacterium
Plant Bacillus licheniform, to vanadium, there is toleration, its toleration is 200mg/L (Effect of vanadium
toxicity at its different oxidation states on selected bacterial and
protozoan isolates in wastewater systems.Environmental Technology.35(16):
2075-2085), and the bacterial strain Bacillus sp.PFYN01 not of the same race of the present invention is up to 2000mg/L to vanadium toleration, significantly
Higher than the toleration to vanadium for the bacillus Bacillus licheniform.In addition, Jennifer (2004) reports spore
The toleration to vanadium for the Bacillus another strain Bacillus subtilis, its value reaches 5000mg/L, but, it is sensitive to chromium Cr,
Do not tolerate vanadium (Methods evaluating vanadium tolerance in bacteria isolated from
crude oil contaminated land.J.Microbiological Methods.58:87-100).And this test separates
Bacillus sp. new strains Bacillus sp.PFYN01 not only to vanadium, there is higher toleration, and be resistant to height
Other heavy metal such as Cr (800mg/L) of concentration and Pb (1200mg/L), for comprehensive utilization bacterial strain Bacillus
The pollution of vanadium water body that sp.PFYN01 repairs containing other heavy metals has good application prospect.
Embodiment 4：The reduction effect to pentavalent vanadium for the antibacterial
The monoclonal colony inoculation that picking embodiment 1 obtains in LB fluid medium, in 30 DEG C, 120rpm shaken cultivation
18h, obtains logarithmic (log) phase bacterium solution；Bacterium solution is accessed LB fluid medium (containing V by the volume fraction inoculum concentration according to 0.2%5+Concentration is
In 30mmol/L), shaken cultivation 48h；Then culture fluid 6000rpm is centrifuged 10min, extracting centrifugal liquid supernatant 10mL, presses
It is imbued with according to old《The spectrophotometric analyses of different valence state vanadium in electrolyte of vanadium redox battery》(spectroscopy and spectrum analyses, 2011,31
(10):2839-2842) method measures pentavalent vanadium and tetravalence vanadium concentration in supernatant.
Result shows, it is dark blue that bacterial strain Bacillus sp.PFYN01 can make the culture medium solution color of LB containing vanadium be changed into by Huang
Or tend to black, referring to Fig. 3.By V in spectrophotometry solution5+And V4+Content, records 4 valencys and 5 valency vanadium in solution total
Concentration is 25.6mmol/L, V4+Concentration be 14.0mmol/L, V5+Concentration be 11.6mmol/L, the vanadium of other 4.4mmol/L
It is changed into trivalent or divalent.Thus, bacterial strain Bacillus sp.PFYN01 can make V5+It is reduced into V4+, conversion ratio is 46.7%, significantly
Reduce vanadium toxicity in solution.This reduction characteristic to vanadium of bacterial strain Bacillus sp.PFYN01 is in bacillus Bacillus
In bacterial strain, there is not been reported.
Claims (6)
1. bacillus sp.PFYN01 it is characterised in that：Its preserving number is CCTCC NO：M2016174.
2. bacillus sp.PFYN01 according to claim 1 it is characterised in that：The correspondence of its 16sRNA
Nucleotides sequence is classified as shown in SEQ ID No.1.
3. purposes in removing environment vanadium toxicity for the bacillus sp.PFYN01 described in claim 1 or 2.
4. purposes according to claim 3 it is characterised in that：Described environment is liquid environment.
5. vanadium toxicity removal agent：It is characterized in that：It is with the bacillus described in claim 1 or 2 any one
Sp.PFYN01 is prepared from for main active.
6. remove the method for environment vanadium toxicity it is characterised in that having steps of：Right is introduced in the environment by pollution of vanadium
Require the bacillus sp.PFYN01 described in 1 or 2, incorporation way is directly to logarithmic (log) phase by described strain growth
Bacterium solution or the preparation with described bacterial strain as main active be introduced in liquid environment growth, described liquid environment pH value is 4
～11, reach the purpose removing environment vanadium toxicity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610723745.XA CN106399153B (en) | 2016-08-25 | 2016-08-25 | There is the bacillus and application thereof of tolerance to vanadium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610723745.XA CN106399153B (en) | 2016-08-25 | 2016-08-25 | There is the bacillus and application thereof of tolerance to vanadium |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106399153A true CN106399153A (en) | 2017-02-15 |
| CN106399153B CN106399153B (en) | 2019-04-30 |
Family
ID=58004452
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610723745.XA Expired - Fee Related CN106399153B (en) | 2016-08-25 | 2016-08-25 | There is the bacillus and application thereof of tolerance to vanadium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399153B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106903148A (en) * | 2017-03-13 | 2017-06-30 | 哈尔滨师范大学 | The method that navajoite contaminated soil is repaired using bacillus subtilis Qiangization Han dish |
| CN110294534A (en) * | 2019-07-09 | 2019-10-01 | 中国地质大学（北京） | The method of pentavalent vanadium in microbial function material and removal underground water |
| CN112702997A (en) * | 2018-06-18 | 2021-04-23 | 里德研究所 | Bacterial compositions and methods of using same for polymer degradation |
| CN114292792A (en) * | 2022-01-07 | 2022-04-08 | 成都理工大学 | Bacillus separated from soil and application thereof |
| CN114317369A (en) * | 2022-01-07 | 2022-04-12 | 成都理工大学 | Bacillus and application thereof in reduction of pentavalent vanadium and hexavalent chromium |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104585502A (en) * | 2014-12-25 | 2015-05-06 | 陈程 | Method for recycling vanadium ions in vanadium-containing industrial sewage |
| CN105670955A (en) * | 2015-10-14 | 2016-06-15 | 四川农业大学 | Ochrobacterum sp. MGJ11, and method of immobilizing heavy metal cadmium in soil therewith |
| CN105886425A (en) * | 2016-03-09 | 2016-08-24 | 中国地质科学院矿产综合利用研究所 | Bacillus and method for bioleaching scandium from scandium-containing mineral by using same |
-
2016
- 2016-08-25 CN CN201610723745.XA patent/CN106399153B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104585502A (en) * | 2014-12-25 | 2015-05-06 | 陈程 | Method for recycling vanadium ions in vanadium-containing industrial sewage |
| CN105670955A (en) * | 2015-10-14 | 2016-06-15 | 四川农业大学 | Ochrobacterum sp. MGJ11, and method of immobilizing heavy metal cadmium in soil therewith |
| CN105886425A (en) * | 2016-03-09 | 2016-08-24 | 中国地质科学院矿产综合利用研究所 | Bacillus and method for bioleaching scandium from scandium-containing mineral by using same |
Non-Patent Citations (1)
| Title |
|---|
| 马文漪: "微生物转化钒，改变V5+毒性的初步研究", 《南京大学学报》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106903148A (en) * | 2017-03-13 | 2017-06-30 | 哈尔滨师范大学 | The method that navajoite contaminated soil is repaired using bacillus subtilis Qiangization Han dish |
| CN106903148B (en) * | 2017-03-13 | 2020-07-03 | 哈尔滨师范大学 | Method for repairing vanadium ore polluted soil by utilizing bacillus subtilis to strengthen rorifolia |
| CN112702997A (en) * | 2018-06-18 | 2021-04-23 | 里德研究所 | Bacterial compositions and methods of using same for polymer degradation |
| CN110294534A (en) * | 2019-07-09 | 2019-10-01 | 中国地质大学（北京） | The method of pentavalent vanadium in microbial function material and removal underground water |
| CN114292792A (en) * | 2022-01-07 | 2022-04-08 | 成都理工大学 | Bacillus separated from soil and application thereof |
| CN114317369A (en) * | 2022-01-07 | 2022-04-12 | 成都理工大学 | Bacillus and application thereof in reduction of pentavalent vanadium and hexavalent chromium |
| CN114292792B (en) * | 2022-01-07 | 2023-04-21 | 成都理工大学 | Bacillus isolated from soil and application thereof |
| CN114317369B (en) * | 2022-01-07 | 2023-04-21 | 成都理工大学 | Bacillus and application thereof in reduction of pentavalent vanadium and hexavalent chromium |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106399153B (en) | 2019-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399153A (en) | Bacillus with tolerance to vanadium and use thereof | |
| Mishra et al. | Novel fungal consortium for bioremediation of metals and dyes from mixed waste stream | |
| CN106148239B (en) | There is the deep-sea Exiguobacterium sp and application thereof of tolerance to vanadium | |
| Gupta et al. | Isolation and characterization of heavy metal tolerant Gram-positive bacteria with bioremedial properties from municipal waste rich soil of Kestopur canal (Kolkata), West Bengal, India | |
| Neethu et al. | Heavy-metal resistance in Gram-negative bacteria isolated from Kongsfjord, Arctic | |
| CN104531585B (en) | A kind of Dell's Ford bacterium and its application | |
| CN105802890B (en) | A kind of achromobacter CZ207 bacterial strain of preventing from heavy metal promoting growth of plants and application thereof | |
| CN112322550B (en) | Stenotrophomonas maltophilia and application thereof in heavy metal treatment | |
| CN105274025B (en) | A kind of composite flora and its treatment process of heavy metal-polluted water process | |
| CN107099478A (en) | One plant of Lycoris aurea endogenetic bacteria bulkholderia cepasea HDXY 02 and its application | |
| CN102337229A (en) | Separation of heavy metal tolerant bacteria and application thereof in reclamation of gangue | |
| CN105039212A (en) | Rhodococcus strain C3, microbial agent containing rhodococcus strain C3, and applications of rhodococcus strain C3 and microbial agent | |
| CN108753667A (en) | Raw enterobacteria YG-14 in the willow of heavy metal tolerance | |
| CN105936884A (en) | Bosea sp. AS-1 strain capable of tolerating pollution of arsenic and antimony and oxidizing As(III) and applications thereof | |
| CN110106109B (en) | Bacillus welchii and application thereof | |
| Sim et al. | Discovering metal-tolerant endophytic fungi from the phytoremediator plant Phragmites | |
| CN102154143A (en) | Marine aerobic denitrifying halomonas strain HGMN422 and application thereof | |
| CN114292792B (en) | Bacillus isolated from soil and application thereof | |
| Pathom-Aree et al. | Performance of Actinobacteria isolated from rhizosphere soils on plant growth promotion under cadmium toxicity | |
| CN104818234A (en) | Streptomycete with cadmium tolerant characteristic and application thereof | |
| CN118256370A (en) | Soil remediation microbial agent with heavy metal resistance | |
| Ren et al. | Screening, characteristics and mechanism of Cd-tolerance Cunninghamella bertholletiae | |
| CN105670965B (en) | Strain with iron reduction capacity and application thereof | |
| CN110577908B (en) | Degradation strain of pyrethroid insecticide and application thereof | |
| Sridevi et al. | Multiple metal tolerance of Paenibacillus dentritiformis isolated from metal contaminated soils west Godavari district (Andhra Pradesh): Mutltiple metal tolerance of Paenibacillus dentritiformis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190430 |